ID: 1029440816

View in Genome Browser
Species Human (GRCh38)
Location 7:100585825-100585847
Sequence GGGTGGGGCTATGCAAATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 163}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029440789_1029440816 30 Left 1029440789 7:100585772-100585794 CCCTGGCCGCCAGGTGAAGGGGC 0: 1
1: 0
2: 1
3: 17
4: 183
Right 1029440816 7:100585825-100585847 GGGTGGGGCTATGCAAATGAGGG 0: 1
1: 0
2: 2
3: 22
4: 163
1029440794_1029440816 21 Left 1029440794 7:100585781-100585803 CCAGGTGAAGGGGCGGGCCCGAC 0: 1
1: 0
2: 0
3: 10
4: 73
Right 1029440816 7:100585825-100585847 GGGTGGGGCTATGCAAATGAGGG 0: 1
1: 0
2: 2
3: 22
4: 163
1029440803_1029440816 3 Left 1029440803 7:100585799-100585821 CCGACTCCCGGGCCGGGCGGGGC 0: 1
1: 0
2: 3
3: 29
4: 260
Right 1029440816 7:100585825-100585847 GGGTGGGGCTATGCAAATGAGGG 0: 1
1: 0
2: 2
3: 22
4: 163
1029440812_1029440816 -9 Left 1029440812 7:100585811-100585833 CCGGGCGGGGCCCGGGGTGGGGC 0: 1
1: 1
2: 7
3: 100
4: 713
Right 1029440816 7:100585825-100585847 GGGTGGGGCTATGCAAATGAGGG 0: 1
1: 0
2: 2
3: 22
4: 163
1029440806_1029440816 -3 Left 1029440806 7:100585805-100585827 CCCGGGCCGGGCGGGGCCCGGGG 0: 1
1: 0
2: 21
3: 190
4: 1214
Right 1029440816 7:100585825-100585847 GGGTGGGGCTATGCAAATGAGGG 0: 1
1: 0
2: 2
3: 22
4: 163
1029440808_1029440816 -4 Left 1029440808 7:100585806-100585828 CCGGGCCGGGCGGGGCCCGGGGT 0: 1
1: 0
2: 6
3: 79
4: 574
Right 1029440816 7:100585825-100585847 GGGTGGGGCTATGCAAATGAGGG 0: 1
1: 0
2: 2
3: 22
4: 163
1029440793_1029440816 24 Left 1029440793 7:100585778-100585800 CCGCCAGGTGAAGGGGCGGGCCC 0: 1
1: 0
2: 1
3: 20
4: 156
Right 1029440816 7:100585825-100585847 GGGTGGGGCTATGCAAATGAGGG 0: 1
1: 0
2: 2
3: 22
4: 163
1029440790_1029440816 29 Left 1029440790 7:100585773-100585795 CCTGGCCGCCAGGTGAAGGGGCG 0: 1
1: 0
2: 0
3: 8
4: 164
Right 1029440816 7:100585825-100585847 GGGTGGGGCTATGCAAATGAGGG 0: 1
1: 0
2: 2
3: 22
4: 163
1029440801_1029440816 4 Left 1029440801 7:100585798-100585820 CCCGACTCCCGGGCCGGGCGGGG 0: 1
1: 0
2: 4
3: 29
4: 312
Right 1029440816 7:100585825-100585847 GGGTGGGGCTATGCAAATGAGGG 0: 1
1: 0
2: 2
3: 22
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029440816 Original CRISPR GGGTGGGGCTATGCAAATGA GGG Intronic
900146256 1:1160168-1160190 GGGTGGAGCTTTGGAACTGATGG + Intergenic
900489865 1:2942518-2942540 GGGAGGGGCCAAGCACATGAGGG - Intergenic
900750517 1:4394053-4394075 GGGGGAGGCTGTGCAAATGTGGG + Intergenic
901130952 1:6962429-6962451 GGGTGGGGCTATAGAAAGGGTGG - Intronic
902756506 1:18552691-18552713 GGTTGGGGCTAAGCAGCTGATGG - Intergenic
