ID: 1029449270

View in Genome Browser
Species Human (GRCh38)
Location 7:100631868-100631890
Sequence TGATGCAACTGGAGGGAACT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 204}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029449270 Original CRISPR TGATGCAACTGGAGGGAACT GGG Exonic
901439222 1:9267416-9267438 TGTTGCAACTGGAGAGGAGTCGG - Exonic
902545561 1:17187448-17187470 TGATGCTGCTGCAGGGAGCTGGG + Intergenic
905313923 1:37069137-37069159 GGCTGCAAGTGGAGTGAACTCGG + Intergenic
906259778 1:44378155-44378177 TGGAGCACCTGGAGGGAACTAGG - Intergenic
906299724 1:44673263-44673285 AGATGCTACGGGAGGGATCTGGG + Intronic
908071112 1:60461264-60461286 GGATGGAACTGGAGTGAAATAGG + Intergenic
908327547 1:63038204-63038226 TGTTAAAACTGGAGGAAACTGGG + Intergenic
911407354 1:97459338-97459360 AGAAGCAAATGGAGAGAACTAGG + Intronic
913246176 1:116871839-116871861 TTATGCAACTTGAGGGAGATGGG - Intergenic
917075094 1:171196895-171196917 TGCTGCAACTGGGCAGAACTTGG + Intronic
921095707 1:211885527-211885549 TGATGCAGCAGGAGGGAAGGAGG - Intergenic
921686405 1:218094043-218094065 TGCTGGAGCTGAAGGGAACTTGG - Intergenic
921710593 1:218369347-218369369 TGATGCATCAGGATGGCACTTGG + Intronic
922207463 1:223461107-223461129 TGATGAGATGGGAGGGAACTGGG - Intergenic
922769697 1:228175300-228175322 TGATGCCACTGGTGGGAAGGGGG - Exonic
923006815 1:230056881-230056903 TAATGGATCTGTAGGGAACTAGG - Intergenic
1063283749 10:4660872-4660894 TGATGCAATTGGAGGGAGTGGGG - Intergenic
1067575179 10:47404292-47404314 TGATGCAAATGCCTGGAACTGGG + Intergenic
1069931319 10:71883741-71883763 GGATGGAACTGGGGAGAACTTGG + Intergenic
1071563302 10:86659143-86659165 TGAGGAAGCTGGAGGGAACTGGG - Intronic
1074323205 10:112422542-112422564 TGAGGCAGCTGGAGGGGATTAGG + Intronic
1075796441 10:125123394-125123416 TGTTACAACTGGAGGGCACCAGG + Intronic
1077359777 11:2135757-2135779 TCTTGCAAATGGAAGGAACTGGG - Intronic
1077575347 11:3378906-3378928 TGGTGCAGCTGGAGGGGCCTCGG + Intronic
1078448144 11:11420443-11420465 TGAAGCTACTGGAGGCCACTTGG + Intronic
1078831824 11:14984794-14984816 TGGTGAAACTGGAGGGAAGTAGG - Intronic
1079039054 11:17045185-17045207 TGGTGAGACTGGAGGGAAGTAGG + Intergenic
1081358358 11:42142079-42142101 TGATGGAAATACAGGGAACTAGG + Intergenic
1082792564 11:57356845-57356867 TGATGCAATTAGAGTGATCTTGG + Intronic
1084774409 11:71365973-71365995 TGATTCAAATGCAGGGAGCTGGG + Intergenic
1086443860 11:86853862-86853884 TGGTGAAACTAGAGGGAAGTAGG - Intronic
1087909444 11:103736250-103736272 TCATGCAAATGCAGGGAGCTAGG - Intergenic
1089032361 11:115345507-115345529 TTATGCAGCTGGAGGGCAATGGG - Intronic
1089081599 11:115780830-115780852 CTATGCAAATGAAGGGAACTGGG + Intergenic
1089882760 11:121790759-121790781 TGATAGAAATTGAGGGAACTTGG + Intergenic
