ID: 1029448304

View in Genome Browser
Species Human (GRCh38)
Location 7:100626980-100627002
Sequence CCTAGCATGGGGAAGGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 665
Summary {0: 1, 1: 0, 2: 3, 3: 51, 4: 610}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029448290_1029448304 5 Left 1029448290 7:100626952-100626974 CCGCCTAGCATGGGGACAAGGAC 0: 1
1: 0
2: 0
3: 14
4: 129
Right 1029448304 7:100626980-100627002 CCTAGCATGGGGAAGGGGGCTGG 0: 1
1: 0
2: 3
3: 51
4: 610
1029448283_1029448304 14 Left 1029448283 7:100626943-100626965 CCAGGACCCCCGCCTAGCATGGG 0: 1
1: 0
2: 0
3: 6
4: 104
Right 1029448304 7:100626980-100627002 CCTAGCATGGGGAAGGGGGCTGG 0: 1
1: 0
2: 3
3: 51
4: 610
1029448286_1029448304 8 Left 1029448286 7:100626949-100626971 CCCCCGCCTAGCATGGGGACAAG 0: 1
1: 0
2: 0
3: 10
4: 102
Right 1029448304 7:100626980-100627002 CCTAGCATGGGGAAGGGGGCTGG 0: 1
1: 0
2: 3
3: 51
4: 610
1029448287_1029448304 7 Left 1029448287 7:100626950-100626972 CCCCGCCTAGCATGGGGACAAGG 0: 1
1: 0
2: 0
3: 6
4: 88
Right 1029448304 7:100626980-100627002 CCTAGCATGGGGAAGGGGGCTGG 0: 1
1: 0
2: 3
3: 51
4: 610
1029448289_1029448304 6 Left 1029448289 7:100626951-100626973 CCCGCCTAGCATGGGGACAAGGA 0: 1
1: 0
2: 0
3: 10
4: 126
Right 1029448304 7:100626980-100627002 CCTAGCATGGGGAAGGGGGCTGG 0: 1
1: 0
2: 3
3: 51
4: 610
1029448291_1029448304 2 Left 1029448291 7:100626955-100626977 CCTAGCATGGGGACAAGGACCCC 0: 1
1: 0
2: 13
3: 17
4: 172
Right 1029448304 7:100626980-100627002 CCTAGCATGGGGAAGGGGGCTGG 0: 1
1: 0
2: 3
3: 51
4: 610

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029448304 Original CRISPR CCTAGCATGGGGAAGGGGGC TGG Intronic
900095205 1:937410-937432 CCTAGCCTGGGGGAGGTGACTGG - Intronic
900110404 1:1003107-1003129 CCTGGCAGGGGGCAGGGAGCAGG - Intergenic
900182229 1:1316249-1316271 TCTAGCCTGGGCAATGGGGCGGG + Intronic
900267885 1:1768755-1768777 ACAGGCATGGGGCAGGGGGCGGG - Intronic
900614012 1:3556218-3556240 CCCAGGATGGGGAGTGGGGCAGG + Intronic
900850733 1:5140864-5140886 CCTGTCATGGGCAAGGGGCCAGG - Intergenic
901004372 1:6164793-6164815 TCTTGGAAGGGGAAGGGGGCTGG - Intronic
901196827 1:7445034-7445056 CCTAGCACGGGGTAGGAGGTGGG + Intronic
901657645 1:10779485-10779507 CCTGGCAAGGGGGAGGGGGCGGG - Intronic
902822217 1:18950339-18950361 CTTTGCCAGGGGAAGGGGGCTGG + Intronic
903334320 1:22614691-22614713 AAGAGCATGGGGATGGGGGCTGG - Intergenic
903711290 1:25326654-25326676 CCAAGCAAGAGGAGGGGGGCAGG + Intronic
903715658 1:25364775-25364797 CCAAGCAAGAGGAGGGGGGCAGG - Intronic
903867916 1:26411839-26411861 CCTGGGAAGGGGCAGGGGGCAGG + Intronic
904412012 1:30330318-30330340 CCCAGCGAGGGGAAGGGGGGTGG - Intergenic
904468788 1:30723339-30723361 TCCAGGATGGGGAAGGGAGCAGG - Intronic
905521100 1:38600975-38600997 CCTGTCATAGGGAAGGGGCCAGG - Intergenic
906411820 1:45584643-45584665 CCTTGCACGAGGAAGGAGGCTGG + Intronic
906602085 1:47138824-47138846 CCCTGCATGGGGAGAGGGGCGGG + Intronic
907418018 1:54327836-54327858 CCTGGGATGGGGGAGGGGACAGG - Intronic
907437737 1:54460159-54460181 CCTTGGATGGGGAAGGAGGGAGG + Intergenic
908008238 1:59748858-59748880 CGTAGCATCAGGATGGGGGCTGG + Intronic
910712650 1:90197557-90197579 CCTTCCATGGGGAAGGGGGATGG + Intergenic
910840684 1:91558433-91558455 CCTAGGATTGGGGAGGGGGAAGG - Intergenic
912957478 1:114165657-114165679 CCCAGCCTGGGGAAGAGGGTGGG + Intergenic
913102159 1:115578380-115578402 CCTATCATGGGGTGGGGGGCTGG - Intergenic
913407494 1:118511933-118511955 CCTGTCCTGGGGTAGGGGGCAGG - Intergenic
913710977 1:121483106-121483128 CCTGTCATGGGGTAGGGGGAGGG + Intergenic
914425012 1:147567771-147567793 CCTAGCAGGGGGAGGGGGAAGGG - Intronic
914815827 1:151061302-151061324 GCCACCATGGGGAAGGGGGAAGG - Intronic
914827732 1:151147228-151147250 CCTAGCATGCGCGTGGGGGCTGG + Intergenic
915022994 1:152798495-152798517 CAGAGGATGGGGAAGGGGTCAGG + Intronic
915145778 1:153795126-153795148 CCTGGCAACGGGGAGGGGGCGGG - Intergenic
915457950 1:156053316-156053338 CCTTGCACCGGGAAGGGGGAAGG - Intronic
915611724 1:156999035-156999057 CCCAGCAGGAGGGAGGGGGCGGG + Intronic
917710654 1:177680882-177680904 CCCAGGTTGGGGATGGGGGCTGG - Intergenic
918224230 1:182465456-182465478 CCTATCATGGGGTGGGGGGAGGG + Intronic
918326675 1:183417500-183417522 CCTAGGACGGGGAGGGGGCCGGG - Intronic
918578816 1:186100046-186100068 TCTAGCATGTGGCAGGGGGAGGG + Intronic
919377581 1:196814212-196814234 CCTATCATGGGGTGGGGGGCAGG - Intergenic
919387095 1:196936109-196936131 CCTATCATGGGGTGGGGGGCAGG - Intronic
920181036 1:204131809-204131831 CCTGGCCTGGGGAAGGAGGCGGG - Exonic
920279128 1:204829693-204829715 ACTAGGATGGGGAAGGGGCAGGG + Intronic
920349497 1:205328583-205328605 CCAGGCACGGGGAAGGGGGGTGG - Intergenic
921836845 1:219787209-219787231 CCTGGCAGGGAGAATGGGGCTGG - Intronic
923035911 1:230285041-230285063 CATGGCATGGCGAGGGGGGCGGG + Intergenic
923416208 1:233764316-233764338 CCTGTCATGGGGTTGGGGGCAGG - Intergenic
923614743 1:235527571-235527593 CCCAGGTTGGGGAAAGGGGCAGG - Intergenic
923684039 1:236142140-236142162 CCGGGGATGGGGAAGGGGCCGGG + Intergenic
924758572 1:246964080-246964102 CCAGGTATGGGGGAGGGGGCAGG + Intronic
1063112936 10:3052653-3052675 CCTAATATGGGGGAGGAGGCGGG + Intergenic
1063657776 10:8009163-8009185 ACGAGCATGGGGCCGGGGGCGGG - Exonic
1065050273 10:21784893-21784915 CCTGTCATGGGGTGGGGGGCAGG + Intronic
1065229864 10:23587037-23587059 CCTGTCATGGGGTTGGGGGCTGG - Intergenic
1066154977 10:32666524-32666546 CCTATCATGGGGTGGGGGGAGGG - Intronic
1067091137 10:43266460-43266482 CCTGGCGTGGGGGTGGGGGCTGG - Intronic
1067155431 10:43777277-43777299 CCTTGCATGGCCAAGGAGGCAGG - Intergenic
1068608172 10:59029263-59029285 CCTATCATGGGGTGGGGGGAGGG - Intergenic
1069280803 10:66651539-66651561 CCTTGCGTGGGGAGGGGGGTTGG + Intronic
1069438334 10:68406684-68406706 CCTTGCTGGGGGGAGGGGGCAGG - Intronic
1069564007 10:69451370-69451392 CCTAGCGTCTGGGAGGGGGCGGG - Intergenic
1070143035 10:73753078-73753100 TCTAGCATGGGCAACAGGGCAGG - Intronic
1070476954 10:76838179-76838201 CCTGTCATGGGGAGGGGGGCAGG + Intergenic
