ID: 1029443499

View in Genome Browser
Species Human (GRCh38)
Location 7:100600832-100600854
Sequence AGCCCTCTGCAGCATGTCCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 1, 2: 2, 3: 18, 4: 192}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029443499_1029443508 0 Left 1029443499 7:100600832-100600854 CCCTGGACATGCTGCAGAGGGCT 0: 1
1: 1
2: 2
3: 18
4: 192
Right 1029443508 7:100600855-100600877 GAAGGAGGCGGGGGTGGTGTAGG 0: 1
1: 0
2: 9
3: 116
4: 1259
1029443499_1029443505 -10 Left 1029443499 7:100600832-100600854 CCCTGGACATGCTGCAGAGGGCT 0: 1
1: 1
2: 2
3: 18
4: 192
Right 1029443505 7:100600845-100600867 GCAGAGGGCTGAAGGAGGCGGGG 0: 1
1: 0
2: 6
3: 78
4: 653
1029443499_1029443509 1 Left 1029443499 7:100600832-100600854 CCCTGGACATGCTGCAGAGGGCT 0: 1
1: 1
2: 2
3: 18
4: 192
Right 1029443509 7:100600856-100600878 AAGGAGGCGGGGGTGGTGTAGGG 0: 1
1: 0
2: 2
3: 41
4: 515
1029443499_1029443506 -9 Left 1029443499 7:100600832-100600854 CCCTGGACATGCTGCAGAGGGCT 0: 1
1: 1
2: 2
3: 18
4: 192
Right 1029443506 7:100600846-100600868 CAGAGGGCTGAAGGAGGCGGGGG 0: 1
1: 1
2: 4
3: 69
4: 667
1029443499_1029443507 -6 Left 1029443499 7:100600832-100600854 CCCTGGACATGCTGCAGAGGGCT 0: 1
1: 1
2: 2
3: 18
4: 192
Right 1029443507 7:100600849-100600871 AGGGCTGAAGGAGGCGGGGGTGG 0: 1
1: 0
2: 5
3: 115
4: 1250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029443499 Original CRISPR AGCCCTCTGCAGCATGTCCA GGG (reversed) Exonic
902585314 1:17435553-17435575 AGCCCTCTGCCCCTTGTCCTGGG - Intronic
903579933 1:24363171-24363193 AGCCTTCTGCAGGCTGTCCTTGG - Intronic
904557491 1:31374707-31374729 AGCCAGCAGCAGCCTGTCCAGGG + Intronic
904748946 1:32728925-32728947 AGCCCTCCCCAGCATCCCCATGG - Intergenic
905358155 1:37399206-37399228 AGCACTCTGGAGTCTGTCCAGGG + Intergenic
906499379 1:46330223-46330245 AGCTCTCTGCATCATGAACAAGG - Intergenic
907198620 1:52707141-52707163 AGCTCACTGCAGCATGCTCATGG + Intergenic
907412013 1:54289792-54289814 CGCCCCCTGCACCATCTCCAGGG + Intronic
909937173 1:81565528-81565550 AAACCTCTGCAGCATGGTCAAGG - Intronic
910771025 1:90832819-90832841 AGCTTTCTGCAGCATTTCCCTGG + Intergenic
915457165 1:156048539-156048561 TGCCCTCCGCCGCATGTACACGG - Exonic
918446568 1:184622900-184622922 AGCCCCCAGGAGCAGGTCCAGGG + Exonic
919124641 1:193379959-193379981 AAGGCTCTGCAGCAGGTCCAGGG - Intergenic
921887047 1:220317443-220317465 ATCCCTCTGCAGGAAGGCCATGG - Intergenic
923305617 1:232685629-232685651 AGCCCTCTATAGGATTTCCATGG + Intergenic
924114997 1:240736385-240736407 AGCCCTCTGCACCATGATCCTGG - Intergenic
924928296 1:248704876-248704898 AGAGCTCTGGAACATGTCCAGGG - Intergenic
1063376120 10:5555483-5555505 AGCCCCCTGCCCCAGGTCCAGGG + Intergenic