903776824 1:25799159-25799181 TGGTGGGGCTCTGCAAAGGCAGG + Intergenic
905865763 1:41375735-41375757 GGGTGGGGGACAGCAAATGAGGG + Intronic
907097940 1:51798855-51798877 GGGTGGGGTTGTGGAAATGGGGG - Intronic
907398698 1:54210718-54210740 GGTTGTGGCTATGACAATGAAGG - Intronic
907827841 1:58036030-58036052 GGGTGGGGCTATAGGAATGAGGG + Intronic
912952742 1:114131656-114131678 GGGCTGGGCTATGGAAAGGAAGG - Intronic
913482629 1:119303561-119303583 GGGTTGGGCTATGCATGGGAAGG - Intergenic
913559609 1:120004434-120004456 GGGTGGAGCTAAGGGAATGATGG + Intronic
913638251 1:120786107-120786129 GGGTGGAGCTAAGGGAATGATGG - Intergenic
914280197 1:146163855-146163877 GGGTGGAGCTAAGGGAATGATGG + Intronic
914541242 1:148614794-148614816 GGGTGGAGCTAAGGGAATGATGG + Intronic
914625398 1:149456451-149456473 GGGTGGAGCTAAGGGAATGATGG - Intergenic
917122033 1:171652769-171652791 GGGTGGGGCTGTGCACAGGGGGG + Intergenic
921014851 1:211179833-211179855 GGGTGGGGCTGGGGAAAGGATGG - Intergenic
923770903 1:236936797-236936819 GGGTTGGGGTATGGAAATAAGGG + Intergenic
1063130505 10:3173225-3173247 GGGTGGGGCTGTGCAAGTGATGG + Intergenic
1063894984 10:10670512-10670534 GTGGGAGGCTATGCAAATGTGGG - Intergenic
1064531549 10:16315447-16315469 TGATGGGGCTATGGAAAAGATGG - Intergenic
1065869989 10:29947911-29947933 GGGTGGCTCAATGCAACTGATGG + Intergenic
1067449978 10:46376163-46376185 GGGTGGGGCCACTCAAAGGAGGG + Intronic
1067587266 10:47483600-47483622 GGGTGGGGCCACTCAAAGGAGGG - Intronic
1067634324 10:47991367-47991389 GGGTGGGGCCACTCAAAGGAGGG - Intergenic
1067832195 10:49616690-49616712 GGCTGGGGCCAGGCAAATGCTGG - Intronic
1069575809 10:69527830-69527852 GGGTGGGGATAGGAAAATTAGGG + Intergenic
1071600828 10:86958061-86958083 GGGTGGGGGTGGGGAAATGAAGG - Intronic
1077166525 11:1142614-1142636 GGGTGGAGCTCTACAAATGTTGG - Intergenic
1079133697 11:17764080-17764102 GTGGGGGGCTATGCAAGTGTAGG - Intronic
1084451514 11:69241583-69241605 GGATGGGCCCATGCAAATGAAGG - Intergenic
1088050570 11:105509485-105509507 GGGTGGGGATATGCAGATCCAGG - Intergenic
1090628262 11:128624537-128624559 GGGTGGGGGGATGCCAATGCAGG + Intergenic
1092182110 12:6453054-6453076 GGGTGGGGCTCTGCAGACAAAGG - Exonic
1095359591 12:41320102-41320124 AGGTGGGGCTGTGCAGAAGATGG - Intronic
1097079712 12:56421150-56421172 GGTTGGGGGAATGAAAATGAAGG + Intronic
1097234110 12:57528229-57528251 GGGTGGGGCTAAGGCACTGAGGG - Exonic
1099415587 12:82381950-82381972 GGGAGGGGGTTTTCAAATGAAGG + Intronic
1101752477 12:107593801-107593823 GGGTGGGGCCATGCAGAGGAAGG - Intronic