1070812536 10:79305613-79305635 CCTAGCGAGGGGCAGGGGGTGGG + Intronic
1071316868 10:84409913-84409935 CCTAGCAGAGGGCAGGGGGTGGG - Intronic
1071825528 10:89322062-89322084 CCTGTCATGGGGTAGGGGGAGGG + Intronic
1072089322 10:92111662-92111684 CCTAGGATGGGGAAGCTGGAGGG + Intronic
1072091785 10:92136004-92136026 CCTGTCATGGGGTGGGGGGCAGG + Intronic
1073082451 10:100868629-100868651 TCTAGCCAGGGGATGGGGGCAGG - Intergenic
1073112330 10:101070093-101070115 CCCAGCATGGGGAAGGGAGGTGG - Intergenic
1073321669 10:102619670-102619692 CCTGGCAGGGGGAGGAGGGCTGG - Intronic
1073737496 10:106366502-106366524 CCTAGAGTGGAGAAAGGGGCAGG - Intergenic
1075397257 10:122136416-122136438 ACCAACATGGGGCAGGGGGCAGG + Intronic
1075688460 10:124379756-124379778 CCTTGCACGGTGATGGGGGCGGG + Intergenic
1075764916 10:124885558-124885580 GCTAGCATAAGGAAGGGGCCTGG - Intergenic
1075804811 10:125179138-125179160 CCTGTCATGGGGTGGGGGGCTGG - Intergenic
1075940995 10:126389750-126389772 GGCAGCATTGGGAAGGGGGCTGG - Intergenic
1076340392 10:129741444-129741466 CCCTGCATGGGAAAGGAGGCTGG + Intronic
1076798479 10:132810017-132810039 CCTTGCTTGGGGAGGGGGCCAGG + Intronic
1076871209 10:133195981-133196003 CGTCGCATGGGGAAGGGAGTGGG + Intronic
1077107394 11:848134-848156 CGTGGCCAGGGGAAGGGGGCCGG + Intronic
1077107478 11:848396-848418 CCTCGCTGGGGGAAGGGGACAGG - Intronic
1078119853 11:8495941-8495963 CCTGTCATGGGGTGGGGGGCTGG + Intronic
1079002454 11:16769618-16769640 CCTGGCATGGCGAAGGGGTGAGG - Intergenic
1079308485 11:19345069-19345091 CCTAGCCTGGGAAAGGGCTCGGG + Intergenic
1079813567 11:25026135-25026157 CCTGTCATGGGGTAGGGGGAGGG + Intronic
1079857004 11:25617458-25617480 CCTGTCATGGGGTAGGGGGGAGG + Intergenic
1080107830 11:28529596-28529618 CATAGCAGGGGGTGGGGGGCGGG + Intergenic
1081143440 11:39532819-39532841 CCTATCATGGGATGGGGGGCAGG - Intergenic
1081569219 11:44279250-44279272 GCTGTCATGGGGAAGGGCGCTGG - Intronic
1081986285 11:47306624-47306646 CCTAGATGGGGGAAGGGGGATGG + Intronic
1083174173 11:60938986-60939008 CCCAGCCCGGGGAAGGGGGTTGG + Intronic
1083889895 11:65590443-65590465 CCTGACACGGGGCAGGGGGCAGG + Intronic
1083932962 11:65855882-65855904 CCCATCATGAGAAAGGGGGCAGG + Intronic
1084249181 11:67882775-67882797 ACTAGGATGGGGAGGGGGTCTGG + Intergenic
1084411116 11:69006329-69006351 CCCAGCGTGGGGGAGGGGGGGGG + Intronic
1084738330 11:71120689-71120711 CCAAGGATGGGGGAGGGTGCGGG - Intronic
1084856328 11:71990002-71990024 CTTTGCCTGGGGAAGGGGCCAGG + Intronic
1084912525 11:72402480-72402502 GATAGGATGGGGGAGGGGGCAGG + Intronic
1085084330 11:73656649-73656671 CCTGGCATGGGGTGGGTGGCAGG + Intronic
1085276208 11:75301881-75301903 CCCAGGAGGGGGAAGGAGGCAGG + Intronic
1085575518 11:77599417-77599439 CCTGTCATGGGGTGGGGGGCTGG - Intronic
1086253091 11:84840833-84840855 CCTGTCCTGGGGTAGGGGGCAGG + Intronic
1086398721 11:86443277-86443299 CCAAGCACGTGGAAGGAGGCTGG - Intronic
1086910444 11:92465706-92465728 CCTGTCATGGGGTGGGGGGCAGG + Intronic
1087136415 11:94725150-94725172 CCAAGCTTGGGGAAGGAGGCAGG + Intronic
1087898824 11:103617303-103617325 CCTATCAGGGGGTGGGGGGCTGG + Intergenic
1088162059 11:106884032-106884054 CCTGTCATGGGGAAGGGGGAGGG + Intronic
1088380377 11:109186435-109186457 CCTATCATGGGGTGGGGGGAGGG - Intergenic
1088381226 11:109194787-109194809 CCTGTCAGGGGGCAGGGGGCAGG - Intergenic
1088400713 11:109420784-109420806 GCTAGCATTGGGGTGGGGGCGGG + Intergenic
1088983426 11:114884580-114884602 CCTGTCATGGGGTAGGGGGAGGG - Intergenic
1089503743 11:118949247-118949269 CCTGTCATGGGGTAGGGGGCAGG - Intronic
1089832074 11:121337789-121337811 CCTGGAATGGGGAAGAGGGGAGG - Intergenic
1090306170 11:125693098-125693120 CCTAGCCCTGGGCAGGGGGCAGG + Intergenic
1090350136 11:126102736-126102758 CCTAGCAAGGAGCAGGAGGCAGG + Intergenic
1090381819 11:126332682-126332704 ACCAGGCTGGGGAAGGGGGCTGG - Intronic
1090687675 11:129141465-129141487 CCTGTCATGGGGTAGGGGGATGG + Intronic
1090723538 11:129499480-129499502 CCTGTCATGGGGTAGGGGGATGG + Intergenic
1090854609 11:130600691-130600713 CAGAGCAGGAGGAAGGGGGCAGG + Intergenic
1091215539 11:133899185-133899207 CCAAGCATGGGGAAGAGCTCAGG + Intergenic
1091239443 11:134042741-134042763 CCTATCTTGGGGCAGGGGTCTGG - Intergenic
1091241115 11:134053123-134053145 CTCAGCATGGAGACGGGGGCGGG + Intergenic
1092847469 12:12596975-12596997 CCTGTCATGGGGTAGGGGGAGGG + Intergenic
1094405768 12:30114835-30114857 CCTGTCATGGGGTAGGGGGAGGG - Intergenic
1095652883 12:44634320-44634342 CCTGTCATGGGGTGGGGGGCTGG - Intronic
1095946921 12:47758921-47758943 CCTGGGGAGGGGAAGGGGGCGGG - Intronic
1096041182 12:48519127-48519149 CCTGTCATGGGGTGGGGGGCAGG - Intronic
1096546226 12:52341972-52341994 CCTAGCATGGAGCAGGAGCCAGG + Intergenic
1097262057 12:57725758-57725780 CCCAACATGGGGATGGGGGCGGG - Intronic
1098820231 12:75218768-75218790 CCTGTCATGGGGTGGGGGGCAGG - Intergenic
1099319607 12:81129773-81129795 CCTATCATGGGGTGGGGGGAGGG - Intronic
1099467693 12:83006931-83006953 CCTGTCATGGGGTCGGGGGCTGG + Intronic
1100749245 12:97678926-97678948 CCTGTCATGGGGTGGGGGGCTGG + Intergenic
1101054721 12:100900449-100900471 CCTGTCATGGGGTAGGGGGAGGG - Intronic
1102520004 12:113472218-113472240 CCAGGGATGGCGAAGGGGGCAGG - Intronic
1103362768 12:120363405-120363427 ACTAACACAGGGAAGGGGGCGGG + Intronic
1103908620 12:124339974-124339996 GTTGGCATGGGGGAGGGGGCGGG - Intronic
1104408218 12:128536384-128536406 CCTGTCATGGGGTGGGGGGCTGG + Intronic
1104736396 12:131138264-131138286 CCGAGCCTGGGGAAGGAGGATGG - Intronic
1105884205 13:24628180-24628202 CCCAGCCTGGGGAAGGAGGAGGG - Intergenic
1105942140 13:25157043-25157065 TCCAGAATGGGGAAGAGGGCCGG - Intergenic
1106633023 13:31496695-31496717 CCTGTCATGGGGTTGGGGGCTGG + Intergenic
1106649892 13:31679070-31679092 CCTGTCATGGGGTAGGGGGAGGG - Intergenic
1106932004 13:34676665-34676687 CCTGTCATGGGGTAGGGGGAGGG - Intergenic
1108373565 13:49793124-49793146 CCTATCAGGAGGAAGAGGGCGGG + Intergenic
1109271000 13:60254812-60254834 CCTGTCATGGGGTGGGGGGCGGG + Intergenic
1109309111 13:60671767-60671789 CTTTGCATGGGGATGGGGGATGG + Intergenic