1064612767 10:17120673-17120695 ACCACTCTGCAGCATGTCAGAGG - Intronic
1066279293 10:33899355-33899377 TGACCTCTGCTGCATTTCCAAGG - Intergenic
1067178289 10:43965893-43965915 TGCCCTATGATGCATGTCCACGG + Intergenic
1067844530 10:49709388-49709410 TGGCCTCGGCAGCATGACCATGG + Exonic
1070685266 10:78475885-78475907 AGCCCACTGCTGCTGGTCCATGG + Intergenic
1070841850 10:79492849-79492871 AGGCCTCTTCATCATGTCCCAGG + Intergenic
1070982892 10:80664319-80664341 ATCCCTCTGCAGCCTTTCCTGGG - Intergenic
1071516519 10:86301222-86301244 GGCCCCCAGCAGCAGGTCCAAGG - Intronic
1073318590 10:102600056-102600078 AGGCCTCTGCTGCCTGTCCAGGG + Intronic
1074080255 10:110162916-110162938 TGCCCTCTGCATCACCTCCAGGG - Intergenic
1074451239 10:113561468-113561490 AGACCTCTGTACCATGGCCATGG - Intronic
1074525333 10:114258111-114258133 ACCCTTCTGCAGCATGCCAAGGG - Intronic
1075062930 10:119269385-119269407 AACCCTCGGCTGCATGTTCAGGG - Intronic
1075102512 10:119516363-119516385 TGCCCTTTGCTGCATGTCCAGGG - Intronic
1076476683 10:130758545-130758567 AGCCTTCTGCAGAATGGACAGGG - Intergenic
1077080359 11:722210-722232 AGGCCTCTGCAGCATCTCCCCGG + Intronic
1077168678 11:1156733-1156755 ACCCCTCTGCAGCAGGACAAAGG + Intergenic
1077907833 11:6547534-6547556 AGCTCTCTGCTGCAGGTACACGG + Exonic
1081733672 11:45388982-45389004 AGCTCTTTCCAGCATCTCCACGG - Intergenic
1081778006 11:45689682-45689704 AGCAGTCTACAGCGTGTCCAAGG + Intergenic
1082808089 11:57462469-57462491 AGGCCTCTGCTGCCTTTCCAGGG + Intronic
1083613846 11:64016890-64016912 GCCCCTCTGCAGCCTGTCCTGGG - Intronic
1083805208 11:65069382-65069404 AGCCCCCTGCCACAAGTCCATGG - Intronic
1084562484 11:69912546-69912568 CTGCCTCTGCCGCATGTCCACGG - Intergenic
1084616996 11:70243098-70243120 AGCCCTCTGAAGCCTGTTCCTGG - Intergenic
1084689804 11:70718484-70718506 TGGAATCTGCAGCATGTCCATGG - Intronic
1085023840 11:73225219-73225241 AGGCCACTGCAGAATTTCCAGGG - Intronic
1087288025 11:96287352-96287374 ACCCCTCTGGAGGATGTACAGGG + Intronic
1087293235 11:96341642-96341664 AGCCTTGTACAGCATGGCCAGGG - Exonic
1089037194 11:115407156-115407178 AAACCTCTGTAGCATGTCTATGG - Intronic
1091818683 12:3458368-3458390 AGAGCTGTGCAGCAGGTCCATGG + Intronic
1091917792 12:4281917-4281939 ATCCCTCTGCAGCAGGTCCTGGG + Intronic
1093939258 12:25034851-25034873 AGCCCTCAGCAGAATGTCCAGGG - Intronic
1094392284 12:29964556-29964578 AGCACTCACCAGCATGGCCAAGG - Intergenic
1098219293 12:68251944-68251966 AGCCCTCTTCAGTAAGTCCTAGG + Intronic
1102800015 12:115723954-115723976 AGATCTCTGCAGCATCTCCTAGG + Intergenic
1103922698 12:124407369-124407391 AGGCCTCTGCGGCATGGCAATGG + Intronic
1103985203 12:124762297-124762319 TGCCCTCAGCTGCATGCCCAAGG - Intergenic
1106193215 13:27472345-27472367 TGGTCTCTGCAGCATGGCCAAGG + Intergenic