1090315972 11:125788781-125788803 GGATGCAACTTGAGAGAACATGG + Intronic
1094099520 12:26746284-26746306 GCATGCAAATGGAGGGAACCTGG + Intronic
1095479050 12:42614679-42614701 TGATCCCACTGGAGGGATTTGGG + Intergenic
1098477503 12:70921700-70921722 TGGTGCAAGTGGAGGAAAATGGG - Intergenic
1099874822 12:88391599-88391621 TGCTGAAGATGGAGGGAACTTGG + Intergenic
1102233196 12:111277571-111277593 TGAGGCAACTGGAGTGAGATGGG - Intronic
1102642498 12:114379329-114379351 GATTGCAACTGTAGGGAACTTGG + Intronic
1104791506 12:131485054-131485076 TGAAGCAACTGTAGAGAACTAGG - Intergenic
1105444395 13:20440103-20440125 GCATGAAACTGGAGGGAAGTTGG - Intronic
1106021533 13:25920363-25920385 TGATACATCTGGAGGGCACTGGG - Intronic
1106849193 13:33770604-33770626 TGAGTGAACTGGAGGGAACTCGG - Intergenic
1107102082 13:36604485-36604507 TGATGGGGCTGGAGGGGACTGGG - Intergenic
1107516681 13:41136141-41136163 TGAGGCAACTACAGGGAATTGGG + Intergenic
1109056990 13:57563323-57563345 TCATGCAACTGGAGGCTACAAGG - Intergenic
1109839770 13:67906374-67906396 TGGTGAAACTAGAGGGAAGTAGG + Intergenic
1110808513 13:79786918-79786940 GGATGAAACTGGAGGACACTGGG - Intergenic
1111690239 13:91555135-91555157 TGTTACCACTGGGGGGAACTGGG - Intronic
1112808957 13:103195181-103195203 TTTTGCAGCTGGAGGAAACTAGG + Intergenic
1112898900 13:104335815-104335837 TGATGCTGCTGGAGCCAACTTGG + Intergenic
1113911049 13:113841468-113841490 TGAGGCATATGGAGGAAACTGGG - Intronic
1114757476 14:25276042-25276064 TGTTGCTACTGGAGGAAACAGGG + Intergenic
1114901831 14:27070903-27070925 TGATGAATCTAGAGGGAAATTGG + Intergenic
1117246767 14:53894429-53894451 AGATGCAACTGGAAGGGGCTGGG - Intergenic
1117832684 14:59768445-59768467 CCAGGCAACTGGAGGTAACTGGG + Intronic
1120826048 14:88956537-88956559 TGATGCAGCGGGTGGGAAGTAGG + Intergenic
1121266725 14:92608254-92608276 TGTTACCACTGGGGGGAACTGGG + Intronic
1122337785 14:101005299-101005321 TGATGAAACTTGAGTGAGCTTGG + Intergenic
1122805973 14:104257160-104257182 TGGGGCACCTGGAGGGAACCAGG + Intergenic
1126398858 15:48248573-48248595 TGATGCAAATGCAGGCAGCTGGG - Intronic
1126763101 15:51987654-51987676 TGAGGGGACTGGAGGGTACTGGG - Intronic
1126828425 15:52574444-52574466 TGCAGCAACTGGATGGAATTTGG - Intergenic
1128031631 15:64485841-64485863 TGTTACCACTGGAGGAAACTAGG - Intronic
1128724266 15:69976185-69976207 TTATGCAACTAGAGGGAAGTAGG - Intergenic
1129522967 15:76197297-76197319 TGAAGCAACCGGAGGGACATGGG + Intronic
1131144988 15:90004884-90004906 TGAGACAACTAGGGGGAACTGGG + Intronic
1134199389 16:12185263-12185285 TGGGGGAACTGGAGGGTACTTGG + Intronic
1141126404 16:81403962-81403984 TGCTGCAAATGGAGGGAAGGTGG - Intergenic
1144628381 17:16857137-16857159 AGTTGCAACTGGAGGGACTTTGG + Intergenic
1144761859 17:17711520-17711542 GGATGGAGCTGGAGGGAAGTGGG + Intronic