1102545334 12:113650412-113650434 GTGTGGGGCTCTGCAGGTGAGGG + Intergenic
1104725137 12:131071187-131071209 GGGTGGGGCTAAGCGAAAGGAGG + Intronic
1105379620 13:19874924-19874946 GGGTGAGGCTATGGAAAAAAGGG + Intergenic
1109256963 13:60095430-60095452 GGGTGGGTCAATGTAAATTAAGG + Intronic
1112424027 13:99280105-99280127 GAGTGGGGCAGTGCAGATGATGG - Intronic
1113574229 13:111382754-111382776 GGGTGGGGTTATGGAGATGGTGG + Intergenic
1113735107 13:112672764-112672786 GGGTGGGGCTTTGCAAAAAACGG + Intronic
1116723336 14:48528883-48528905 GGGTGAGGCTATGCATGTGTGGG - Intergenic
1117226061 14:53660337-53660359 GGGTGTGTCTATGCAAATGTGGG - Intergenic
1120813730 14:88831303-88831325 GGGTGGGCCAATGCAAATTAGGG - Intronic
1121559227 14:94862195-94862217 GGATGGGACTATGCAAATCATGG + Intergenic
1123151192 14:106183559-106183581 GGGTGGGGCTATTCATATTTGGG - Intergenic
1123399606 15:19971445-19971467 GGGTGGGGCTATTCATATTTGGG - Intergenic
1126086401 15:45014504-45014526 GGGTAGGGAAATGCAGATGAAGG - Intergenic
1127166309 15:56247096-56247118 GGATTGGGCTAGGAAAATGAGGG - Intronic
1127254900 15:57281575-57281597 GGATGTGGAGATGCAAATGATGG - Intronic
1130453783 15:84083253-84083275 GGGTTGGAGTAAGCAAATGAGGG - Intergenic
1131071086 15:89466399-89466421 GGGTTGGGCTATACACAAGAAGG - Intergenic
1131221200 15:90585761-90585783 AGGTGGGGATAGGCAAAGGAAGG - Intronic
1131491865 15:92870064-92870086 GGGGAGGGCTGTGCAAATGTGGG + Intergenic
1132999282 16:2841011-2841033 GAGTGGGGCTCTGAAAGTGAGGG + Intergenic
1133021379 16:2968445-2968467 GCGTGTGTCCATGCAAATGAAGG + Intronic
1134434034 16:14238329-14238351 GGGGGGGACTGTGCAAGTGAGGG + Intronic
1134610782 16:15606368-15606390 GGGTGTGGCTATGCAGGTGTCGG - Intronic
1135235379 16:20750372-20750394 GGGTGAGGCTATTGAAATGTGGG + Intronic
1136866006 16:33754534-33754556 GGGGGGAGCTATGCATGTGAGGG + Intergenic
1138550036 16:57742691-57742713 GGGTGTGGCTAAGCTAATTACGG - Intronic
1140691078 16:77484444-77484466 GGGTGGGGGCATGCAAATACTGG - Intergenic
1141407594 16:83807843-83807865 GGGAGGGGCTATGCGAAAGAAGG + Exonic
1141763427 16:86043821-86043843 GGTTGGAGCCATGCAATTGAGGG + Intergenic
1142307265 16:89292791-89292813 AGGTGTGGCTACGCCAATGATGG - Intronic
1203106149 16_KI270728v1_random:1361569-1361591 GGGGGGAGCTATGCATGTGAGGG - Intergenic
1203127365 16_KI270728v1_random:1600799-1600821 GGGGGGAGCTATGCATGTGAGGG + Intergenic
1144274923 17:13657143-13657165 GGGTAGGGATTTGAAAATGAAGG - Intergenic
1145752912 17:27367945-27367967 GGCTGGGGCTTGGCACATGACGG - Intergenic
1152757104 17:82091624-82091646 GGTTGGGGCTATGGAAGTGCAGG + Exonic
