ID: 1029452488

View in Genome Browser
Species Human (GRCh38)
Location 7:100648921-100648943
Sequence AGAGATTTGCAGACTGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 392
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 363}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029452488_1029452497 3 Left 1029452488 7:100648921-100648943 CCATCCCCAGTCTGCAAATCTCT 0: 1
1: 0
2: 1
3: 27
4: 363
Right 1029452497 7:100648947-100648969 CCTGGTGATGACTCATCTCCTGG 0: 1
1: 0
2: 3
3: 23
4: 243
1029452488_1029452498 10 Left 1029452488 7:100648921-100648943 CCATCCCCAGTCTGCAAATCTCT 0: 1
1: 0
2: 1
3: 27
4: 363
Right 1029452498 7:100648954-100648976 ATGACTCATCTCCTGGAGAAAGG 0: 1
1: 0
2: 1
3: 24
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029452488 Original CRISPR AGAGATTTGCAGACTGGGGA TGG (reversed) Intronic
900673173 1:3868464-3868486 AGAGGTTTGCAGACCAAGGATGG - Intronic
901152921 1:7116090-7116112 AGAGGCTTGCAGACTCAGGAGGG - Intronic
902669725 1:17964679-17964701 AGTGTTTTGCAGACTGGTGAGGG + Intergenic
904729831 1:32581640-32581662 ATACTTTTGCAGGCTGGGGACGG - Intronic
905530641 1:38676003-38676025 ACAGATTTGCTGTCTGGTGAAGG + Intergenic
905968307 1:42117783-42117805 AGAGGAGAGCAGACTGGGGACGG + Intergenic
906929825 1:50158634-50158656 ACAGAATTGCATAGTGGGGAGGG - Intronic
907346864 1:53789401-53789423 AGAGATTTAGAGACTTGGCAAGG - Intronic
908931016 1:69315901-69315923 ACAGCTTTGCTGATTGGGGAGGG + Intergenic
909399032 1:75205432-75205454 ACACATTTGCACACAGGGGATGG + Exonic
911213716 1:95168999-95169021 AGAGCTGTGCAGTCTGGGGTGGG + Intronic
911728815 1:101270170-101270192 AGAAGTTTGCAGGCTGGGCATGG - Intergenic
912250761 1:108010383-108010405 GTAGTTTTGCAGAGTGGGGATGG + Intergenic
912262258 1:108121831-108121853 AGAGATTTGAGGGCTGAGGAAGG - Intergenic
913698824 1:121354744-121354766 AGACATTTCCAGGCTGGGCATGG + Intronic
914138721 1:144925293-144925315 AGACATTTCCAGGCTGGGCATGG - Intronic
915646090 1:157273715-157273737 AAGGAGTTGCAGAGTGGGGATGG + Intergenic
915906367 1:159880770-159880792 AGAGAGATGCAGACAGAGGAGGG + Intronic
916336829 1:163681774-163681796 AGAGAGTGGCAAAATGGGGATGG - Intergenic
916868017 1:168881771-168881793 AGACATGGGCTGACTGGGGAGGG - Intergenic
918012665 1:180602423-180602445 AGAGGTTTGAAGACTTGCGAAGG + Intergenic
919653472 1:200174247-200174269 AGAGATTGGGGGAGTGGGGAGGG + Exonic
919688382 1:200506075-200506097 AGAGACATGCAAACTGGAGATGG + Intergenic
919718894 1:200810596-200810618 ACAGACTTGGAGACTGGGGGCGG + Intronic
919991192 1:202709626-202709648 TGAGATTTGGAGAGAGGGGAGGG + Intronic
920051678 1:203168148-203168170 AGAGAGGTGCAGAGTGGGGAGGG + Intronic
920486233 1:206373442-206373464 AGACATTTCCAGGCTGGGCATGG + Intronic