1110015625 13:70397761-70397783 CGTATCATGGGGTAGGGGGATGG - Intergenic
1110159595 13:72359570-72359592 CCTGTCATGGGGAGGGGGGAGGG + Intergenic
1110791102 13:79587861-79587883 CCTGTCATGGGGTAGGGGGATGG - Intergenic
1112182878 13:97102705-97102727 CCCAGCATGGGATAGGGGACAGG + Intergenic
1112624850 13:101092524-101092546 ACTAGCCAGGTGAAGGGGGCAGG - Intronic
1112628653 13:101136452-101136474 CCTGTCATGGGGCAGGGGGAGGG - Intronic
1113486087 13:110653173-110653195 CCTGGGGTGGGGAGGGGGGCTGG + Intronic
1113731894 13:112647571-112647593 CCGAGCTTGGGCAAGGAGGCCGG + Exonic
1114244520 14:20900246-20900268 CGTAGCATTAGGATGGGGGCTGG - Intergenic
1114318190 14:21525827-21525849 CCCGGCATGGGGCAGGGGGGTGG + Intronic
1114433528 14:22683781-22683803 CCTGTCATGGGGTAGGGGGAGGG + Intergenic
1116403744 14:44542499-44542521 CCTGTCATGGGGCGGGGGGCAGG + Intergenic
1116754430 14:48928049-48928071 CCTGTCAGGGGGTAGGGGGCTGG + Intergenic
1116914467 14:50509225-50509247 CCTGTCATGGGGTGGGGGGCAGG + Intronic
1117472350 14:56058767-56058789 GATAGCTTGGGGGAGGGGGCTGG + Intergenic
1117772722 14:59151091-59151113 ACAAGGATGGGGAAGTGGGCAGG + Intergenic
1118604332 14:67491904-67491926 CCTGGCATGGGGAAGGTGCATGG + Intronic
1119168065 14:72512471-72512493 CCTGGCATGGGGAAAGGAGCTGG - Intronic
1119581923 14:75792216-75792238 CCTATCATGGGGTGGGGGGAGGG + Intronic
1120090698 14:80329731-80329753 CCTAGTGTGGGGTGGGGGGCTGG + Intronic
1120463413 14:84825884-84825906 CCTACCAGGGGAAAAGGGGCAGG - Intergenic
1121117090 14:91351540-91351562 CCACCCATGGGGAAGGAGGCAGG + Intronic
1121241243 14:92431499-92431521 ACTGGCATGGTGAAGGGGGTGGG - Intronic
1121640131 14:95479768-95479790 CCTGGCTTGAGGAAGGTGGCTGG + Intergenic
1122070124 14:99200698-99200720 CCTGGCATGGCGCAGGAGGCTGG + Intronic
1122295067 14:100700847-100700869 CCGGGCAGGGGGAAGGGAGCTGG + Intergenic
1122314386 14:100817244-100817266 CCTGGCAGGGCGAAGTGGGCAGG + Intergenic
1122393619 14:101407469-101407491 CCTTGCCTGGAGAAGGCGGCTGG - Intergenic
1122832994 14:104412191-104412213 CCTGTCATGGGGTAGGGGGAGGG - Intergenic
1123057040 14:105575556-105575578 CCTGTCCTGGGGGAGGGGGCGGG - Intergenic
1123081206 14:105696335-105696357 CCTGTCCTGGGGGAGGGGGCGGG + Intergenic
1124022002 15:25933729-25933751 CCTGAGATGGGGCAGGGGGCGGG - Intergenic
1124178296 15:27447844-27447866 CCTGTCAGGGGTAAGGGGGCTGG + Intronic
1124340558 15:28886873-28886895 CCTGCCATGGGGAAGGGGCCAGG - Intronic
1124811345 15:32942085-32942107 CCTGGCATGTGGCAGGGGTCTGG - Intronic
1125355620 15:38814612-38814634 CCTGTCATGGGGTGGGGGGCTGG + Intergenic
1125508533 15:40281098-40281120 CCCAGCGAGGGGAGGGGGGCCGG + Intronic
1126071812 15:44872132-44872154 CCTGTCATGGGGTGGGGGGCAGG + Intergenic
1126617694 15:50602376-50602398 CCTGTCATGGGGTAGGGGGCAGG + Intronic
1126617778 15:50603453-50603475 CCTGTCATGGGGTGGGGGGCAGG - Intronic
1127885330 15:63194079-63194101 CCTAACAGGAAGAAGGGGGCAGG - Intronic
1128249014 15:66151950-66151972 CCTGCCATGGGGCGGGGGGCAGG + Intronic
1128325387 15:66720725-66720747 TCTAGCACGGGGAAGGGGATGGG + Intronic
1131116503 15:89799381-89799403 CCTGTCCTGGGGCAGGGGGCAGG + Intronic
1131256621 15:90867076-90867098 GCTTGCTTGGGGAAGGGGGCAGG - Intergenic
1131917031 15:97278878-97278900 CCTATCAGGGGGTGGGGGGCGGG - Intergenic
1132066111 15:98732558-98732580 GTGAGCATGGGGAAGGGGGTCGG + Intronic
1132661350 16:1062856-1062878 CCTACCATAGGGAAGTGGCCAGG + Intergenic
1132704628 16:1237770-1237792 CCTAGCATGGGGCAGGTCCCAGG + Intergenic
1132706885 16:1248655-1248677 CCTAGCATGGGGCAGGTCCCAGG - Intergenic
1132980908 16:2738272-2738294 CCCAGCACGGGGATGGAGGCTGG + Intergenic
1133041785 16:3064856-3064878 CTCAGCTGGGGGAAGGGGGCTGG + Intergenic
1133414546 16:5596109-5596131 CCTAGCTAGGGGGAAGGGGCTGG + Intergenic
1133918939 16:10134470-10134492 CCTGTCAGGGGGTAGGGGGCTGG + Intronic
1134189680 16:12111548-12111570 CCTTGCAGTGGGAAGGGGCCGGG - Intronic
1136429040 16:30186454-30186476 CCTGGGGTGGGGACGGGGGCGGG - Intronic
1136632364 16:31496449-31496471 CCTAGGGTGGGCAAGGGGGCTGG + Intronic
1137460917 16:48662496-48662518 CCTGTCATGGGGTAGGGGGAAGG - Intergenic
1138528097 16:57620373-57620395 CCTAGCACCGGGAAGCTGGCAGG + Intronic
1138891918 16:61154045-61154067 CCTGTCATGGGGTAGGGGGAAGG - Intergenic
1139915930 16:70428533-70428555 CCTAGCAGGGAGGAAGGGGCAGG - Intronic
1140055824 16:71524784-71524806 CCTAGCACGGGAAAGATGGCAGG + Intronic
1140750135 16:78015884-78015906 CCTAGAAGAGGGAAGGGAGCTGG + Intergenic
1141692967 16:85606897-85606919 CCGAGGCAGGGGAAGGGGGCTGG - Intergenic
1142535591 17:615757-615779 GGTAGCATGGGGAAGGGGTCAGG + Intronic
1142619327 17:1154827-1154849 GCTGGAATGGGGAAGGGAGCGGG - Intronic
1142739000 17:1919542-1919564 ATTAGCTTGGGGAGGGGGGCTGG + Intergenic
1143631886 17:8144465-8144487 CCTAGCCTGGGGGCAGGGGCAGG - Intronic
1144227143 17:13160255-13160277 CCTAGCCTCAGGAAGAGGGCTGG + Intergenic
1144322642 17:14145003-14145025 CCTAGAAAGTGGAAGGGGACAGG + Intronic
1144342782 17:14324039-14324061 CCTAGGTTGGGGTTGGGGGCAGG - Intronic
1144757271 17:17687241-17687263 GCGAGCATGGGGTAGGGGGCAGG + Intronic
1144775883 17:17784322-17784344 CCTAGGCTGGGGAAGGCGGAAGG + Intronic
1144779560 17:17800987-17801009 CCTGGCATGTGGAAGGGGCTTGG + Intronic
1145733178 17:27209058-27209080 CCTGTCATGGGGTCGGGGGCTGG + Intergenic
1146308217 17:31746848-31746870 CCAAGCAGGAAGAAGGGGGCTGG - Intergenic
1146507365 17:33416924-33416946 TCTAGCATGGGCAGGGAGGCAGG - Intronic
1146593707 17:34151486-34151508 CCTGGCGTGGGGAGAGGGGCTGG + Intronic
1146862923 17:36320898-36320920 CCTGTCATGGGGTAGGGGGCTGG - Intronic
1146942685 17:36854860-36854882 CCTAGCAATGGGAGGAGGGCTGG + Intergenic
1147093252 17:38124981-38125003 CCTGTCATGGGGTAGGGGGCTGG - Intergenic
1147103955 17:38195507-38195529 CCTGTCATGGGGTAGGGGGCTGG + Intergenic
1147581948 17:41631984-41632006 CCGAGCAAGGAGATGGGGGCTGG - Intergenic
1147652754 17:42071709-42071731 CCTAGGAGGGGGCATGGGGCCGG - Intergenic
1148127601 17:45244913-45244935 CCTGGCTTGGGGACTGGGGCTGG + Intronic