1107129438 13:36879516-36879538 AGCCCTCTCCAGCTCGTCCATGG + Exonic
1111755981 13:92396715-92396737 AGGCCTCTGAAGCATGTAAAAGG - Intronic
1112190627 13:97173900-97173922 GGCCCTCTTCTGCATTTCCATGG + Intergenic
1113832043 13:113303434-113303456 AGCCGTTGGCAGCATCTCCAAGG - Intronic
1114651926 14:24290721-24290743 AGCCCTCTGCTGTGTGTCCGTGG - Exonic
1115089665 14:29558759-29558781 TGCCCTGTGCAGTATGTCGAGGG - Intergenic
1118708306 14:68500022-68500044 AGACCCCAGCAGCAAGTCCAGGG - Intronic
1119348084 14:73942654-73942676 GGCCATCTGGAGCATGTCCAGGG + Exonic
1119432445 14:74577337-74577359 AGCCCTCTGCAGGCTTGCCAAGG + Intronic
1119658834 14:76436423-76436445 AGCCCTCTGCAGCCTGGGGAAGG + Intronic
1122812764 14:104297186-104297208 AGCCAGCTGCTGCATGTCCAGGG + Intergenic
1123146224 14:106133185-106133207 ACTCCTCTGCAGCAGCTCCAGGG + Intergenic
1123186464 14:106522234-106522256 ACTCCTCTGCAGCAGCTCCAGGG + Intergenic
1202943079 14_KI270726v1_random:1267-1289 ACTCCTCTGCAGCAGCTCCAGGG - Intergenic
1128111593 15:65079647-65079669 AGCCCTTTCCAGCCTCTCCATGG + Intergenic
1128604116 15:69023018-69023040 AGCCCTCTTAAGCAGGCCCATGG - Intronic
1129229302 15:74188069-74188091 TGCCCTCAGCAGCAGTTCCAGGG + Intronic
1129313539 15:74727859-74727881 AGCGCCCTGCCGCATGTGCAGGG + Intergenic
1129590918 15:76914411-76914433 AGGGCTCTGTAGCAGGTCCAGGG + Intergenic
1130563147 15:84974410-84974432 TGCCATCTGCTGCATGACCAAGG + Intergenic
1131053989 15:89364963-89364985 AGCTCTCAGCACCATGGCCAGGG + Intergenic
1131075032 15:89490159-89490181 TGCCCACTGCAGCCTGGCCAAGG + Intronic
1132332814 15:101024539-101024561 GGCCCTCTGAAGTCTGTCCAGGG + Intronic
1133040349 16:3057256-3057278 TGTCCTCTGCAGCAGGGCCAGGG + Intronic
1133180314 16:4049281-4049303 AGCCTTCAGCAGCATTTCCCTGG - Intronic
1133688718 16:8192023-8192045 AGCCCAAGGCAGCATGGCCATGG + Intergenic
1139268240 16:65659428-65659450 ATCCCTCTGCACCTTCTCCATGG - Intergenic
1139348409 16:66320020-66320042 TGCCCTCTGCGCCATGTCCTTGG - Intergenic
1140125957 16:72119304-72119326 AGCCCTGAGCAGCATTTCCACGG - Exonic
1140273319 16:73485549-73485571 AGCCCTTATCAGCATGTCAAGGG - Intergenic
1142685504 17:1575048-1575070 AGCCCCCTGTCGCCTGTCCAGGG - Exonic
1143782575 17:9236960-9236982 AGGCCTCTGCAGGAAGTCTAAGG + Intronic
1147340494 17:39750785-39750807 TCACCTCTTCAGCATGTCCAGGG + Intergenic
1148814087 17:50314227-50314249 AGCCCTGTCCAGCATGTCTTGGG + Intergenic
1149406461 17:56356850-56356872 AGCCCAGTGCAGGATGGCCATGG - Intronic
1151196127 17:72432283-72432305 AGCCCCCTGCAGCATAAACACGG + Intergenic
1151494377 17:74450673-74450695 GACCCTCTGGAGCATGTCCGAGG - Intronic
1151575334 17:74950230-74950252 AGCCCGCTGCAGAATGTCACCGG - Intergenic
1152299962 17:79489682-79489704 AGCCCTCTGGAGCTTGCCCGGGG + Intronic