920751576 1:208682928-208682950 AGAGATTGGCACTGTGGGGAGGG + Intergenic
920955552 1:210617456-210617478 AGAGATATGCAGACTGGAGGTGG + Intronic
921164891 1:212499879-212499901 AGAGTATTGCAGACTAGGCAGGG + Intergenic
922560590 1:226566483-226566505 ATAGTCTTGCAGAGTGGGGAAGG + Intronic
923255924 1:232221336-232221358 AGAAATATGCAGGCTGGAGAAGG - Intergenic
923626457 1:235617592-235617614 AGAGACTTGCAGGCTGGGTGCGG + Intronic
924589661 1:245391499-245391521 AGAGATTTGTGGGCTGGGGATGG + Intronic
924693023 1:246370074-246370096 AGAGGGTTGCAGACAGTGGAAGG - Intronic
1063392492 10:5659545-5659567 AGAGCTTTCCAGGCAGGGGAAGG - Intronic
1063596449 10:7440149-7440171 AGACATTTAAAGACTAGGGAGGG + Intergenic
1064267014 10:13833382-13833404 AGATAATTGCATCCTGGGGACGG - Intronic
1064957704 10:20929736-20929758 AGAGACTTGGAAAGTGGGGAGGG + Intronic
1065209165 10:23386572-23386594 AGAGACTTGCTGTCTGGTGAGGG + Intergenic
1068329316 10:55540519-55540541 AGAGAATTACAGTCTGGTGAAGG - Intronic
1068362056 10:55988460-55988482 AGATATTTACAGGCTGGGAATGG + Intergenic
1068956792 10:62825666-62825688 AGGAATTTGCACAGTGGGGAAGG - Intronic
1070471579 10:76785745-76785767 AGAGATCAGCAGAGTTGGGAAGG - Intergenic
1070631509 10:78088305-78088327 AGGGATTTGTAGACCTGGGAAGG - Intergenic
1070756586 10:78997183-78997205 AGAGTAATGCAGACTGGAGAAGG - Intergenic
1071106789 10:82107168-82107190 AGGGATTTTCAGATTTGGGATGG - Intronic
1071447487 10:85762310-85762332 AGAAATTTCCAGACTGGGTTTGG - Intronic
1072695419 10:97599670-97599692 AGAGATCAGCAACCTGGGGAGGG - Exonic
1074129082 10:110557283-110557305 AGAGACTTGCAGGCTCAGGAGGG + Intergenic
1074304348 10:112262961-112262983 AGAGAATTGCAGAGTGGGGAGGG - Intergenic
1074956405 10:118395012-118395034 AGATGTTTGCAGACTGGTGTGGG - Intergenic
1076060089 10:127407301-127407323 GCAGATTTGGAGTCTGGGGAGGG + Intronic
1076603759 10:131676300-131676322 AGAGCTCTCCGGACTGGGGATGG - Intergenic
1076883661 10:133251739-133251761 GGAGATTTGCAGAGTAGGGGTGG + Intergenic
1077719996 11:4618448-4618470 ACATCTTTGCAGATTGGGGAAGG - Intergenic
1077843166 11:5996840-5996862 AGAAAATTTCAGACTGGGCATGG - Intergenic
1079367014 11:19818142-19818164 AGAGATTTCCAGTTTGGGGGAGG + Intronic
1079843897 11:25438863-25438885 ATAGATTTGCAGATTGAGGACGG - Intergenic
1081917610 11:46742975-46742997 AGAGTTTTTCTGACTGTGGAGGG + Intergenic
1082809648 11:57471663-57471685 ACAGCTTTTCAGAATGGGGAAGG + Intronic
1084901778 11:72315225-72315247 GGAGATGAGCAGGCTGGGGAGGG + Intronic
1084946504 11:72641717-72641739 AGAGATTTGGACTCTGGGGTAGG + Intronic
1084980367 11:72825613-72825635 CCAGATTTGCAGGATGGGGAGGG + Intronic
1085793836 11:79519035-79519057 AGAGATAAGCAGATTGGTGATGG + Intergenic
1086207916 11:84282428-84282450 AGAAATTTGCAGAGGGGTGATGG + Intronic