1148149509 17:45388368-45388390 CGCGGGATGGGGAAGGGGGCTGG + Intergenic
1148425536 17:47592902-47592924 CCTGTCATGGGGTAGGGGGCTGG - Intronic
1148741046 17:49892879-49892901 CACAGCACAGGGAAGGGGGCAGG + Intergenic
1148767526 17:50047800-50047822 CCTAGGGTGGGGGAGGGGACAGG + Intergenic
1148836608 17:50469006-50469028 CCCTCCACGGGGAAGGGGGCGGG + Intronic
1149176502 17:53878205-53878227 CCTATCATGGGGTACGGGGAGGG + Intergenic
1149506521 17:57198487-57198509 CCTAACAATGGGTAGGGGGCGGG - Intergenic
1149932445 17:60769556-60769578 CCTGCCGTGGGGAAGGGGGAGGG + Intronic
1149991813 17:61387684-61387706 TCCAGCATGGGCATGGGGGCCGG + Intronic
1149994006 17:61397398-61397420 CCTGGGAAGGGGGAGGGGGCCGG + Intergenic
1150321859 17:64221194-64221216 CCTGTCAGGGGGCAGGGGGCAGG + Intronic
1150426872 17:65084110-65084132 CCTGTCATGGGGTGGGGGGCTGG + Intergenic
1151143147 17:72014663-72014685 CCTGTCATGGGGTGGGGGGCAGG + Intergenic
1151390868 17:73785936-73785958 CCCAGCCTGGGGAACGGTGCCGG - Intergenic
1151955210 17:77376696-77376718 CCTGGCATGGGGAAAGAGGCAGG + Intronic
1152360686 17:79831923-79831945 CCCAGCATGGGGAGGGGAGGGGG - Intergenic
1152404362 17:80087990-80088012 GCCTGCATGGGGGAGGGGGCGGG - Exonic
1152878122 17:82800010-82800032 CAGAGCAGGGGGATGGGGGCTGG - Intronic
1153263411 18:3245939-3245961 GCTACCTTGGGGATGGGGGCGGG - Intergenic
1156517476 18:37693092-37693114 CCTGTCATGGGGTAGGGGGCAGG - Intergenic
1156728266 18:40157415-40157437 CCTGTCATGGGGTAGGGGGAAGG - Intergenic
1156905950 18:42352291-42352313 CCTGTCATGGGGTGGGGGGCTGG - Intergenic
1157220663 18:45826600-45826622 CCTAGGATGGGGATGGGGTAAGG - Intronic
1157231606 18:45921805-45921827 CCTGTCATGGGGTGGGGGGCTGG + Intronic
1159851984 18:73535367-73535389 CCTAGGCTGGGGAGGGCGGCTGG - Intergenic
1160616275 18:80131842-80131864 CCTGTCATGGGGTGGGGGGCAGG + Intronic
1160741935 19:690387-690409 CCTGGGATGGGGAACGGCGCTGG + Intronic
1160835442 19:1122629-1122651 CCCTGCCTGGGGCAGGGGGCGGG - Intronic
1161273459 19:3403275-3403297 CCTTGAATGTGGGAGGGGGCTGG - Intronic
1161838931 19:6667072-6667094 CCTGGCAAGGGGCAGGGGTCAGG - Intronic
1161854100 19:6753814-6753836 CGTAGCCTAGGGAAAGGGGCTGG + Intronic
1162629054 19:11911665-11911687 CCTGTCATGGGGTAGGGGGAGGG + Intronic
1162632302 19:11938382-11938404 CCTGTCATGGGGTAGGGGGAAGG - Intronic
1162823582 19:13237633-13237655 TCTAGGATGGGGAAGGGGGCTGG + Intronic
1162884928 19:13689898-13689920 CCTGTCATGGGGTAGGGGGAGGG + Intergenic
1162948459 19:14057304-14057326 CCTAGCCTGGGGAATGGAGTGGG - Intronic
1163041569 19:14606857-14606879 CATACCATGGGGACGGGGACGGG + Intronic
1163219026 19:15900953-15900975 CCTAGCATGAGGCAGATGGCTGG - Intergenic
1163437206 19:17302902-17302924 CCCAACCTGGGGTAGGGGGCAGG - Intronic
1164145539 19:22510460-22510482 CCTTGCATGGGGAGGGGTCCTGG - Intronic
1164245269 19:23422653-23422675 CCTAACGTGGAGAAGGAGGCAGG + Intergenic
1164308791 19:24028888-24028910 CCTAACATGGAGGAGGAGGCAGG - Intergenic
1164601707 19:29567174-29567196 GATGGCATGGGGAAGGGGACAGG + Intergenic
1164713736 19:30376843-30376865 CCTAGCCTGGGGGTGGGGTCGGG - Intronic
1164735214 19:30536179-30536201 CCAAGGATGAAGAAGGGGGCAGG - Intronic
1165482588 19:36073544-36073566 CCAAGCAGGGGCAAGGGGGTGGG - Intronic
1165973584 19:39655086-39655108 ACTATCATGGGGTGGGGGGCAGG + Intergenic
1166069945 19:40381173-40381195 CGGGGCATGGAGAAGGGGGCAGG + Intronic
1166839468 19:45687818-45687840 CATGGCTTGGGGAAGGGTGCAGG + Intronic
1167322891 19:48807283-48807305 CGCAGCATGGAGGAGGGGGCGGG - Intronic
1167380040 19:49133396-49133418 CCTTGCGTGGGGAAGGGGTGGGG + Intronic
1167643328 19:50693719-50693741 CTCAGCATGGGGAGGGGGGCTGG - Intronic
1167643835 19:50695403-50695425 CCGGGCAGGGGGGAGGGGGCCGG + Intronic
1168720088 19:58550042-58550064 CCTAGGATGGGAAAGGGGAAGGG + Intronic
925301324 2:2815023-2815045 CCTGTCATGGGGTAGGGGGAAGG - Intergenic
925804452 2:7634315-7634337 CCTATAATGGGGAAGGGGTGGGG + Intergenic
926332137 2:11834422-11834444 CCTAATATGGGGGCGGGGGCTGG - Intergenic
926847111 2:17153672-17153694 CCTATCATGGGGTGGGGGGAGGG + Intergenic
926911279 2:17853659-17853681 CCTAGCATGGGGGACAGGGGTGG - Intergenic
927259150 2:21069504-21069526 CCTGCCATGGGGTAGGGGGGTGG - Intergenic
928718015 2:34085564-34085586 CCTGTCATGGGGTAGGGGGAGGG + Intergenic
928755605 2:34521881-34521903 CCTGTCATGGGGTCGGGGGCTGG + Intergenic
929090294 2:38209957-38209979 CCTGTCATGGGGTGGGGGGCTGG + Intergenic
930295340 2:49546940-49546962 CCTGTCATGGGGTAGGGGGAGGG + Intergenic
930502221 2:52235694-52235716 CCTGTCATGGGGTAGGGGGATGG + Intergenic
930941621 2:57021406-57021428 CCTGTCATGGGGTGGGGGGCAGG - Intergenic
931195685 2:60050504-60050526 CTTGGGATGGGGAAGGGGACTGG + Intergenic
932460630 2:71879712-71879734 CCCAGCATGGGGCAGTGAGCAGG - Intergenic
932491942 2:72127993-72128015 CCCAGGGTGGGGAAAGGGGCAGG - Intergenic
932750979 2:74371536-74371558 CCTTGGATGGGGAAGGAAGCGGG + Exonic
933653519 2:84868429-84868451 CCTGTCATGGGGTAGGGGGAGGG + Intronic
933663230 2:84944443-84944465 CATAGCTTGAGGATGGGGGCTGG + Intergenic
934954051 2:98601909-98601931 CCACGGACGGGGAAGGGGGCAGG - Intronic
935379120 2:102432725-102432747 CCTGGCCTGGGGAAGGCTGCAGG + Intronic
936097832 2:109547050-109547072 CCCTGGTTGGGGAAGGGGGCTGG - Intronic
936751715 2:115650396-115650418 GCTGGCATGGGGAAAGGGGGGGG + Intronic
936933271 2:117812276-117812298 CCTAGCCTTGGGAAGGGGTCTGG - Intergenic
937130665 2:119510133-119510155 CCTGTCAGGGGGTAGGGGGCTGG - Intronic
937284836 2:120743738-120743760 CCTATCTCTGGGAAGGGGGCGGG + Intronic
937612232 2:123876057-123876079 CCTGTCATGGGGTTGGGGGCAGG - Intergenic
939019401 2:136941003-136941025 CCTGTCATGGGGTGGGGGGCTGG - Intronic
939934530 2:148274376-148274398 CCTGTCATGGGGTGGGGGGCTGG - Intronic
939947723 2:148429839-148429861 CCTGTCATGGGGTGGGGGGCTGG + Intronic
941188238 2:162344085-162344107 GCTGGCCTGCGGAAGGGGGCGGG + Exonic
942523136 2:176825656-176825678 TCTTGCATGGGGAAGGAGGAAGG - Intergenic
943092306 2:183389866-183389888 TTTAGCATGGGGCAGGGTGCTGG + Intergenic
943608459 2:190004123-190004145 CTTAGAATGGGGAGGGGGGAGGG + Intronic
