ID: 1029445853

View in Genome Browser
Species Human (GRCh38)
Location 7:100612544-100612566
Sequence CCCGCCGAGCCCCACCTCGA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 111}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029445853_1029445856 -8 Left 1029445853 7:100612544-100612566 CCGTCGAGGTGGGGCTCGGCGGG 0: 1
1: 0
2: 0
3: 4
4: 111
Right 1029445856 7:100612559-100612581 TCGGCGGGTCCGAAGGAACCTGG 0: 1
1: 0
2: 1
3: 0
4: 32
1029445853_1029445867 23 Left 1029445853 7:100612544-100612566 CCGTCGAGGTGGGGCTCGGCGGG 0: 1
1: 0
2: 0
3: 4
4: 111
Right 1029445867 7:100612590-100612612 TGGAAGAGGAAAGGTCTTGGGGG 0: 1
1: 0
2: 2
3: 39
4: 375
1029445853_1029445861 9 Left 1029445853 7:100612544-100612566 CCGTCGAGGTGGGGCTCGGCGGG 0: 1
1: 0
2: 0
3: 4
4: 111
Right 1029445861 7:100612576-100612598 ACCTGGGGCAGAGCTGGAAGAGG 0: 1
1: 1
2: 5
3: 72
4: 528
1029445853_1029445863 14 Left 1029445853 7:100612544-100612566 CCGTCGAGGTGGGGCTCGGCGGG 0: 1
1: 0
2: 0
3: 4
4: 111
Right 1029445863 7:100612581-100612603 GGGCAGAGCTGGAAGAGGAAAGG 0: 1
1: 0
2: 9
3: 94
4: 1012
1029445853_1029445866 22 Left 1029445853 7:100612544-100612566 CCGTCGAGGTGGGGCTCGGCGGG 0: 1
1: 0
2: 0
3: 4
4: 111
Right 1029445866 7:100612589-100612611 CTGGAAGAGGAAAGGTCTTGGGG 0: 1
1: 0
2: 1
3: 34
4: 377
1029445853_1029445858 -6 Left 1029445853 7:100612544-100612566 CCGTCGAGGTGGGGCTCGGCGGG 0: 1
1: 0
2: 0
3: 4
4: 111
Right 1029445858 7:100612561-100612583 GGCGGGTCCGAAGGAACCTGGGG 0: 1
1: 0
2: 0
3: 4
4: 56
1029445853_1029445868 29 Left 1029445853 7:100612544-100612566 CCGTCGAGGTGGGGCTCGGCGGG 0: 1
1: 0
2: 0
3: 4
4: 111
Right 1029445868 7:100612596-100612618 AGGAAAGGTCTTGGGGGCCCTGG 0: 1
1: 0
2: 6
3: 30
4: 286
1029445853_1029445864 20 Left 1029445853 7:100612544-100612566 CCGTCGAGGTGGGGCTCGGCGGG 0: 1
1: 0
2: 0
3: 4
4: 111
Right 1029445864 7:100612587-100612609 AGCTGGAAGAGGAAAGGTCTTGG 0: 1
1: 1
2: 5
3: 43
4: 542
1029445853_1029445869 30 Left 1029445853 7:100612544-100612566 CCGTCGAGGTGGGGCTCGGCGGG 0: 1
1: 0
2: 0
3: 4
4: 111
Right 1029445869 7:100612597-100612619 GGAAAGGTCTTGGGGGCCCTGGG 0: 1
1: 0
2: 4
3: 31
4: 235
1029445853_1029445865 21 Left 1029445853 7:100612544-100612566 CCGTCGAGGTGGGGCTCGGCGGG 0: 1
1: 0
2: 0
3: 4
4: 111
Right 1029445865 7:100612588-100612610 GCTGGAAGAGGAAAGGTCTTGGG 0: 1
1: 0
2: 3
3: 40
4: 541
1029445853_1029445857 -7 Left 1029445853 7:100612544-100612566 CCGTCGAGGTGGGGCTCGGCGGG 0: 1
1: 0
2: 0
3: 4
4: 111
Right 1029445857 7:100612560-100612582 CGGCGGGTCCGAAGGAACCTGGG 0: 1
1: 0
2: 1
3: 2
4: 30
1029445853_1029445860 3 Left 1029445853 7:100612544-100612566 CCGTCGAGGTGGGGCTCGGCGGG 0: 1
1: 0
2: 0
3: 4
4: 111
Right 1029445860 7:100612570-100612592 GAAGGAACCTGGGGCAGAGCTGG 0: 1