1086460758 11:87003307-87003329 AGAGATTCTCAGAATGGGAAGGG + Intergenic
1087287223 11:96278014-96278036 ACAGAATTGGAGACTGGGGATGG - Intronic
1088850711 11:113700969-113700991 AGAGAAGTGCAGAGTGGAGAGGG - Intronic
1089141468 11:116288294-116288316 AGAGATTTGGAGTTGGGGGAAGG + Intergenic
1090724565 11:129512362-129512384 AGATATTAGCAGGCTGGGCATGG - Intergenic
1090954328 11:131501162-131501184 AGGGGTTTGCATTCTGGGGAGGG + Intronic
1091799864 12:3318118-3318140 AGAAATCTGCAGAGAGGGGAAGG - Intergenic
1092101790 12:5889598-5889620 AGAGACTGGCAGTCTGGGGAAGG - Intronic
1092994174 12:13932695-13932717 AGAGATTTCCAGAAATGGGAAGG + Intronic
1093007409 12:14065093-14065115 AGGGATTTGCAGACCAAGGAGGG - Intergenic
1094199572 12:27781849-27781871 AGAGATTTGCAGGATGGGAGGGG - Intronic
1095156758 12:38866012-38866034 AGAGATCTGCAGACTGGCATTGG - Intronic
1095638595 12:44460235-44460257 AGATCTTTGCACACAGGGGATGG + Intergenic
1095955373 12:47802804-47802826 AGAGGTTTCCAGAGTGGGGGAGG + Intronic
1096625532 12:52893381-52893403 AGAAACTGGCTGACTGGGGAAGG + Intergenic
1096773520 12:53950899-53950921 AGGGATTTGCAGCCTGGAGGAGG - Intergenic
1097804650 12:63952139-63952161 AGTGAGGTGCAGAGTGGGGAGGG - Intronic
1098099236 12:66996132-66996154 AGAGACTTTTAGAGTGGGGAGGG + Intergenic
1099877266 12:88423547-88423569 AGCAATTTGAAGAATGGGGAGGG + Intergenic
1102445954 12:113002922-113002944 AGAGTGGTGCAGGCTGGGGAAGG - Exonic
1102777760 12:115535417-115535439 AGGGTCTTGCAGAATGGGGATGG - Intergenic
1104942224 12:132400525-132400547 ACAGATCTGCAGTCTGGGCAGGG + Intergenic
1105242377 13:18619944-18619966 AGAGCTGTGCTGCCTGGGGAAGG + Intergenic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1107584145 13:41825574-41825596 AGAGTTCTGGAGGCTGGGGATGG - Intronic
1107850570 13:44568631-44568653 AGAGATTTGCAGTGTGGGGCTGG - Intronic
1108141455 13:47426807-47426829 AGAGATGTGAAGACTGAGAAAGG + Intergenic
1109764412 13:66874968-66874990 AGAGATATGTAGAAGGGGGAGGG + Intronic
1110553230 13:76830078-76830100 AGAGCTTTCCAGGCTGTGGAGGG - Intergenic
1110642203 13:77838475-77838497 GGAGATTTGCAGCCTGGGGCTGG + Intergenic
1111738568 13:92173784-92173806 AAATATTTGCAGAATGTGGAAGG + Intronic
1111813227 13:93118552-93118574 GGTGATTTGCAGCCTGTGGAAGG + Intergenic
1113303218 13:109045766-109045788 AGGGCTGTGCAGACTGTGGAAGG - Intronic
1115467796 14:33735223-33735245 AGTGGTTAGCAGACTGGGGCTGG - Exonic
1115715513 14:36098818-36098840 AGAGATTTTTAGTCTGGGGGAGG + Intergenic
1115768104 14:36644626-36644648 AGAAATTTGAAGGCTGGGTATGG - Intergenic
1117881745 14:60319348-60319370 AGAGATTGGAAGAGTGTGGAGGG + Intergenic
1119030248 14:71186771-71186793 AGAGAGATGCAGCATGGGGAAGG + Intergenic
1120685103 14:87528921-87528943 AGTAATTTACAGACTAGGGAGGG - Intergenic