1148155880 17:45425152-45425174 TGAGTCACCGGGAGGGAACTGGG + Intronic
1148854049 17:50569078-50569100 TGACCCAACTGGTGGGGACTAGG + Intronic
1149622102 17:58053431-58053453 TGAAGCAACTGGAGGGAATGTGG - Intergenic
1151426253 17:74032799-74032821 TGGTTGAACTGGAGGGAAGTCGG - Intergenic
1152486662 17:80599125-80599147 AGATTCAACGGGAGGGAACAGGG - Intronic
1153658118 18:7303428-7303450 TGATGCAACTGGAGGCAAATAGG - Intergenic
1156471113 18:37377814-37377836 TGATGCCACTGGAGGAAAGTGGG + Intronic
1156541604 18:37917155-37917177 GGGTGCAACTGGAGGAAACTTGG - Intergenic
1158814902 18:61083988-61084010 TGATGCCACAAGGGGGAACTTGG - Intergenic
1159105173 18:63996392-63996414 AGAGGCTACTGGAGGGAACTTGG + Intronic
1159802111 18:72913957-72913979 AGATGCAACTGGAGGCCATTCGG - Intergenic
1160935659 19:1593262-1593284 AAAAGCTACTGGAGGGAACTTGG - Intergenic
1161076079 19:2286435-2286457 GGATGGAAGTGGACGGAACTAGG - Intronic
1164506210 19:28863513-28863535 TGATGCAGGTGGAGGGTACTTGG + Intergenic
1166054521 19:40280403-40280425 TGATGCTACTGGAGGGGAAGTGG + Intronic
926286718 2:11494423-11494445 AGATGCACCTGGATGGCACTGGG - Intergenic
927322663 2:21765797-21765819 TCATGCAACTTGGTGGAACTCGG + Intergenic
928468954 2:31554418-31554440 TTTTGCAACTGGAGACAACTTGG + Intronic
932348257 2:71010210-71010232 TGGTGAAACTAGAGGGAAGTAGG + Intergenic
932351134 2:71033090-71033112 TGGTGAAACTAGAGGGAAGTAGG + Intergenic
934021520 2:87959305-87959327 TAATGCAAGTGGAAGGAACAGGG + Intergenic
934475015 2:94587892-94587914 TGCTGGAGCTAGAGGGAACTGGG + Intergenic
937117068 2:119415188-119415210 CATTGCAACTGAAGGGAACTGGG + Intergenic
937402593 2:121597874-121597896 CTATGCAACTGGAGGGAATTGGG - Intronic
937576413 2:123427696-123427718 TGATACCATTGGGGGGAACTGGG + Intergenic
938874590 2:135519235-135519257 TGTTACCACTGGAGGAAACTAGG + Intronic
939211903 2:139186315-139186337 TCATGCACCTGGAGGCTACTTGG + Intergenic
940532085 2:154890727-154890749 TGATGCTAGGGTAGGGAACTAGG + Intergenic
940870677 2:158857732-158857754 TGGTGAAACTAGAGGGAAGTAGG + Intronic
941183999 2:162298540-162298562 TTATGAAACTGGAGGGAAGGTGG - Intronic
941831385 2:169964495-169964517 TGAGGAAACTGGAGGGAAGGAGG + Intronic
943064973 2:183076085-183076107 GGAAGCCACAGGAGGGAACTAGG - Intergenic
943138492 2:183947121-183947143 TGATGAAACAGGAAGGAATTTGG - Intergenic
944953673 2:204783219-204783241 TGACCCAAATGGAGGGAACCTGG + Intronic
946129383 2:217594019-217594041 TGAGGGAAGTGGAGGGAAATGGG + Intronic
1170119443 20:12895645-12895667 GGAGGCACCTGGAGGGCACTGGG - Intergenic
1173042404 20:39476784-39476806 TGGTGCACCTGGAGGGGACATGG - Intergenic
1174773469 20:53322700-53322722 TGATGCAAATGCAGGGAGCTGGG + Intronic
1175462869 20:59166442-59166464 TGTTGCTATTGGAGGAAACTGGG - Intergenic
1182202882 22:28591643-28591665 TGAAACCATTGGAGGGAACTGGG - Intronic