1: 0
2: 6
3: 56
4: 506

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029445853 Original CRISPR CCCGCCGAGCCCCACCTCGA CGG (reversed) Exonic
900946652 1:5834670-5834692 CCGGCCGTGATCCACCTCGAGGG + Intergenic
901645154 1:10712950-10712972 GTCGAGGAGCCCCACCTCGAAGG + Intronic
902246233 1:15122622-15122644 CCTGCCCAGCCCCACCTGCAGGG - Intergenic
904696742 1:32335609-32335631 CCCGCCGGGCCCCAGCTCCGCGG + Intronic
905390814 1:37634496-37634518 CCCGCCGCGCCCCAGCTCCCGGG + Intronic
910789742 1:91038849-91038871 GCCACCGAGCCCCGCCTCCAAGG - Intergenic
922592243 1:226785958-226785980 CCTGCCCAGCCCCACATGGAAGG - Intergenic
922798484 1:228353197-228353219 CCAGCCCAGCCCCTCCTCCAGGG - Intronic
1070305380 10:75236007-75236029 CCCGCCGGGCTCCACCTTGTCGG + Exonic
1070745397 10:78930757-78930779 TCACACGAGCCCCACCTCGATGG + Intergenic
1070785233 10:79158726-79158748 CCTTCCCAGCCCCACCTCCAGGG - Intronic
1075258463 10:120943729-120943751 CCTCCCAAGCCCCACCTCCAGGG + Intergenic
1075856078 10:125631384-125631406 ACAGCCGAGGCCCACCCCGAAGG - Intronic
1077026391 11:441821-441843 CCCCGCCAGCCCCACCTGGAAGG - Intronic
1077340557 11:2024596-2024618 CCCCCCGACCCCCAGCTCCAGGG + Intergenic
1078317001 11:10302815-10302837 CCCGCCGCGCCCCACCCCCCAGG + Intergenic
1078981166 11:16536648-16536670 CCCGCCGAGCCACACATGGGAGG - Intronic
1082004124 11:47410318-47410340 CCCACTGAGCCCCACCATGAGGG - Exonic
1084102358 11:66958100-66958122 CCGGCCGAGCCCCCGCGCGAGGG + Intronic
1084892699 11:72244288-72244310 CGCCCCGACCCCCACCCCGAAGG + Intronic
1084973109 11:72781914-72781936 CCCGCCCCGCCCCACCCCGCAGG + Intronic
1202823542 11_KI270721v1_random:79785-79807 CCCCCCGACCCCCAGCTCCAGGG + Intergenic
1096771463 12:53938599-53938621 TTCGCCCCGCCCCACCTCGAGGG + Intergenic
1101437882 12:104679645-104679667 GCCGCCGAGCCCCAGCTGCAGGG + Intronic
1103870868 12:124090617-124090639 CTCTCGGAGCCCCACCTGGATGG - Intronic
1104134102 12:125921247-125921269 CCCTCCCAGCCCCACCCCCAAGG + Intergenic
1104898148 12:132174172-132174194 CCAGCCGAGCCCCTTCTCCACGG - Intergenic
1114178250 14:20343190-20343212 TCCGCCGGGCCCCTCCCCGAAGG + Intergenic
1114411954 14:22509292-22509314 CCTGCCGTGCCCCTCCTTGAGGG + Intergenic
1119418824 14:74493948-74493970 CCTGGCGACCCCCACCTGGACGG - Intronic
1122609280 14:102970136-102970158 CCCGCCCAGCACTACCTTGAGGG + Exonic
1122688623 14:103521504-103521526 GCCCCCGTGCCCCACCTCGGGGG + Intronic
1131461765 15:92622593-92622615 CCCCCCAAGCCCCTCCTCGGGGG - Intronic
1132744669 16:1431670-1431692 GCTGCCCAGCCCCTCCTCGAGGG - Intergenic
1132947055 16:2537740-2537762 CCCGCCCAGCCCCGCCCCGCAGG + Intergenic
1133018437 16:2955485-2955507 CCCCGCCATCCCCACCTCGAGGG - Intergenic
1133018544 16:2955829-2955851 CCCGCCCACCCCCTCCTCCACGG - Intergenic