1121105070 14:91274186-91274208 AGAGAGAGGCAGAATGGGGATGG + Intronic
1121408651 14:93734532-93734554 AGGGACTTGCAGAGTGGGGGCGG - Intronic
1122366054 14:101195410-101195432 GGAGCTTTGCAGACATGGGAGGG + Intergenic
1123131462 14:105988915-105988937 AGAGACTTGCTGACTTGGAAGGG - Intergenic
1124354802 15:28986923-28986945 ACAGATTTGCTGTCTGGTGAGGG + Intronic
1126475838 15:49064104-49064126 AGAGAGTGGCAAAATGGGGAAGG - Intergenic
1127542309 15:59952841-59952863 GCAGATTTGGTGACTGGGGAGGG + Intergenic
1127572816 15:60261009-60261031 AGAGATAGCCAGATTGGGGAGGG + Intergenic
1128061767 15:64739805-64739827 AGAGATGTGGAGTCGGGGGAAGG - Intergenic
1128184314 15:65631508-65631530 AGAGATCTGCAGAATGAGAAGGG + Intronic
1128389433 15:67173237-67173259 ACACATTTGCAGCCTGGGGGCGG + Intronic
1128410027 15:67387357-67387379 AGAGATTCGCAAAGTTGGGAAGG - Intronic
1128959812 15:71990373-71990395 ATAGATTTGCTGGCTGGGCATGG - Intronic
1131024037 15:89124661-89124683 AGAGTTGTGCAGACTGGGCATGG + Intronic
1131610511 15:93956246-93956268 AGAGATGTGCATACAGGGAAGGG + Intergenic
1134746884 16:16595377-16595399 AGGGATTTGCAGAGTGAGGCTGG + Intergenic
1134998590 16:18758286-18758308 AGGGATTTGCAGAGTGAGGCTGG - Intergenic
1137397391 16:48125759-48125781 TGAGAATGGCAGACAGGGGATGG - Intronic
1138350978 16:56346064-56346086 AGAGAAAGGCAGGCTGGGGATGG - Exonic
1139518678 16:67467013-67467035 AGGGAATTGGAGACTTGGGAGGG - Intronic
1141254363 16:82386787-82386809 AGAAATTTGCAGATAGAGGAAGG - Intergenic
1141268434 16:82517907-82517929 AAAGATTTGCAGAATGTGCAGGG + Intergenic
1141487412 16:84349912-84349934 AGAGATTTGAAGATGGAGGAAGG + Intergenic
1142267814 16:89072591-89072613 GGAGATTTGCAGACTCGGGGGGG - Intergenic
1143668144 17:8376606-8376628 AAAGAGCTGCAGACTGAGGAAGG + Intronic
1143967760 17:10769020-10769042 AGAAATCTGCAGACTGGACAGGG - Intergenic
1146628958 17:34456293-34456315 AGAGATTATCAGACAAGGGAGGG + Intergenic
1147437037 17:40422821-40422843 AGAATTTTGCAGAGTGGGGCAGG - Intergenic
1147540338 17:41351999-41352021 AGTGGTTTACACACTGGGGAGGG + Intergenic
1147667953 17:42160493-42160515 AGAGCTTTGTAAACTGGAGAGGG - Intronic
1148509934 17:48159937-48159959 AGGGATTTGCAACATGGGGAAGG + Intronic
1148710222 17:49674887-49674909 ACTGTTTTGCAGATTGGGGAGGG - Intronic
1149342729 17:55703064-55703086 AGAGCTTTACAGACTGATGAGGG + Intergenic
1149521653 17:57322464-57322486 GGCCATTTGCAGACTAGGGAGGG + Intronic
1150137065 17:62701910-62701932 AGAGACCTGCAGTCTGGGGCCGG + Intronic
1150264064 17:63820488-63820510 AGAAATTACCAGACTGGGCACGG + Intronic
1152342735 17:79734150-79734172 AGAGCATTGCAAACTGGGGGTGG - Intronic
1153018159 18:602926-602948 AGAGAGTTTCAGGGTGGGGAAGG + Intronic