1153095071 18:1391757-1391779 GGGAGGGGCTAAGGGAATGAAGG - Intergenic
1155021428 18:21900577-21900599 TGGAGGGCCTGTGCAAATGAGGG + Intergenic
1161837296 19:6656545-6656567 GGGTGAGGGACTGCAAATGAAGG + Intergenic
1162001767 19:7749111-7749133 GGGTGGGTCAATGCAAATTGAGG - Intergenic
1163775891 19:19217326-19217348 GGGTGGAGCGATGGAAATAAAGG + Intronic
1163961043 19:20693101-20693123 GGGTGGGGGTAGGTTAATGAGGG - Intronic
1166148759 19:40855456-40855478 GGGTGGGGCTGTGGGAATGTTGG + Intronic
1166152899 19:40887241-40887263 GGGTGGGGCTGTGGGAATGTTGG + Intronic
1166177324 19:41083663-41083685 GGGTGGGGCTATGGGAATGTTGG - Intergenic
1166944918 19:46390650-46390672 GGGAGGAGCCATGCAAATGAGGG - Exonic
925517304 2:4697305-4697327 TTGTGGGGATATGCAAATGACGG - Intergenic
925594018 2:5537478-5537500 GGGGAGCGCTATGTAAATGAGGG + Intergenic
926621042 2:15047641-15047663 GGCTGGGCCTGTGCAGATGAAGG + Intergenic
927907776 2:26873606-26873628 CAGTTGGGGTATGCAAATGATGG + Intronic
929910968 2:46089304-46089326 GTGTGGGGCTCTGGAAATAATGG - Intronic
930863709 2:56102497-56102519 GGGTGGGCCAATGCAAATTGAGG - Intergenic
931900796 2:66785690-66785712 GGGTGAGGCTGTGCATATGTTGG + Intergenic
933486888 2:82935445-82935467 GGGTGGGTCAATGCAAATTGAGG - Intergenic
933844383 2:86313778-86313800 AGGTGGGGCTAGGCAGATCAGGG + Intronic
934092759 2:88567753-88567775 TGGTGGGGCTAGGCCAGTGAGGG - Intronic
934634519 2:95971398-95971420 GGGGGGAGCTATGCATGTGAGGG + Intronic
934799114 2:97133837-97133859 GGGGGGAGCTATGCACGTGAGGG - Intronic
935120316 2:100178395-100178417 GGGTGGGCCAATGCAAATCAAGG - Intergenic
937472106 2:122183021-122183043 GGTTGGGGCTCTGCTATTGATGG + Intergenic
937862269 2:126720476-126720498 GGGTGAGTCTCTGAAAATGAAGG - Intergenic
939606414 2:144260345-144260367 GGGTGTGGGTATGCAGAAGAGGG + Intronic
941717431 2:168778849-168778871 GGGGGAGGCTATGCAAGTGTGGG + Intergenic
942067030 2:172281142-172281164 GGAAGGGCCCATGCAAATGAAGG + Intergenic
942912507 2:181262719-181262741 GGGTGAGGCTATGGCAAAGAGGG + Intergenic
943951469 2:194135475-194135497 GGGTCGGGGTATGGAAATAAGGG + Intergenic
947564308 2:231184311-231184333 TGGAGGGGATATGAAAATGAAGG - Intergenic
947966689 2:234288046-234288068 TGATGAGGCTATGCAAAAGAGGG + Intergenic
1168885636 20:1252013-1252035 AGTTGGAGGTATGCAAATGAGGG - Intronic
1169215898 20:3794778-3794800 GGGTGGGCCAATGCATCTGAAGG - Intronic
1173403820 20:42747769-42747791 GGGTGGGGCATTACAAATCAAGG + Intronic
1177745214 21:25204459-25204481 AGGTGGGGCTTTGCAAACTATGG + Intergenic
1181324877 22:22037054-22037076 GGGTGGGGCTGGGCAGATGAGGG - Intergenic