1136478017 16:30525395-30525417 CCCGCCGACCTGGACCTCGAAGG + Exonic
1140393377 16:74607179-74607201 CCTGCCGAGCCCCGCCCCGCCGG + Intergenic
1142140010 16:88468686-88468708 CCCCCAGAGCCCCACCCCCATGG + Intronic
1142417176 16:89949100-89949122 CCCGCCGGCCCCGACCTCGCCGG - Intronic
1142597613 17:1037123-1037145 CTCTCCCAGCCCCACCTGGATGG - Intronic
1143477042 17:7208737-7208759 CTCCCCGCGCCCCACCTCCATGG + Intronic
1143891562 17:10106267-10106289 CCACCCGAGCCACACCTGGAAGG - Intronic
1144737525 17:17563395-17563417 CCCTCTCAGCCCCACCTCGCAGG + Intronic
1148591043 17:48817029-48817051 CCTGCCGGCCCCCTCCTCGAAGG + Exonic
1151961058 17:77405849-77405871 CCAGCCCAGCCCCACATGGAGGG - Intronic
1159057074 18:63476870-63476892 CCCGCCCCGCCCCGCCTCGGCGG - Exonic
1160816113 19:1036555-1036577 CCGGGCGAGCCCCACCTGGCTGG - Exonic
1161014908 19:1978740-1978762 CCCGCCGCGCACCAGCTGGATGG - Exonic
1161456132 19:4370530-4370552 CCCACAGGGCCCCACCTGGACGG + Intronic
1161722857 19:5913352-5913374 CCCACCCAGGCCCACCTCCAAGG - Intronic
1162410644 19:10503123-10503145 CCCGGCCATCCCCACCCCGAGGG - Intronic
1162577637 19:11507990-11508012 CCCCCCCAGCCCCACATCGTAGG - Exonic
1162802533 19:13118965-13118987 CCCGCCGTGCCCCACTTCCTGGG - Intronic
1165832845 19:38737661-38737683 CCTGCCCGGCCCCACCTCGAGGG + Intronic
1165907960 19:39205003-39205025 CCCCCCCCGCCCCACCACGAGGG - Intergenic
1166781503 19:45345771-45345793 CTCGCCCAGCCCCAGCTCGATGG - Exonic
1167278345 19:48552262-48552284 CCCGCCGAGCCCCAGATCCCGGG + Exonic
1167435534 19:49476415-49476437 CCCGCAGAGCTCCTCCTAGAGGG - Exonic
925427483 2:3762702-3762724 CCCACCAGGCCCCACCTCCAAGG + Intronic
936146956 2:109986662-109986684 CCAGCCCAGCACCACCTGGAAGG + Intergenic
936197736 2:110384821-110384843 CCAGCCCAGCACCACCTGGAAGG - Intergenic
937993257 2:127675441-127675463 CCCGCACAGCCCCAGCTCCAGGG + Intronic
1169557592 20:6767586-6767608 CCCGGCGAGCCGCGCCGCGAAGG + Intergenic
1170608901 20:17895495-17895517 CCTGCCCACCCCCACCTGGAAGG + Intergenic
1174216806 20:48921993-48922015 CCCACCGAGCGCCACCTGGCAGG - Exonic
1175959147 20:62626284-62626306 CCTGCCGGGTCACACCTCGAGGG - Intergenic
1176139977 20:63540745-63540767 CCTGCAGAGCGCCAACTCGAAGG - Intergenic
1176556325 21:8255992-8256014 CCCGCCGACACCCACGTCGTCGG - Intergenic
1176575264 21:8439034-8439056 CCCGCCGACACCCACGTCGTCGG - Intergenic
1179411873 21:41168417-41168439 CCTGCCGAGCGCCACGCCGACGG + Exonic
1181778227 22:25175154-25175176 CCCTGGGAGCCCCACCTCCAGGG + Intronic
1183428491 22:37751928-37751950 CCCTCCCAGCCCCACCCCCAGGG - Intronic
1185284350 22:49993766-49993788 CCTCCCCAGCCCCACCTCCACGG + Intergenic
1185289473 22:50016345-50016367 CCAGCCCAGGCCCACTTCGAAGG - Intronic
1203253315 22_KI270733v1_random:128089-128111 CCCGCCGACACCCACGTCGTCGG - Intergenic