1152462797 17:80450205-80450227 TCCCCTCTGCAGCCTGGCCAAGG + Intergenic
1152759354 17:82099835-82099857 TGCTCTCTGCAGCCTGTCGAGGG + Intergenic
1154177116 18:12093027-12093049 GGCTCACTGCAGCATCTCCAGGG + Intergenic
1155219320 18:23670084-23670106 AACCCTCAGCAGAATGTCGAAGG - Intergenic
1156888314 18:42160988-42161010 AGCCCTCTGACCCATCTCCAGGG - Intergenic
1158137388 18:54223195-54223217 AGACATCAGCAGCATGACCACGG + Intronic
1160912604 19:1481839-1481861 CGTCCTCTGCGGCATGTCCATGG - Exonic
1161300438 19:3539925-3539947 AGCCCTTTGCTCCATTTCCAAGG + Intronic
1162717023 19:12640595-12640617 AGCGCACTGCATCATCTCCAGGG - Intergenic
1165752649 19:38270022-38270044 AGCCCTCTCCTGCACTTCCAAGG + Intronic
1165787833 19:38473163-38473185 AGCCCTCTGCAACATTTCTCTGG - Intronic
925611035 2:5703401-5703423 AGCCCTCTGCCCCAGCTCCATGG + Intergenic
928610651 2:32988716-32988738 GGACCTCTGCAGCATGTGGAAGG - Intronic
929108821 2:38389179-38389201 AAGCCTCTGCAGCATCTCCAGGG + Intergenic
929909837 2:46080500-46080522 AGCAATCTGAACCATGTCCATGG + Intronic
931195412 2:60047981-60048003 TCCCCTCTGCAGCATGTTAAAGG - Intergenic
931473034 2:62558692-62558714 AGCTCACTGTAGCATGTTCAGGG - Intergenic
932139429 2:69262552-69262574 AGGGCTCTGCAGCAAGTCCCAGG + Intergenic
932218994 2:69985829-69985851 TGCCATCTGCTTCATGTCCAGGG - Intergenic
932750121 2:74366207-74366229 AGGCCTCTGCAACTTCTCCAAGG + Intronic
935068917 2:99676468-99676490 AGCCCTCTGAGGCAGGTCCCAGG - Intronic
936243596 2:110808149-110808171 AGACCTCTGCAGCCTGTGCTGGG + Intronic
947586726 2:231361113-231361135 AGCACTCAGAAGCATGCCCATGG + Intronic
948934664 2:241155309-241155331 GACTCTCTGCAGCTTGTCCAAGG + Intronic
948942355 2:241202852-241202874 AGCCCACTGCTGCATGGCCAGGG + Intronic
1170224931 20:13981965-13981987 GCTCCTCTGCAACATGTCCAGGG + Intronic
1170596137 20:17807080-17807102 AGCCCTCTGCACCATGACCTCGG - Intergenic
1172475726 20:35236033-35236055 GGCGCTCTGCAGAATGTCCTTGG - Intronic
1173117026 20:40254234-40254256 AGGGCTCTGCAGCATTTCCCAGG - Intergenic
1173248973 20:41354649-41354671 CTCCCTCTCCAGCTTGTCCATGG - Exonic
1174516326 20:51095235-51095257 ATCCACCTGCAGCATGGCCAAGG + Intergenic
1175182313 20:57157298-57157320 AGACCTTCGCAACATGTCCAAGG + Intergenic
1175495856 20:59413667-59413689 GGGCCTCTGCAGCCTGTCCTTGG + Intergenic
1175880742 20:62257269-62257291 AGCCCGCTCCAGCAGGGCCACGG - Intronic
1176223388 20:63980549-63980571 GGCCCTCACCAGAATGTCCAAGG + Intronic
1179397854 21:41057547-41057569 TGCCCTCTGGGGCATGGCCATGG - Intergenic
1181522378 22:23457044-23457066 GGACCTCTGCAGCACGTCCGTGG - Intergenic
1182338964 22:29603914-29603936 AGGCCTGTGCAGCAACTCCAGGG + Exonic
1183948562 22:41340167-41340189 AGCACTGTGCAACCTGTCCAGGG - Intronic