943908319 2:193529601-193529623 CCTGTCAGGGGGTAGGGGGCTGG - Intergenic
944152087 2:196570545-196570567 CCTGTCATGGGGTAGGGGGTAGG + Intronic
944256658 2:197629438-197629460 CCTGTCATGGGGCAGGGGGATGG + Intronic
944655089 2:201869372-201869394 CCTGTCATGGGGTGGGGGGCAGG + Intronic
945259669 2:207831906-207831928 CCCAGCAGGGGAAAGGGGGCTGG - Intronic
945417749 2:209595948-209595970 CCTGTCATGGGGTAGGAGGCAGG + Intronic
945444030 2:209914566-209914588 GCTGGGAGGGGGAAGGGGGCTGG - Intronic
945715568 2:213354033-213354055 CCTATCATGGGGTGTGGGGCTGG - Intronic
946173716 2:217910217-217910239 GCTGGCATGGGGAAGGGGTGGGG - Intronic
948703284 2:239774130-239774152 CCTTGCCTGGAGAAGGGGCCAGG + Intronic
1168750247 20:276971-276993 CAGAGGATGGGGAAGAGGGCGGG + Intronic
1169307898 20:4508949-4508971 GCTAGCATCAGGATGGGGGCTGG - Intergenic
1169622572 20:7524663-7524685 GCCAGCATGGGGATGGGGGGTGG - Intergenic
1170920548 20:20674929-20674951 CCTAAAATGGTGAAGGGGGAGGG + Intronic
1171245798 20:23608661-23608683 CCAAGCAGGGGGAATGGGGAGGG - Intergenic
1171346785 20:24471168-24471190 CCTAGCACGGAGAAGTTGGCCGG - Intronic
1171392860 20:24812255-24812277 CCCAGCCTGGGGTATGGGGCAGG - Intergenic
1171442998 20:25180987-25181009 CCTGTTGTGGGGAAGGGGGCAGG - Intergenic
1171971712 20:31569027-31569049 CCTAGGATGGGGGTGGGGGAAGG + Intronic
1172455726 20:35071429-35071451 CCTGGCATGGGGTGGGGGGAGGG - Intronic
1172457112 20:35086034-35086056 GCTGGGAGGGGGAAGGGGGCAGG - Intronic
1172623937 20:36336847-36336869 CCCAGGAAGGAGAAGGGGGCTGG - Intronic
1172942213 20:38661923-38661945 CCTACTATGGGGGAGGGGGAGGG + Intergenic
1173185307 20:40835940-40835962 CCTGGCATGGAGAAGGGTGATGG + Intergenic
1173402355 20:42736747-42736769 CCTTGGCAGGGGAAGGGGGCAGG + Intronic
1173703504 20:45093680-45093702 CCCAGCAAGGGTGAGGGGGCTGG + Exonic
1173911518 20:46674353-46674375 CTCACTATGGGGAAGGGGGCAGG + Intronic
1174402693 20:50284374-50284396 CCAAGCAAAGGGAAGGGCGCAGG - Intergenic
1175250169 20:57604403-57604425 CCTGGCATGGGGATGGGTTCAGG - Exonic
1175423342 20:58849765-58849787 CCTAGCACGGTGAAGGAAGCAGG - Intronic
1175753499 20:61514957-61514979 CCTGGCATTGGGGCGGGGGCGGG + Intronic
1175979740 20:62732243-62732265 CCTAAGATAGGGAAGGAGGCAGG - Intronic
1176150405 20:63587979-63588001 CCCAGCGTGGGGAAGGGCCCTGG - Exonic
1177122717 21:17157739-17157761 CCTGTCATGGGGTAGGGGGCTGG + Intergenic
1178223022 21:30682723-30682745 ACTAGAGTGGGGAAGGGGGCAGG - Intergenic
1178249718 21:30990776-30990798 CCCAGCAGGGGGAGCGGGGCTGG + Intergenic
1179305769 21:40152869-40152891 CCTTTCAATGGGAAGGGGGCAGG - Intronic
1179360930 21:40708093-40708115 CCTAGGATGGGGTAGGGGAAGGG + Intronic
1180109125 21:45639775-45639797 TCTATGCTGGGGAAGGGGGCTGG + Intergenic
1180237963 21:46476488-46476510 ACTAGCATGGGGAAGAGCTCAGG + Intronic
1180539618 22:16431725-16431747 CCTATCAAGGGGGCGGGGGCAGG + Intergenic
1181082596 22:20424846-20424868 CCCAGCCTGGGGAGGAGGGCTGG - Exonic
1182281103 22:29218166-29218188 CCCAGCATGGGGTAGGCGGTGGG - Intronic
1182331720 22:29555713-29555735 TCTAGCAGGGGGAGGGAGGCAGG + Exonic
1182704058 22:32264031-32264053 CCTGTCATGGGGTTGGGGGCTGG + Intergenic
1182847598 22:33444497-33444519 CCTTGCATGGCGAAGTGGTCAGG + Intronic
1183061722 22:35340277-35340299 GCTAGCATGGGGTTGGGGGTAGG + Intronic
1183286269 22:36966089-36966111 TCCAGCATGGGGAAGAAGGCAGG - Intergenic
1183289150 22:36988294-36988316 CCTGGGATGGGGTAGGGTGCCGG - Intergenic
1183742266 22:39675373-39675395 CAGAGCATGGGGAAGGGGAGAGG - Intronic
1184265939 22:43346076-43346098 CCTGGCAGGGGAAAGGGTGCAGG - Intergenic
1184950262 22:47836960-47836982 CCTGGCATGGGGCAGGTGCCAGG + Intergenic
1184986869 22:48141706-48141728 CCAAGCATGGGGGCAGGGGCTGG + Intergenic
1185272928 22:49936936-49936958 TCCAGCATGGGGAAGGGGTAAGG - Intergenic
949305850 3:2639918-2639940 CCTAGCACGGGGAAAGGGGGTGG - Intronic
949450564 3:4180536-4180558 CCTGTCATGGGGTGGGGGGCTGG + Intronic
949588975 3:5473507-5473529 CCTAGCATGGGAAATGGTGAGGG - Intergenic
950265306 3:11568894-11568916 CCTAGGATGGGGATGAGGCCCGG - Intronic
950289249 3:11770387-11770409 CCCAGCAAGGGGAAGGGGCTTGG - Intergenic
950460909 3:13121789-13121811 CCCAGGATGGGGCAGTGGGCTGG + Intergenic
950469752 3:13177340-13177362 CCCAGCATGGGGATGGGGTGGGG - Intergenic
951538537 3:23761342-23761364 ACCAGCTGGGGGAAGGGGGCTGG + Intergenic
952221170 3:31325686-31325708 CTTGACATGGGGAAGAGGGCTGG - Intergenic
952455556 3:33468369-33468391 CCTACCAAGGAGAATGGGGCAGG - Intergenic
953328405 3:42031966-42031988 CACAGCATGGGTTAGGGGGCGGG + Intronic
953405292 3:42656834-42656856 CCTGGCATGGGGAAGGGGGGCGG + Intronic
953848399 3:46446922-46446944 CCTTGCAGGAGTAAGGGGGCGGG + Intronic
953909078 3:46882831-46882853 CCAAGGATGGGGAAGGGGTGCGG + Intronic
954298026 3:49684950-49684972 GCTTGCCTGGGGAAGGGGGAAGG + Intronic
954305441 3:49723110-49723132 CCCAGCTGGGGGAAGGGGACAGG + Exonic
954584404 3:51720965-51720987 CCTGACATGGGAAAGGGGGAGGG + Intergenic
954864516 3:53717546-53717568 CCTACCATGGAGAAGTGGGATGG + Intronic
954915896 3:54148485-54148507 ACTAGCATGTGGCAGGGGGTTGG + Intronic
955361123 3:58275791-58275813 CCAGGCAGGGGGTAGGGGGCTGG - Intronic
956051852 3:65256671-65256693 CCTGGGCTGGGGAAGGGGGGTGG - Intergenic
956873978 3:73444085-73444107 CCAAGCATGGGGTCAGGGGCAGG - Intronic
957195953 3:77068761-77068783 ACTAGCCTGCGGAAGTGGGCTGG - Intronic
957696104 3:83639548-83639570 CCTGTCATGGGGTAGGGGGAGGG + Intergenic
957744921 3:84328024-84328046 CATAGAATGGGGAAGTGGACTGG - Intergenic
959003583 3:100993398-100993420 CCTCGCATGGGGAATGATGCTGG + Exonic
959173574 3:102875377-102875399 CCTGTCATGGGGTTGGGGGCTGG + Intergenic
960276212 3:115732306-115732328 CCTGTCATGGGGTGGGGGGCAGG - Intergenic
960771172 3:121193816-121193838 CCTGTCATGGGGTAGGGGTCAGG + Intronic
961311091 3:126001906-126001928 CCTGTCATGGGGTAGGGGGCAGG + Intergenic
962349142 3:134644163-134644185 CCTAGGCTGGGGTAGGAGGCAGG - Intronic
962480034 3:135790032-135790054 CCTGTCATGGGGTGGGGGGCAGG - Intergenic
962861839 3:139410574-139410596 CCTGTCATGGGGTGGGGGGCTGG + Intergenic