1183152413 22:36048131-36048153 TGTGGCAAGTGGAGGCAACTAGG + Intergenic
949885736 3:8692312-8692334 TGGTGAAACTAGAGGGAAGTAGG + Intronic
950485730 3:13273161-13273183 TGGTGCATGTGGAGGGAGCTGGG + Intergenic
951066997 3:18278133-18278155 TGAGGAAACTGGAGTGAAGTTGG - Intronic
952337785 3:32420225-32420247 GGATGCATCTGGAGGAAACAGGG - Intronic
952342280 3:32456487-32456509 TGAAACACCTGTAGGGAACTGGG + Intronic
952591777 3:34963765-34963787 TGATGCATCCGGAGGGCACCAGG + Intergenic
952894617 3:38069792-38069814 TGAAACAGCTGGTGGGAACTAGG - Intronic
955030070 3:55207605-55207627 TGTTGCCAGTGGAGGAAACTGGG - Intergenic
956192937 3:66624251-66624273 TGTTTCCACTGGAGGAAACTAGG - Intergenic
957043250 3:75353338-75353360 TGGTGAAACTAGAGGGAAGTAGG - Intergenic
957725477 3:84060069-84060091 TAATGCCACTGGAGGAAACTAGG - Intergenic
960616324 3:119599321-119599343 TGATGGAAGTGGAGGGAACAGGG + Intronic
960618398 3:119616941-119616963 TGTTGCAACTGGAGAGAGCTTGG + Intronic
961273397 3:125707512-125707534 TGGTGAAACTAGAGGGAAGTAGG + Intergenic
962831022 3:139140363-139140385 TGTTGCTACTGGCGGAAACTAGG - Intronic
963204993 3:142624508-142624530 TGATGCATGTTGAGGAAACTTGG + Intronic
967081460 3:186053638-186053660 TGAAGCAACTGAACGGAAATTGG - Intronic
967787102 3:193509130-193509152 TGATGCAGGTGGAGGGAATATGG - Intronic
968602025 4:1513992-1514014 TCATGCAAGAGGAGGAAACTGGG - Intergenic
968870512 4:3239684-3239706 TGATGCAGCTGGAGGCATCCAGG + Intronic
968892389 4:3376437-3376459 AGATGGAACAGGAGGGGACTGGG + Intronic
969026793 4:4179635-4179657 TGGTGAAACTAGAGGGAAGTAGG - Intergenic
970124639 4:12795527-12795549 TGATACTACTGGAGTGAACTTGG - Intergenic
970695911 4:18676817-18676839 TGCTGCAAGTGGAGAGAAATAGG + Intergenic
973760577 4:54111034-54111056 TGATGCAACTGGTAGAGACTTGG - Intronic
975285992 4:72620908-72620930 TAATGGAACTGGAGGTCACTGGG + Intergenic
977459646 4:97309093-97309115 AAATGAAACTGGAGGGAGCTGGG + Intronic
978498329 4:109384002-109384024 TCATGCAGCCGGTGGGAACTGGG + Intergenic
979590928 4:122479663-122479685 TGATCCAGATGGAGGGAACTAGG + Intergenic
979638123 4:122979578-122979600 TGTTGCCACTGGAGGAAACTGGG - Intronic
979743749 4:124182644-124182666 TAAGGCAACAGCAGGGAACTAGG - Intergenic
980800097 4:137735869-137735891 TGATGAAACTGGCAGGGACTTGG + Intergenic
985543364 5:497293-497315 TCCTGCACCTGGAGGGAATTCGG - Intronic
987192740 5:15495932-15495954 TGTTACCACTGGAGGAAACTGGG - Intergenic
987490302 5:18571884-18571906 TGTGGCAAGTGGATGGAACTGGG + Intergenic
988347904 5:30063797-30063819 TGATGCATATGGAGGGATCAAGG - Intergenic
989148372 5:38271663-38271685 TCATAGAACTGGAGGTAACTGGG - Intronic
989428750 5:41327202-41327224 TGATGCAACTAGAGGGGACATGG + Intronic
992214650 5:74514229-74514251 TGATCCATCTGCAGGGCACTGGG - Intergenic