1184048981 22:41990378-41990400 AGCCCTGTGCTGGATGTACAGGG + Intronic
1185221392 22:49630731-49630753 AGGCCTCTGCAGCAGCTGCACGG + Intronic
949765188 3:7518231-7518253 AGGCCTTGGCAGCATTTCCAAGG + Intronic
950163266 3:10775472-10775494 AGCCCTCTACAGCCAGGCCAAGG - Intergenic
950242755 3:11386547-11386569 AGCTCTCTGCAGCCTGTGCCAGG + Intronic
953717308 3:45326532-45326554 TTCCCTCTGCAGCCTGTGCATGG - Intergenic
953820416 3:46203297-46203319 GACCCTCTCCAGCCTGTCCACGG + Exonic
954193384 3:48980667-48980689 AGTCCTCTGATGGATGTCCAGGG + Intronic
955917406 3:63920485-63920507 AGCCCTTTCCAGAATGTACATGG + Intronic
961352612 3:126313603-126313625 GACCCTCTGCAGGAAGTCCAGGG - Intergenic
961573949 3:127819917-127819939 GGACCTCTGCATCATCTCCAGGG + Intronic
961723109 3:128908956-128908978 AGCTCACTGCAGAAAGTCCATGG - Exonic
963732466 3:148986805-148986827 TGCCCTCCGCCGCATGTACACGG - Intergenic
964313459 3:155418709-155418731 AGCCATCTGCAGCATGTCAGAGG - Intronic
966135383 3:176692385-176692407 AGCCCTCTGCAGCTTGTCCACGG + Intergenic
967191572 3:186989574-186989596 AGCCCTATGCACCATGTTCGAGG + Intronic
969449355 4:7264360-7264382 GGCCCTCTCCTGCTTGTCCAGGG + Intronic
969602620 4:8185909-8185931 TGCTCTCTGCAGCCTGCCCAGGG + Intronic
975521629 4:75307715-75307737 ACCCCTCTGAAGCAGGTTCACGG - Intergenic
978835585 4:113145808-113145830 TGCCCTCTGCACTCTGTCCAGGG - Intronic
981178949 4:141716320-141716342 AGCCCTGGGCAGTATGCCCATGG - Intronic
981788950 4:148513646-148513668 AGCCCTCTACACCATGTGAATGG - Intergenic
982023937 4:151233313-151233335 AGCCCTCTGCACCTGGTCCATGG + Intronic
985733727 5:1565587-1565609 AGCCCCCTGCTGTGTGTCCAGGG - Intergenic
985903648 5:2816040-2816062 AGCCCTCTGCAGGAAAACCATGG - Intergenic
986274342 5:6260549-6260571 ACCCCTCTGTGGCATGTCTAGGG + Intergenic
988910419 5:35835117-35835139 GCCCCTCTGCTGCATTTCCATGG - Intergenic
990761678 5:59137036-59137058 AGGCCTCTGCAGCAGCCCCAAGG - Intronic
993363184 5:87003007-87003029 AGTGCTCTGTAGCAGGTCCAAGG - Intergenic
997529497 5:134573197-134573219 ATCCCTCTGCCTCCTGTCCAAGG - Intronic
997849557 5:137318834-137318856 TGCCCTCAGCAGCATGTCTTGGG - Intronic
998338358 5:141394288-141394310 CGCCCCCTGCAGCGTGTCCTCGG - Exonic
999539976 5:152560680-152560702 AGGCCACAGGAGCATGTCCAAGG - Intergenic
1002001363 5:176198007-176198029 AGCCCACTGCAGCCCCTCCAAGG + Intergenic
1002252976 5:177940962-177940984 AGCCCACTGCAGCCCCTCCAAGG - Intergenic
1003673590 6:8182057-8182079 TGCCCTGTGCAAAATGTCCATGG - Intergenic
1003728018 6:8788818-8788840 AGCCATCCGCAGCGTGTCCCTGG - Intergenic
1003734526 6:8863685-8863707 GGTCCTCTGCAGGTTGTCCAAGG - Intergenic
1005465877 6:26112738-26112760 GGTCATCTGCAGCATGTCTAGGG - Intergenic
1006109809 6:31737650-31737672 ACCCCTCTGCCCCATCTCCAAGG - Intronic