1153697947 18:7663557-7663579 ACAGATCTGCAGTCTGGGCAGGG + Intronic
1154263399 18:12857636-12857658 AGAGATTTGGAGGCAGGGGAAGG + Intronic
1154446572 18:14439934-14439956 AGAGCTGTGCTGCCTGGGGAAGG - Intergenic
1155621718 18:27786978-27787000 AGATCTTTGCACAATGGGGAGGG - Intergenic
1156545551 18:37960611-37960633 AGAAAGTTGCAGGATGGGGAGGG + Intergenic
1156690356 18:39700180-39700202 TGAGAGTTGCTGGCTGGGGATGG - Intergenic
1157206446 18:45704211-45704233 AGAGATTGGAAGAGTGTGGAGGG - Intergenic
1157562674 18:48659775-48659797 CGAGTTTTCCAGCCTGGGGAGGG + Intronic
1157708118 18:49826340-49826362 AGAGATTGACAGCCTGTGGAGGG - Exonic
1157928424 18:51791660-51791682 AGTGATATGTGGACTGGGGATGG - Intergenic
1158847491 18:61459915-61459937 CGAGATTTGGTGTCTGGGGAAGG + Intronic
1158848920 18:61474457-61474479 AGAGGTTTGGAGAATGAGGACGG - Intronic
1163080133 19:14933368-14933390 ACAGATTTCCAGGCTGGGCATGG - Intergenic
1163857588 19:19717002-19717024 AGAGATTTGGAGAATGGCGTTGG - Intronic
1165015351 19:32876414-32876436 AGACACTTGCAGCATGGGGAAGG + Intergenic
1165774932 19:38398945-38398967 AGAGCTGGGCAGAGTGGGGAGGG - Intergenic
1166158988 19:40937571-40937593 AGAGATATATAGACTGGGCATGG + Intergenic
1166982364 19:46638892-46638914 AGAAATTCACAGACAGGGGAGGG + Intergenic
1167113041 19:47473079-47473101 AGAGACTTGCAGGCTGGGTGCGG + Intergenic
1167717585 19:51154002-51154024 AGAGCTATGCAGGCTGGGGCAGG - Intergenic
1168272563 19:55258235-55258257 AGAGATTAAGAGACTGGGGAGGG + Intronic
925199041 2:1951308-1951330 AGGGGTTTGGGGACTGGGGAGGG + Intronic
925275852 2:2647825-2647847 AGAGATAAGCAGTCTGGGGCTGG + Intergenic
925918785 2:8625467-8625489 AGAAAATAGAAGACTGGGGAAGG + Intergenic
927094043 2:19734330-19734352 AAAGATTTGCTGACTGGGTGAGG - Intergenic
927184884 2:20474971-20474993 AGAGATCTGCAAGCTGGGGCAGG + Intergenic
928169766 2:28995799-28995821 GGAGTCTTGCAGCCTGGGGATGG + Intronic
928478534 2:31656211-31656233 ATAGTTTTGCATACTGGGGATGG + Intergenic
929197829 2:39204886-39204908 AGGGATTTTCAGACTGGGTGTGG + Intronic
930000367 2:46857058-46857080 AGAGATTTGCAGGATGAGGGTGG + Intronic
930420387 2:51145422-51145444 AGCTATTTGCAAACTGGAGAGGG - Intergenic
930711681 2:54556273-54556295 AAAGGTTTGGACACTGGGGAAGG - Intronic
931319073 2:61158661-61158683 AGGGATTTACATAGTGGGGAAGG + Intronic
931832793 2:66070056-66070078 ACAGGTTTGGAGACAGGGGAAGG + Intergenic
932089029 2:68788446-68788468 AGGGATGATCAGACTGGGGAAGG + Intronic
932139166 2:69260478-69260500 AGAGATTTTAAAAGTGGGGAAGG - Intergenic
934727210 2:96630833-96630855 ATAGATTTGCAGGCTATGGAGGG - Intronic
934916616 2:98305461-98305483 AGTGATGTGAAGATTGGGGACGG + Intronic
935562568 2:104574326-104574348 TGAGGCTTGCAGAGTGGGGATGG - Intergenic