1181836453 22:25613984-25614006 GGGTGGGGCGATGATAATTATGG - Intronic
1183056831 22:35311944-35311966 GGGTGGGGCTTAGAAGATGAGGG + Intronic
1183169212 22:36172997-36173019 GGGTGTGGTCATGAAAATGAAGG - Intergenic
950077653 3:10198647-10198669 GTGTGGTGCTATGCAAATTTAGG + Intronic
952314045 3:32217054-32217076 GGAAGGGGCTGTGCAATTGAGGG + Intergenic
957676424 3:83372785-83372807 GGGAGAGGCTATGCATATGCAGG + Intergenic
958009419 3:87857654-87857676 GGGGGAGGCTATGCATATGTGGG - Intergenic
959561624 3:107789013-107789035 GGGTGGGGCTATGCCATGGGTGG + Intronic
959633043 3:108530649-108530671 GGGTGAGGCTATGCATGTGTAGG + Intergenic
960524580 3:118695218-118695240 GGAAGGGGCCAGGCAAATGAAGG - Intergenic
965187290 3:165481820-165481842 GAGTTGGCCTATGGAAATGATGG + Intergenic
968566391 4:1315819-1315841 GGGTGGGGACATGCACATGGGGG - Intronic
973069928 4:45845489-45845511 GGGTTGAGCTATGGAAATGGAGG + Intergenic
974836422 4:67256658-67256680 GGGTGGGTCAATGCAAATTAAGG + Intergenic
977564324 4:98566347-98566369 GGGTGGGGGTGGGGAAATGAGGG + Intronic
978440627 4:108729921-108729943 GGGTGGGGCAATGCATATGGAGG + Intergenic
982069806 4:151685393-151685415 GAGTGGGGCTCTGCACCTGATGG + Intronic
984754392 4:183312462-183312484 GGATGGGGCTATTCACCTGAAGG - Exonic
984835914 4:184020854-184020876 TGGTTGGGCTATGAAAAAGAGGG - Exonic
986571220 5:9168123-9168145 GGGTGGGGATCTGAAAAGGAAGG + Intronic
988611829 5:32734195-32734217 GGGTGGGGGTAAGCCAAGGAAGG + Intronic
988936640 5:36090059-36090081 GGGTGGCCCAATGCAAATTAAGG + Intergenic
993881699 5:93370545-93370567 GGGTGGAGCTATGCATGTGTAGG - Intergenic
994851115 5:105056867-105056889 GGGTGCAGCTATGCGAAGGAGGG - Intergenic
996221905 5:120943279-120943301 GAATGTGGCTATGGAAATGAAGG + Intergenic
997065446 5:130554186-130554208 GGGTGGGTCAATGCAAATTGAGG - Intergenic
999497713 5:152116432-152116454 GGGAAGGCCTATGCAACTGATGG + Intergenic
1000222925 5:159231528-159231550 GGGTGGTGCTTTGCAAATGGTGG + Intergenic
1001144201 5:169169839-169169861 TGGTGGGGCTTTGCAAATAGAGG - Intronic
1001247419 5:170115193-170115215 AGGGGGGGCTATGAGAATGAGGG + Intergenic
1001347082 5:170913342-170913364 GGGTGGGTGAATGCAAATGATGG + Intronic
1001569743 5:172722629-172722651 GGATGGGGGGATGCAAATGCTGG - Intergenic
1001679942 5:173549103-173549125 GAGTGGGACTGTGCAAATGGAGG - Intergenic
1006180776 6:32152168-32152190 GGGTGGGACTAAGGAAAGGAAGG + Intronic
1008535408 6:52503334-52503356 GGGTGGGGCCAGGCCAAGGAAGG + Intronic
1011545406 6:88477438-88477460 GGGTGGGTTAATGCAAATCAAGG + Intergenic
1018417690 6:163615339-163615361 GGGTGGGGCTGAGCAGCTGAAGG + Intergenic