1203261370 22_KI270733v1_random:173168-173190 CCCGCCGACACCCACGTCGTCGG - Intergenic
954367650 3:50154961-50154983 CCCGCCCAGCCCCACCCCCGGGG - Intergenic
954681158 3:52346763-52346785 CCCGCCGGGCCCCACCTGTAGGG - Exonic
961736258 3:129003822-129003844 CCCGCCGTGCCCCATCTCGTGGG - Exonic
961742968 3:129045771-129045793 CCCGCGGAGCACCACTTCGGAGG + Intergenic
964040871 3:152260324-152260346 CCCTCCTGGCCCCACCTGGATGG - Intronic
966889908 3:184399412-184399434 CCCGCCGTGCCCCAGCACGGTGG - Intronic
968084910 3:195869910-195869932 CCCGAGGAGGCCCACCTCGGCGG + Intronic
968092843 3:195909206-195909228 CCCGCCGAGCCCGTCCACCACGG + Intronic
968137138 3:196227746-196227768 CCTGCCTCGCCCCACCTCCAAGG + Intronic
968449146 4:666996-667018 CCGACCCAGCCCCGCCTCGAGGG - Intronic
968523668 4:1045890-1045912 CCCGCCGAGCTGCCTCTCGAGGG + Intergenic
968585652 4:1414847-1414869 ACCGCCGAGCCCCTCCCCCAGGG + Intergenic
969189487 4:5505476-5505498 CCCGCCGAGCCACCCCACCATGG - Intergenic
985731680 5:1553104-1553126 CCCGCCGAGGCCTGCCGCGACGG + Intergenic
998129090 5:139642324-139642346 CTCTCCGAGCCCCTCCCCGAGGG - Intergenic
1001433326 5:171680670-171680692 CCCGCCCAGCCCCACCCCTGTGG + Intergenic
1002204663 5:177554292-177554314 CCGGCGGAGCCCGACCACGACGG - Exonic
1002924019 6:1594627-1594649 CCAGCCGGGACCCACCTCGCAGG + Intergenic
1006151377 6:31991962-31991984 CCCCCCCAGCCCCACCCAGAGGG - Intronic
1006157678 6:32024700-32024722 CCCCCCCAGCCCCACCCAGAGGG - Intronic
1006513773 6:34534940-34534962 CTCGCCGAGCCCCACCAGGGCGG - Exonic
1007762000 6:44138753-44138775 CCTGCCCTGCCCCACCTTGAGGG + Intronic
1018013615 6:159693358-159693380 CCCGCCGCGCCCAACCCCGGGGG + Intronic
1019147200 6:169983094-169983116 CCTGCCCAGCCCCTCCTGGAAGG + Intergenic
1025992510 7:66506340-66506362 CCCGCCCCGCCCCGCCTCGGCGG + Intergenic
1026020254 7:66700217-66700239 CCAGCCAAGCCCCACTGCGATGG + Intronic
1028838072 7:95396512-95396534 CCCGCCGAGCCCCGCCGCCCGGG + Intergenic
1029445853 7:100612544-100612566 CCCGCCGAGCCCCACCTCGACGG - Exonic
1032020566 7:128405404-128405426 CCCTCCCAGCCTCACCACGAGGG - Intronic
1041108805 8:54466938-54466960 GCCGCCGGGCTCCACCTCAACGG - Intergenic
1049605926 8:143529157-143529179 CTGGCCCTGCCCCACCTCGAAGG - Intronic
1049790187 8:144468848-144468870 CCCGCCTAGCCCCTCCTCTCTGG + Intronic
1049806380 8:144542628-144542650 CCCCCCCACCCCCACTTCGACGG + Intronic
1059375222 9:113876137-113876159 GCCGCCGAGCCGCCCCTCGCGGG - Intergenic
1061937892 9:133868285-133868307 CCCACCGCGCCCCACCTCATGGG - Intronic
1203469715 Un_GL000220v1:111236-111258 CCCGCCGACACCCACGTCGTCGG - Intergenic
1203477536 Un_GL000220v1:155208-155230 CCCGCCGACACCCACGTCGTCGG - Intergenic
1201317488 Y:12662214-12662236 CCCGCCAAGCCCCGCCCCTAGGG - Intergenic