993224870 5:85155738-85155760 TAATGAAACTGAAGGGAAATTGG + Intergenic
993393723 5:87355972-87355994 TGATGAAACTGGAGCGAAAGAGG + Intronic
998835441 5:146198553-146198575 TGCTGCCATTGGAGGAAACTGGG - Intergenic
1000251916 5:159503694-159503716 TCATGCAGCTGGGGGTAACTGGG + Intergenic
1001697547 5:173683208-173683230 TTATGCAACTCGTGGGTACTGGG - Intergenic
1001941652 5:175743959-175743981 AGATGCAAGGGAAGGGAACTAGG - Intergenic
1004004985 6:11630127-11630149 TGATGGAATTGGAGGGGACCAGG + Intergenic
1004204181 6:13575373-13575395 TGATGGAACGGGAGGGAATGGGG + Intronic
1004300263 6:14451453-14451475 TGCTGAAACCTGAGGGAACTTGG - Intergenic
1004424312 6:15497216-15497238 TGAGGGAACTGCAGGGATCTGGG - Intronic
1006459294 6:34149062-34149084 TGATGCAGCAGGAGGGAGTTAGG - Intronic
1008353470 6:50521387-50521409 TGATACAACTGGAGGGACATTGG - Intergenic
1008695068 6:54026066-54026088 GAAGGCAACTGGAGGGAATTCGG + Intronic
1011248817 6:85348728-85348750 TGAGGCAACTGGAGGAGAGTGGG - Intergenic
1012885348 6:104840104-104840126 TGTTACCACTGGAGGAAACTCGG + Intronic
1012956647 6:105577744-105577766 TGTTGCCACTGGAAGAAACTGGG - Intergenic
1013611982 6:111804285-111804307 TGGGGGAACTGGGGGGAACTGGG + Intronic
1015663560 6:135602975-135602997 TCATGGAACTGGTGGGAACTGGG + Intergenic
1016341067 6:143061484-143061506 TGTTGCAACTGAAGGAAACTGGG + Intronic
1021430939 7:20558592-20558614 TGATGCAACAGGAGGCTAGTGGG + Intergenic
1022038329 7:26555089-26555111 TGCTGCATCTGGAGGGTTCTGGG + Intergenic
1022056409 7:26739939-26739961 TGCTGCAATTGGAGGAAACTGGG + Exonic
1023821237 7:43981752-43981774 TGAAGCCACCAGAGGGAACTGGG - Intergenic
1028590737 7:92491347-92491369 TGATTCATCTGGAAGGATCTCGG + Exonic
1029449270 7:100631868-100631890 TGATGCAACTGGAGGGAACTGGG + Exonic
1029749507 7:102535176-102535198 TGAAGCCACCAGAGGGAACTGGG - Intergenic
1029767454 7:102634279-102634301 TGAAGCCACCAGAGGGAACTGGG - Intronic
1031851528 7:126870187-126870209 TCAAGAAACTGGAGGGAATTAGG + Intronic
1032944869 7:136837785-136837807 TGTTGCAATTGGGGGCAACTGGG + Intergenic
1033456075 7:141505199-141505221 TGATGAAATGGGAGGTAACTTGG - Intergenic
1034656698 7:152735527-152735549 TGAGGCAGCTGGAGGGCTCTTGG - Intergenic
1034819659 7:154205232-154205254 TGTTACCACTGGAGGAAACTGGG - Intronic
1035332582 7:158105959-158105981 GGATGGAACTGGATGGAGCTGGG - Intronic
1036236649 8:7044732-7044754 TGATGCCCCTGGAGGGAGCCAGG + Intergenic
1038165723 8:25083475-25083497 TGAGGCAACTGCAGTGAAATTGG - Intergenic
1038628583 8:29218750-29218772 TGATGCAACTGATGGGATTTAGG + Intronic
1038813566 8:30877721-30877743 TGTTTCCACTGGAGGAAACTGGG - Intronic
1040745274 8:50634561-50634583 TGATGCCACTGGGAGAAACTAGG - Intronic
1040789274 8:51206012-51206034 TGCTGCACCTGGAGAGAACATGG - Intergenic