963080813 3:141392238-141392260 AGTAGAGTGGGGAAGGGGGCTGG + Intronic
964371880 3:156008687-156008709 CCTGTCAGGGGGTAGGGGGCTGG - Intergenic
964560948 3:157995423-157995445 CCTGTCAGGGGGTAGGGGGCTGG + Intergenic
964581156 3:158239567-158239589 CCTGTCATGGGGTGGGGGGCTGG + Intronic
964626640 3:158766101-158766123 TCAAGCATGGGAAAGGTGGCAGG + Intronic
964691442 3:159454328-159454350 CCTGGGATGGGGGTGGGGGCTGG + Intronic
965206054 3:165720128-165720150 CCTTGCATGGAGCAGGGGCCTGG - Intergenic
966413872 3:179669551-179669573 CTTAGCCTGGGGAAGATGGCAGG - Intronic
966818851 3:183909479-183909501 GCTTGCCTGGGGAACGGGGCTGG - Intergenic
966819070 3:183910815-183910837 CCAAGGATGGGGAAGGGGAGTGG + Intergenic
966871345 3:184292125-184292147 CCCAGCACGCGGAAGCGGGCAGG - Exonic
967311239 3:188108294-188108316 CCTGTCGTGGGGTAGGGGGCAGG - Intergenic
968233556 3:197017966-197017988 CTGAGCAGGGGGCAGGGGGCAGG + Intronic
968470922 4:781982-782004 CCGGGCCTGGGGAAGGGAGCGGG - Intergenic
968743039 4:2340859-2340881 CCTAGAAAGGGGAGGCGGGCAGG + Intronic
968811374 4:2801021-2801043 CCTGGCCTTGGGAAGGGGGCTGG + Intronic
968844030 4:3029809-3029831 AGGAGCATGGGGAAGGAGGCAGG - Intronic
969075867 4:4577250-4577272 CCTAGCATGGGGAGGAGGTGGGG - Intergenic
969121350 4:4913717-4913739 CCTAGCATGGGGAAGCTGCTGGG + Intergenic
969724852 4:8912903-8912925 GCTGGCATGGGGGAGGGGGGGGG - Intergenic
969902672 4:10364237-10364259 CCTAGTATGGGGGGGGGGGGGGG - Intergenic
970448946 4:16148244-16148266 CCTACAGTGGGGAAGAGGGCAGG + Intergenic
973216211 4:47672194-47672216 CCAAGCATCGGGATGGGCGCTGG - Intronic
973818983 4:54645948-54645970 CCCAGCAGGGAGAAGGGGACAGG - Intergenic
973870804 4:55164423-55164445 CCTATCAGGGGGTTGGGGGCTGG - Intergenic
973922038 4:55696782-55696804 CCTGTCATGGGGTAGGGGGTTGG + Intergenic
973964675 4:56149231-56149253 CCTAGCAGGAGGATGGGGGAGGG - Intergenic
974264375 4:59565456-59565478 CCTGTCATGGGGCGGGGGGCTGG - Intergenic
974361533 4:60887237-60887259 CCTGTCATGGGGTAGGGGGAGGG - Intergenic
975359869 4:73456721-73456743 CGGAGCATGGGCAATGGGGCAGG + Intergenic
976505998 4:85848331-85848353 CCTGTCATGGGGTAGGGGGATGG - Intronic
977572286 4:98641092-98641114 CCTAGCATTGGGAAGAGGAGGGG + Intronic
977615871 4:99087237-99087259 CCGAGCATGGTGACGGGCGCCGG + Intronic
977984288 4:103363564-103363586 AGTAGCAGGGGGAAGGGGGCTGG - Intergenic
978046348 4:104134066-104134088 CCTGTCATGGGGTGGGGGGCTGG - Intergenic
978503689 4:109434220-109434242 CCTGGCGTGGGGGCGGGGGCCGG + Intronic
978734546 4:112070534-112070556 CCTATCATGGGGTGGGGGGAGGG + Intergenic
979497127 4:121395996-121396018 CCTGTCATGGGGTGGGGGGCTGG + Intergenic
979623183 4:122818501-122818523 GATAGCATGGGGCAGGGGGTGGG + Intergenic
980260038 4:130436971-130436993 CCTGGCAGGGGGAGGGGGGCTGG - Intergenic
980399389 4:132259983-132260005 CCTGTCATGGGGTAGGGGGAGGG + Intergenic
980476941 4:133330503-133330525 CCTGTCAGGGGGTAGGGGGCTGG - Intergenic
980530446 4:134046185-134046207 CTCAGCAAGGGGAATGGGGCAGG + Intergenic
982280673 4:153681002-153681024 CCTAACGTGGGGTGGGGGGCTGG + Intergenic
982383192 4:154771919-154771941 CCTGTCATGGGGTAGGGGGAGGG - Intergenic
983948550 4:173613401-173613423 CCTGTCAGGGGGGAGGGGGCTGG - Intergenic
984032735 4:174625127-174625149 CCTGTCAGGGGGTAGGGGGCCGG - Intergenic
984372937 4:178889921-178889943 CCTTTCATGGGGTAGGGGGCTGG + Intergenic
985016222 4:185638653-185638675 CCTGGGATGGGGAAGGGTGCGGG + Intronic
985054728 4:186026287-186026309 GTTACCATGGGGAAGGGAGCTGG + Intergenic
985484042 5:139120-139142 CCCAGCCTGGGCAAGGGGCCGGG - Intergenic
985558810 5:571116-571138 CCCAGCCTGGGGCAGGAGGCCGG + Intergenic
986199739 5:5570135-5570157 CCCAGAATGGGGAAGTGGGCTGG + Intergenic
987529644 5:19101083-19101105 CCTGTCATGGGGTGGGGGGCAGG + Intergenic
988612284 5:32738285-32738307 CCTATCAGGGGGTGGGGGGCAGG - Intronic
989346028 5:40430452-40430474 CCTTGCCTAGGGAAAGGGGCAGG + Intergenic
989823040 5:45818599-45818621 CCTGTCATGGGGTAGGGGGAAGG + Intergenic
990456193 5:55990887-55990909 CCTGTCATGGGGTAGGGGGAGGG - Intronic
990941173 5:61204593-61204615 CCTGTCGTGGGGTAGGGGGCAGG + Intergenic
992321859 5:75621156-75621178 CTTGGCTTGGGGGAGGGGGCAGG + Intronic
992772638 5:80062682-80062704 CCTGTCATGGGGTAGGGGGAGGG - Intronic
992796369 5:80257704-80257726 CCTGGCCTGGGGAAATGGGCAGG + Intergenic
993170968 5:84418732-84418754 CCTGTCATGGGGAGGGGGGAAGG - Intergenic
993296349 5:86146392-86146414 CCTGTCATGGGGTAGGGGGAGGG - Intergenic
993474533 5:88348351-88348373 CCTGTCATGGGGTAGGGGGAGGG - Intergenic
993489732 5:88532304-88532326 CCTGTCAAGGGGTAGGGGGCTGG + Intergenic
995357665 5:111257997-111258019 CCTAGCACGGGGAGGGTGTCGGG + Intronic
995685440 5:114766806-114766828 CCTTGGCTGGGGATGGGGGCGGG + Intergenic
996419844 5:123250678-123250700 CCTGTCAGGGGGTAGGGGGCTGG - Intergenic
997219187 5:132145340-132145362 CCTATCATGGGGTGGGGGGCTGG - Intergenic
997411447 5:133694181-133694203 CCTAGCATGGGGACAGGATCTGG + Intergenic
997510053 5:134447888-134447910 CCTCGGATGGGGCAGGAGGCAGG + Intergenic
998133742 5:139664063-139664085 CTGGGCATGGGGGAGGGGGCTGG - Intronic
998323615 5:141257833-141257855 CCTGTCATGGGGTGGGGGGCAGG - Intergenic
998424931 5:142018519-142018541 ACAAACATGTGGAAGGGGGCAGG - Intergenic
999079970 5:148834028-148834050 ACTAGCAAGGGGCAGGGGGAGGG - Intergenic
999261599 5:150241886-150241908 CACAGAATGGGGAAGGGGCCAGG + Intronic
999436941 5:151570579-151570601 CCAAGGATGGGGCAAGGGGCAGG + Intergenic
1000791437 5:165613310-165613332 CCTATCATGGGGTTGGGGGCAGG - Intergenic
1001071846 5:168592695-168592717 CCTGTCATGGGGTAGGGGGAGGG - Intergenic
1001568059 5:172713262-172713284 CCCAGCAAGGGGAAGGGGCCGGG + Intergenic
1002060669 5:176623921-176623943 CCTTGCATGGGAAACGAGGCTGG + Intronic
1002307737 5:178293685-178293707 TCTGGCATGGGGAAGCTGGCAGG + Intronic
1003701238 6:8467260-8467282 CCTAGCTTGGGGAAAGGAGGAGG + Intergenic
1004336934 6:14772281-14772303 ATTAGAATGGGGAAGAGGGCAGG - Intergenic
1006301105 6:33193850-33193872 TCTAACTTGGGGAAGGGGCCTGG - Exonic