1007146297 6:39636669-39636691 CCCTCTCTGCAGCATGTCAAAGG + Intronic
1011095765 6:83660178-83660200 TGACCTCTGCAGTAGGTCCATGG - Intronic
1012853494 6:104474162-104474184 AGACCTCTGCTGCATGTTTAGGG + Intergenic
1017645836 6:156539208-156539230 AGCCCTCTGAACCCTGTCCCTGG - Intergenic
1018790136 6:167141984-167142006 GGCCCTGTGCAGCAAGTCTAGGG + Intergenic
1019588951 7:1819518-1819540 GGACCTCTGCAGCATGTCCGTGG + Intronic
1021716729 7:23468864-23468886 TGCCCTGTGGAGCGTGTCCAGGG - Intronic
1022529338 7:31057359-31057381 AGGACTCTGCAGCATGACCTTGG + Intronic
1023395245 7:39745771-39745793 AGCCCCAGGCAGCATCTCCAGGG - Intergenic
1023931222 7:44707800-44707822 ATCCCTCTGCTGCATGTGCCTGG - Intronic
1024280604 7:47715987-47716009 AGCCCTTTGCACCAAGTCCAGGG - Intronic
1026867958 7:73834911-73834933 AGCCTGCTCCAGCCTGTCCAGGG + Exonic
1027222580 7:76223464-76223486 AGCCATCTGCATCATGTCCAAGG - Intronic
1029443499 7:100600832-100600854 AGCCCTCTGCAGCATGTCCAGGG - Exonic
1030287044 7:107837470-107837492 ACCCCTCTGCCCCATGTCCAGGG + Intergenic
1036678802 8:10855526-10855548 AAACCTCTGCTGGATGTCCATGG + Intergenic
1036796192 8:11758242-11758264 AGCCCTCAGGAGCGTCTCCATGG + Intronic
1037926680 8:22848997-22849019 AGCTCCAGGCAGCATGTCCATGG + Intronic
1038908089 8:31929999-31930021 AGCCAGCTACAGAATGTCCAAGG - Intronic
1042867790 8:73370671-73370693 AGCCCACTGCAGCAAGAGCAAGG + Intergenic
1043377495 8:79667052-79667074 AGCCCTCTGCAGCATATTTGGGG + Intergenic
1047446441 8:124924406-124924428 AGCTCATTGCAGCATGTACAAGG - Intergenic
1051087288 9:13364442-13364464 AAACCACTGCAGCATGCCCAGGG - Intergenic
1053172072 9:35895091-35895113 TTCCCTGGGCAGCATGTCCATGG - Intergenic
1056137319 9:83642986-83643008 GGTCCTCTGCAGGATGTTCAGGG - Intronic
1056443878 9:86645863-86645885 AGCTCTCCGCAGCATCCCCATGG - Intergenic
1057110627 9:92467256-92467278 AGTCTTTTGCAACATGTCCAAGG + Intronic
1057849487 9:98553865-98553887 AGCACTCTGCAGAATGAGCAGGG - Intronic
1060805175 9:126570894-126570916 AAGGCTCTGCAACATGTCCAGGG - Intergenic
1060994066 9:127866338-127866360 AGGCCTCTGCAGCTGGTCCTCGG - Intergenic
1061927039 9:133811021-133811043 AGCCCCCAGCAGCAGGGCCATGG + Intronic
1062051340 9:134448637-134448659 AGCCAACTGCAGACTGTCCAGGG + Intergenic
1062675658 9:137742094-137742116 AGGCGTCTGCAGTATGTTCATGG - Intronic
1185730515 X:2457644-2457666 AACCATCTTCAGCATGTCCACGG - Intronic
1187670268 X:21659112-21659134 ATCCCTTTGCAGCATGAACAAGG + Intergenic
1189722408 X:43933628-43933650 TGCCCTCTGCAGAATGTGCCAGG - Intergenic
1193653413 X:84168079-84168101 ATCTCTCTGCAGCATGTCACAGG + Intronic
1197530429 X:127617042-127617064 AGCCCAATGCCCCATGTCCATGG + Intergenic
1200142129 X:153907627-153907649 AGCCCTGTCCAGCAAGTGCAGGG - Exonic