1040956013 8:52980629-52980651 GGCTGCAACTGGGGGGAGCTCGG + Intergenic
1041253682 8:55960238-55960260 TGTTACCACTGGAGGAAACTGGG - Intronic
1046147352 8:110178307-110178329 AGATGAAACTGCTGGGAACTAGG - Intergenic
1046518725 8:115297175-115297197 AGATGCATTTGGATGGAACTCGG + Intergenic
1046714782 8:117555686-117555708 TGAGCCATCTGAAGGGAACTTGG - Intergenic
1047523443 8:125613315-125613337 TGATGAATCTGCAGGGAACGAGG + Intergenic
1048458035 8:134595864-134595886 TGATGCAACTGGAAAGAACTTGG + Intronic
1049052579 8:140210422-140210444 TGCTGCTGCTGGAGGGAAGTGGG + Intronic
1050299000 9:4237838-4237860 TGCTGAAGCTGGAGAGAACTGGG - Intronic
1050552522 9:6760096-6760118 GGATAGAATTGGAGGGAACTAGG - Intronic
1050682030 9:8122683-8122705 TGATGCAATAGGAAGCAACTAGG - Intergenic
1051261853 9:15272370-15272392 TGTTGTAACTGGAGGGCACACGG - Intronic
1052855035 9:33401868-33401890 TGCTGGAGCTAGAGGGAACTGGG - Intronic
1053683054 9:40498209-40498231 TGCTGGAGCTAGAGGGAACTGGG - Intergenic
1053933037 9:43126525-43126547 TGCTGGAGCTAGAGGGAACTGGG - Intergenic
1054280660 9:63126719-63126741 TGCTGGAGCTAGAGGGAACTGGG + Intergenic
1054296154 9:63333707-63333729 TGCTGGAGCTAGAGGGAACTGGG - Intergenic
1054394170 9:64638212-64638234 TGCTGGAGCTAGAGGGAACTGGG - Intergenic
1054428820 9:65143411-65143433 TGCTGGAGCTAGAGGGAACTGGG - Intergenic
1054501559 9:65878124-65878146 TGCTGGAGCTAGAGGGAACTGGG + Intronic
1054797640 9:69317359-69317381 TGTTGCAGCTGGAGAGACCTTGG + Intergenic
1055117060 9:72616318-72616340 TGATTCATTTGGAGGGGACTTGG - Intronic
1056306282 9:85294108-85294130 TGATCAACCTGGAGTGAACTGGG - Intergenic
1056732886 9:89180964-89180986 TGAGGCCAGTGGAGGGAAATTGG + Intergenic
1056863739 9:90211397-90211419 TGGTGAAACTAGAGGGAAGTAGG + Intergenic
1056916169 9:90748047-90748069 TGGTGAAACTAGAGGGAAGTAGG - Intergenic
1057201814 9:93144539-93144561 TGCTGCAACTGGAGGGAGAGAGG + Intergenic
1058016842 9:100042767-100042789 GGATGGAACTGGAGGTTACTAGG + Intronic
1185669046 X:1791237-1791259 TGAAGCAAATGGAGTGAAATTGG + Intergenic
1186849965 X:13570140-13570162 TGATGCAAAAGGAGCTAACTAGG - Intronic
1189194605 X:39142237-39142259 TGATGTAGATGGAGGTAACTGGG + Intergenic
1190740892 X:53288131-53288153 TGATGCAGCTGGATGGCTCTGGG + Intronic
1192058178 X:67794676-67794698 TGATGCAACTTGAGAGCACAAGG - Intergenic
1192328294 X:70152058-70152080 TGATGTAACTGCATGTAACTTGG + Intronic
1195597976 X:106714462-106714484 TGATACTACTGGGGGAAACTGGG - Intronic
1196970632 X:121104601-121104623 TGATACAACTGGAAGGCACTTGG + Intergenic
1199123003 X:144079793-144079815 TAATGCAAGTGGAAGGAACAGGG - Intergenic
1199431595 X:147767260-147767282 TGTTGCCACTGGAGGAAAGTGGG - Intergenic
1201362768 Y:13171286-13171308 GGCTGCAACTGGAGGGTCCTTGG + Intergenic
1201384634 Y:13425394-13425416 TGACCCACCTGGAGTGAACTGGG + Intronic