1006385349 6:33727664-33727686 CCTAGCAGTTGGAAGGGGCCAGG - Intronic
1006455690 6:34130538-34130560 CCCAGCATGGGGAAGGGCCAGGG - Intronic
1006617050 6:35336745-35336767 CCTGTCATGGGGTGGGGGGCTGG - Intergenic
1006990466 6:38210981-38211003 CCCAGAATGGGGAAGGGGAGGGG - Intronic
1007110913 6:39313227-39313249 CCTAGCAGGGCGGAGGAGGCCGG - Intronic
1007199114 6:40090572-40090594 CCTGTCATGGGGTAGGGGGAGGG - Intergenic
1007259831 6:40555720-40555742 CCTGCCATGGGGGTGGGGGCAGG - Intronic
1007393982 6:41566796-41566818 CCTTGAGTGGGGCAGGGGGCGGG + Intronic
1007795374 6:44342800-44342822 CCTCCCCTGGGGAAGGGGGTGGG + Exonic
1009500541 6:64407291-64407313 CCTGTCATGGGGTGGGGGGCTGG + Intronic
1010154018 6:72770992-72771014 TCTAGAAGGGGGAAGGGGGCGGG + Intronic
1010190143 6:73186939-73186961 CCTGTCATGGGGTAGGGAGCAGG - Intronic
1010669113 6:78665794-78665816 CCTGTCATGGGGTAGGGGGAGGG - Intergenic
1011259420 6:85455970-85455992 GATAGCTTCGGGAAGGGGGCTGG + Intronic
1011282925 6:85694945-85694967 CCTGTCATGGGGTAGGGGGAGGG - Intergenic
1011673114 6:89703356-89703378 CCATGTATGGGGAAGGGGGGGGG + Intronic
1011932258 6:92729071-92729093 CCTGTCATGGGGTTGGGGGCTGG - Intergenic
1012423451 6:99089435-99089457 CCTAGCAAGAGGCAAGGGGCTGG + Intergenic
1014355710 6:120406570-120406592 ACAAGCCTGGGGAAGGGGGGCGG + Intergenic
1014462156 6:121708918-121708940 CCTGTCATGGGGTGGGGGGCAGG + Intergenic
1014649804 6:124022042-124022064 CCTGTCATGGGGTAGGGGGAGGG - Intronic
1015046312 6:128780182-128780204 CCCAGGATGGGCAAGGGGTCGGG - Intergenic
1015155374 6:130089214-130089236 CCTGTCATGGGGTGGGGGGCAGG - Intronic
1015702919 6:136055800-136055822 TGTGGCATGGGCAAGGGGGCGGG + Intronic
1015967164 6:138706070-138706092 CCTGTCATGGGGTGGGGGGCTGG - Intergenic
1015979240 6:138822253-138822275 CATTACATGGGGAAGGAGGCCGG + Intronic
1015989808 6:138927166-138927188 TCTAGCATGGGGTAGGGAGTGGG - Intronic
1016456327 6:144234687-144234709 TCCAGGGTGGGGAAGGGGGCTGG + Intergenic
1016741409 6:147533071-147533093 CCTTGGGTTGGGAAGGGGGCTGG + Intronic
1016783923 6:147989384-147989406 CCTAGAATGAGGTTGGGGGCTGG - Intergenic
1016974204 6:149791033-149791055 CTTAGCATGGAGAGGGGGTCAGG + Intronic
1017092448 6:150772094-150772116 TCCAGCATGGGGAAAGGGGAGGG + Intronic
1017160319 6:151359686-151359708 CCGGGCATGGGGCATGGGGCAGG + Intergenic
1017303240 6:152886496-152886518 CCTGTCATGGGGTGGGGGGCAGG + Intergenic
1018462054 6:164007729-164007751 CCCAGCATGGTGGAGAGGGCAGG + Intergenic
1018490906 6:164292346-164292368 CCTGTCATGGGGTAGGGGGAGGG - Intergenic
1018676606 6:166227629-166227651 CCTAGCATGGGGTGGGGTGCAGG - Intergenic
1018916654 6:168136541-168136563 CAGAGCATGGGGAAGGTTGCAGG + Intergenic
1018994399 6:168700203-168700225 CGCAGCATGGGGAGCGGGGCAGG + Intergenic
1019067025 6:169311013-169311035 CCTTCCATGGGGCAGGGGCCAGG + Intergenic
1019522739 7:1468027-1468049 CCAGGCATGGGGAAGGAGGATGG - Intergenic
1019525974 7:1480747-1480769 CCCAGCCTGGGGAGGGGGACGGG - Intronic
1019557823 7:1641366-1641388 CCACACATGGGGCAGGGGGCAGG - Intergenic
1019710755 7:2517165-2517187 CTGAGCCTGGGGAAGCGGGCGGG + Intronic
1019815543 7:3197255-3197277 CCTGGCATGAGGCTGGGGGCAGG + Intergenic
1020107925 7:5430768-5430790 CCTGGCATGAGGAAGGAGGGGGG + Intergenic
1020327840 7:6989076-6989098 ACTAGGATGGGGAGGGGGTCTGG + Intergenic
1021311419 7:19102519-19102541 TCTATCATGGGCAGGGGGGCGGG - Intronic
1021354633 7:19639042-19639064 CCTATCATGGGGTAGGGGGCAGG - Intergenic
1021749865 7:23785837-23785859 CCTGTCATGGGGTGGGGGGCAGG + Intronic
1022347839 7:29534395-29534417 CCTGTCATGGGGTGGGGGGCAGG + Intergenic
1022651569 7:32282003-32282025 CCTGTCATGGGGTAGGGGACGGG + Intronic
1022877329 7:34548170-34548192 CCTGTCATGGGGTGGGGGGCAGG - Intergenic
1023608829 7:41954401-41954423 CCTGGAGAGGGGAAGGGGGCTGG + Intergenic
1023664239 7:42504855-42504877 CCTGTCATGGGGTAGGGGGAGGG - Intergenic
1027233123 7:76283205-76283227 CCTGGCACGGGGATGGGGGGGGG + Intronic
1027244478 7:76358339-76358361 CCTAGCCTGGGCGTGGGGGCGGG - Intronic
1027250844 7:76397827-76397849 CCTCACCTGGGGATGGGGGCGGG + Exonic
1027727315 7:81824226-81824248 CCTGTCATGGGGTGGGGGGCTGG - Intergenic
1028218171 7:88160957-88160979 CCTGTCATGGGGCAGGGGGAAGG + Intronic
1028241560 7:88427230-88427252 CCTATCATGGGGTGGGGGGAGGG + Intergenic
1028394282 7:90350069-90350091 CCTGTCATGGGGTTGGGGGCTGG - Intronic
1028638340 7:93016043-93016065 CCCAGCAAAGGGAAGGGGGAGGG - Intergenic
1028736740 7:94221818-94221840 CCTGTCAGGGGGTAGGGGGCTGG + Intergenic
1029448304 7:100626980-100627002 CCTAGCATGGGGAAGGGGGCTGG + Intronic
1029457562 7:100678886-100678908 CGTGGCCCGGGGAAGGGGGCTGG - Exonic
1029518512 7:101043988-101044010 CCTGCCATGGGGTAGGGGGATGG - Intronic
1030147476 7:106371286-106371308 TGGAGCATGGGGAAGTGGGCAGG - Intergenic
1030462962 7:109863485-109863507 CCTGTCAGGGGGTAGGGGGCTGG + Intergenic
1030678139 7:112406271-112406293 CCCAGCATGGGGCAGGGGCCAGG - Intergenic
1031864733 7:127025999-127026021 CCTGTCAGGGGGCAGGGGGCTGG - Intronic
1031970060 7:128058120-128058142 CCTAGCACTGGCAAGGGGTCAGG - Intronic
1032188744 7:129750382-129750404 CCTGGCAAGGGAAAGGGGGAGGG - Intronic
1033377942 7:140782057-140782079 CCTGTCATGGGGTAGGGGGAGGG - Intronic
1033473290 7:141667838-141667860 CCTGGCATGGGGTAGGGGAATGG - Intronic
1033973897 7:147075779-147075801 CCTATCGTGGGGTAGGGGGAAGG - Intronic
1034692617 7:153025978-153026000 CCTGTCATGGGGTGGGGGGCTGG - Intergenic
1034861565 7:154599668-154599690 CCTGTCATGGGGTGGGGGGCTGG - Intronic
1034949835 7:155289838-155289860 CCTCACATGGTGAAGGGGCCAGG + Intergenic
1035657125 8:1318786-1318808 CCAAGGATGGGCGAGGGGGCGGG - Intergenic
1036602150 8:10271271-10271293 CCTACCATGGGGAAGCAAGCAGG + Intronic
1037359868 8:18061832-18061854 CCTAGCTTGGGTAATGGGGAAGG + Intronic
1037374819 8:18216462-18216484 TCTGGCATGGGGAAGAGGACTGG + Intronic
1037834536 8:22208388-22208410 CCTAGTATGGGGTGGGGGGCAGG - Intronic
1038116841 8:24566015-24566037 CCTGTCATGGGGTAGGGGGCAGG - Intergenic
1038470496 8:27813311-27813333 CCTGTCATGGGGTAGGGGGGAGG + Intronic