1019636819 7:2080530-2080552 GGGAGGCGCTCTGCACATGAGGG - Intronic
1022031947 7:26499775-26499797 GGGTGGGGTGAGGCAAATCAAGG - Intergenic
1023473247 7:40548609-40548631 GGGTGGGGGAATGCTGATGACGG - Intronic
1024249728 7:47496869-47496891 GGGTGAGCCTGTGCAAATGCAGG + Intronic
1028317910 7:89427065-89427087 GGGTGGGTCAATGCAAATTGGGG + Intergenic
1029440816 7:100585825-100585847 GGGTGGGGCTATGCAAATGAGGG + Intronic
1033447931 7:141438280-141438302 GAGTGGTCCTATGCACATGACGG - Intronic
1035648321 8:1245574-1245596 GGCTGGGGGCATGGAAATGAGGG + Intergenic
1036257316 8:7216356-7216378 GGTTGAGGCTGTGGAAATGACGG - Intergenic
1036309362 8:7674952-7674974 GGTTGAGGCTGTGGAAATGACGG - Intergenic
1036360177 8:8071167-8071189 GGTTGAGGCTGTGGAAATGACGG + Intergenic
1037088215 8:14879548-14879570 AGGAGGGGCTATGTCAATGAGGG + Intronic
1037395461 8:18437077-18437099 GGGTGGTGGTCTGCAAAGGAAGG - Intergenic
1040908466 8:52493251-52493273 GGAAGGGGCCATGCAAATAAAGG - Intergenic
1041093290 8:54324944-54324966 GGGGGAGGCTATGCATATGTGGG + Intergenic
1041670347 8:60485455-60485477 GGGTGGGGCAAAGCAAGAGAGGG + Intergenic
1045992041 8:108319393-108319415 GGGGGAGGCTATGCAAATGTGGG - Intronic
1050196769 9:3093108-3093130 GGGTGAGGCTATGCATGTGTTGG + Intergenic
1050567264 9:6899243-6899265 GTGGGGGGCTATGCACATGTGGG - Intronic
1053162195 9:35820862-35820884 GGGTGGTGCTGTGCAACTGAGGG + Intronic
1053411863 9:37920986-37921008 TGCTGGGGCTAGGCAAATGCTGG - Intronic
1057366668 9:94428577-94428599 GGGGGGGGGTATGCATATGTAGG - Intronic
1057383680 9:94590045-94590067 GGGTGGGGTTAGGCGGATGAGGG - Intronic
1057656665 9:96959485-96959507 GGGGGGGGGTATGCATATGTAGG + Intronic
1060169393 9:121448727-121448749 GGGTGGGGCTGTGCAAATGTGGG - Intergenic
1060879830 9:127110325-127110347 GGGTGGCGCTCTGGAAAGGAAGG - Intronic
1061903262 9:133683808-133683830 GGGTGGGGAAATGCTAAGGAAGG - Intronic
1186646105 X:11508742-11508764 GGGTGGGGCTGAGGAAGTGATGG - Intronic
1189239228 X:39512835-39512857 GGCTGGGACTAGGAAAATGATGG - Intergenic
1191238073 X:58152340-58152362 GGGTGGGGGTAGGTTAATGAGGG + Intergenic
1192467321 X:71366527-71366549 GGGTGGGGCTAAGCAGAGGAAGG + Intronic
1196379265 X:115070950-115070972 GGGGGGGGCTGTGGAAATGAAGG - Intergenic
1196441234 X:115721898-115721920 GGGAGGGGAGATGCAAATAAAGG - Intergenic
1196444763 X:115839885-115839907 GGGAGGGGAGATGCAAATAAAGG - Intergenic
1198502377 X:137264267-137264289 GGGGGAGGCTATGCATATGTAGG + Intergenic
1199532426 X:148865502-148865524 GGGTTTGGTGATGCAAATGAGGG - Intronic
1199702490 X:150392863-150392885 GGGGGAGGCTATGCACATGAAGG - Intronic