1038642273 8:29338049-29338071 CCATGCAAGGGGAAGGGGACTGG + Intronic
1038886003 8:31663671-31663693 GCTTTCATGGGGAAGAGGGCTGG + Intronic
1039257520 8:35735238-35735260 CCAACCATGGGGTCGGGGGCGGG - Intronic
1040486583 8:47878487-47878509 CCTGGCATGGTGAAGGAGGGGGG - Intronic
1040577642 8:48667685-48667707 ATTAGTAAGGGGAAGGGGGCTGG - Intergenic
1041281574 8:56215433-56215455 CCACGGATGGGGAAGGGGGCGGG + Intronic
1041461771 8:58119366-58119388 CCTCGCATGGGGGAAGGGACAGG + Intronic
1042931838 8:74021914-74021936 CCTGTCATGGGGTGGGGGGCTGG + Intronic
1042956480 8:74256385-74256407 CCTATCATGGGGTGGGGGGAAGG + Intronic
1043526562 8:81104089-81104111 CCTACCATGTGGAAGGTGGGTGG - Intronic
1044598758 8:93983254-93983276 CCCAGAATGGGGAATGGAGCTGG - Intergenic
1044798398 8:95928039-95928061 CCTGTCATGTGGTAGGGGGCTGG - Intergenic
1044812356 8:96076394-96076416 CCTGTCATGGGGTAGGGGGAAGG + Intergenic
1045070613 8:98500510-98500532 CCTGTCATGGGGTAGGGGGCAGG - Intronic
1047272386 8:123374486-123374508 CCTAGCATCTGAAAGGGGCCTGG - Intronic
1048311578 8:133326597-133326619 CCCAGCATGGGGACTGGGGTGGG + Intergenic
1049009915 8:139880379-139880401 TGTAGCATTGGGGAGGGGGCTGG + Intronic
1049388541 8:142356365-142356387 CCTGGAATGGGGAGGTGGGCAGG + Intronic
1049543882 8:143220711-143220733 CCTAGCCTGAGGCAGGGGGCAGG - Intergenic
1050631306 9:7561580-7561602 CCTGGAGTGGGGTAGGGGGCAGG - Intergenic
1051053404 9:12956196-12956218 CCTTGAGTGGGGATGGGGGCGGG - Intergenic
1051302821 9:15671506-15671528 CCTGGCAGGGGGTGGGGGGCTGG - Intronic
1051548244 9:18300454-18300476 CCTGTCAGGGGGAGGGGGGCTGG + Intergenic
1051565915 9:18498205-18498227 TGTAGCATGGGGGTGGGGGCAGG + Intronic
1051619430 9:19036098-19036120 CCTGGCGGGGGGTAGGGGGCTGG + Intronic
1052723404 9:32200364-32200386 CCTACCATGTGGAAGGAAGCTGG + Intergenic
1052745351 9:32434902-32434924 CCTAACAAGGGGAAGGGGAGAGG + Intronic
1052800596 9:32963799-32963821 CCTGTCGTGGGGTAGGGGGCTGG + Intergenic
1053025282 9:34724106-34724128 GCTAGCATGGGGACATGGGCTGG + Exonic
1053036810 9:34833168-34833190 GCTAGCATGGGGACATGGGCTGG + Intergenic
1053341692 9:37341525-37341547 CCTAGCCTGGGGATGGGGTTGGG + Intronic
1053753799 9:41281579-41281601 CCTGTCATGGGGTGGGGGGCTGG - Intergenic
1054259322 9:62845935-62845957 CCTGTCATGGGGTGGGGGGCTGG - Intergenic
1054332455 9:63774098-63774120 CCTGTCATGGGGTGGGGGGCTGG + Intergenic
1055388437 9:75791146-75791168 CAAAGCATGGGGCAGGGGGATGG - Intergenic
1056096000 9:83254108-83254130 CCTGTCATGGGGTAGGGGGAAGG + Intronic
1056137410 9:83643848-83643870 TCTAGTATGGGCAAGGCGGCTGG - Exonic
1056798435 9:89674972-89674994 CTTAGAATGGGGAAGGCTGCTGG + Intergenic
1057566827 9:96172419-96172441 ACTAGCATGGGGACAGGGGAAGG - Intergenic
1058614861 9:106815181-106815203 CCTGTCATGGGGTTGGGGGCAGG + Intergenic
1059729855 9:117045927-117045949 CTTAGGATGGGGAAAGAGGCTGG + Intronic
1059992789 9:119881089-119881111 TCTTGCCTGGGGAAGGGGGATGG - Intergenic
1061196497 9:129109896-129109918 GCCAGGGTGGGGAAGGGGGCTGG + Intronic
1061196511 9:129109932-129109954 GCCAGGGTGGGGAAGGGGGCTGG + Intronic
1061259030 9:129469530-129469552 AATTGCATGGGGAAGGGGGAGGG - Intergenic
1061637469 9:131922016-131922038 CCTGTCATGGGGAGGGGGGAGGG + Intronic
1061657169 9:132101192-132101214 CCTGTCATGGGGTGGGGGGCAGG + Intergenic
1061670403 9:132185221-132185243 CCCAGGGTGGGGAAGGGGGTCGG - Intronic
1062218594 9:135402481-135402503 CCTAGCATGTGGACTGGGGATGG + Intergenic
1062463187 9:136670350-136670372 CCTGGCCTGGGGAGGCGGGCAGG + Intronic
1062482596 9:136759417-136759439 CCTGGGAAGGGGCAGGGGGCAGG - Intergenic
1186026494 X:5319377-5319399 CCAAGCAAGGAGAATGGGGCAGG + Intergenic
1186898334 X:14027615-14027637 CATAGCATGGGGAAGGAGTAAGG + Intronic
1188354804 X:29177742-29177764 CCTGTCATGGGGTCGGGGGCTGG - Intronic
1189483648 X:41412314-41412336 CTAAGCATGGGGGTGGGGGCAGG + Intergenic
1189894416 X:45639261-45639283 CCTGTCATGGGGTGGGGGGCTGG + Intergenic
1190736138 X:53256833-53256855 CTCAGCTGGGGGAAGGGGGCAGG + Intronic
1191025311 X:55907913-55907935 ACTAGAATGGGGAAGGGGAAGGG - Intergenic
1191734018 X:64369607-64369629 CCTATCATGGAGGAGGGGGCAGG + Intronic
1192145296 X:68678146-68678168 ACTAGCCTGGGGAAGGTGGGTGG + Intronic
1192567397 X:72176627-72176649 CCTGTCATGGGGTGGGGGGCTGG + Intergenic
1192679352 X:73235564-73235586 CCTGTCATGGGGTAGGGGTCAGG + Intergenic
1192897194 X:75456346-75456368 CCTGTCATGGGGTGGGGGGCTGG + Intronic
1193773937 X:85620505-85620527 ACTAGCAGGGAGCAGGGGGCAGG - Intergenic
1194459748 X:94151733-94151755 CCTGTCATGGGGCGGGGGGCAGG - Intergenic
1194549963 X:95285480-95285502 CCTGTCATGGGGTGGGGGGCAGG - Intergenic
1195278843 X:103310501-103310523 CCCGGCGTGGGGAAGGGGCCGGG - Intronic
1195517120 X:105789677-105789699 CCTGTCATGGGGTGGGGGGCTGG + Intergenic
1195665642 X:107427698-107427720 CCTGTCATGGGGTGGGGGGCTGG + Intergenic
1195728712 X:107943712-107943734 CCTGTCATGGGGTGGGGGGCAGG - Intergenic
1195932314 X:110090856-110090878 CCTGTCATGGGGTGGGGGGCTGG - Intronic
1195951383 X:110277411-110277433 CCTGTCATGGGGTGGGGGGCTGG + Intronic
1196711006 X:118762702-118762724 GCTTTCATGTGGAAGGGGGCTGG + Intronic
1196979211 X:121193179-121193201 CCTGTCAGGGGGTAGGGGGCTGG - Intergenic
1197746488 X:129934822-129934844 GCTAGGATGGGGAAGAGGGATGG - Intergenic
1197985865 X:132266035-132266057 CATGGCATGGGGTAGGGGGAGGG - Intergenic
1198225055 X:134637278-134637300 CCAGGCATGGGGAAGGGGACAGG + Intronic
1198854874 X:141005368-141005390 CCTAGGATAGGGAAGGGGCGGGG - Intergenic
1198877138 X:141239775-141239797 CCTAGGATAGGGAAGGGGCGGGG + Intergenic
1198907819 X:141582001-141582023 CCTAGGATAGGGAAGGGGTGGGG + Intergenic
1198908972 X:141592423-141592445 CCTAGGATAGGGAAGGGGTGGGG - Intronic
1198918106 X:141695729-141695751 CCTAGGATAGGGAAGGGGTGGGG + Intronic
1199175310 X:144781324-144781346 CCTATCATGGGGTGGGGGGAGGG + Intergenic
1199473952 X:148225779-148225801 CCTAGCATGGTGCCGGGGACAGG - Intergenic
1199975412 X:152892341-152892363 CTCAGCATGGGGGAAGGGGCTGG - Intergenic
1200058278 X:153472741-153472763 CCTACCATGGGGGAGGGAGGGGG + Intronic