937222069 2:120347405-120347427 AGAGATTTGCAATCTGGGGCCGG - Intronic
937260737 2:120585545-120585567 TGAGATATGCAGGCTGGGGGCGG + Intergenic
939451419 2:142379655-142379677 AGAAATTTACAGACTGAGGTAGG + Intergenic
941985196 2:171503636-171503658 ACAGATTTGCTGTCTGGTGAGGG + Intergenic
943145630 2:184041319-184041341 AGACATTTTTAGACTGGGCATGG + Intergenic
943911287 2:193571337-193571359 AGAGATTTTAAGAGAGGGGAGGG - Intergenic
945195283 2:207231752-207231774 AGTGATTTGCAGAATGGAGGGGG - Intergenic
945473998 2:210260716-210260738 TGACATTTGCAGACTTGAGAAGG - Intergenic
945585722 2:211659968-211659990 AGAGTTCTGCAAACTGGGGTTGG + Intronic
946373403 2:219294296-219294318 AGAAACTGGCAGACAGGGGAAGG + Intronic
946697262 2:222372262-222372284 AGAGCTGTGCAGCCTGGGGTTGG - Intergenic
948343093 2:237270752-237270774 AGAGCTTTGCAGCCTGGGAGAGG + Intergenic
1168799858 20:637471-637493 AGAGAAGGGCAGCCTGGGGAGGG - Intergenic
1169155571 20:3327078-3327100 AGAGATGACCAGACTGAGGAAGG + Intronic
1169930701 20:10829685-10829707 AGAAATTTGCAAACTGGAAAAGG - Intergenic
1170255388 20:14337482-14337504 AGAGCTTGGGAGACGGGGGAGGG - Exonic
1170694696 20:18647751-18647773 AGGGATTTGCAGTGAGGGGAAGG + Intronic
1170921402 20:20683130-20683152 ACAGAATGGCATACTGGGGATGG - Intronic
1171720961 20:28562890-28562912 AGAGTTTTGCAGTCTGGTGGGGG + Intergenic
1171757106 20:29120665-29120687 AGAGTTTTGCAGTCTGGTGGGGG - Intergenic
1171863163 20:30419923-30419945 AGAGTTTTGCAGTCTGGTGGGGG - Intergenic
1172244782 20:33438435-33438457 AGAGGGGTGCGGACTGGGGAAGG - Intronic
1173411312 20:42812398-42812420 AGAGGTTACCAGACTGGGGCAGG - Intronic
1174080196 20:47965505-47965527 AGTGATTTTCAGGCTGGGCACGG - Intergenic
1174643214 20:52063145-52063167 AAAGTTTTGCAGGCTGGGCATGG + Intronic
1175555730 20:59854684-59854706 AGAGATTAGAAGAGTGAGGAGGG + Intergenic
1176029226 20:63003283-63003305 AGAGATGTGCAGGCTGTGGGAGG - Intergenic
1176969226 21:15246822-15246844 AGAGATTAGAATACTGGGGTAGG - Intergenic
1177453282 21:21300664-21300686 AGAGATTTGCATACAGGAGGCGG + Intronic
1177477079 21:21637257-21637279 AGAGAATACTAGACTGGGGAGGG - Intergenic
1178839624 21:36128429-36128451 AGAGATTTGGAGATGGAGGAAGG - Intergenic
1179618811 21:42599058-42599080 AGCGATGTGGAGAGTGGGGATGG - Intergenic
1179901447 21:44396488-44396510 AGGGATGTGGAGACTGTGGAAGG + Intronic
1180142916 21:45903161-45903183 AGGCATATGGAGACTGGGGAAGG + Intronic
1180145131 21:45914573-45914595 CCAGATCTGCAGACTGGGTATGG - Intronic
1180727360 22:17956273-17956295 AGACAGTTGCAGAAAGGGGATGG + Intronic
1181035728 22:20168940-20168962 AGTGATCTGCGGACTGGGGAGGG + Intergenic
1181589110 22:23872043-23872065 AGAGGTTAGCAGGCTGGGCATGG + Intronic
1181674761 22:24444493-24444515 GGAGATGTGAAGACTGGTGAAGG + Intergenic
1181763383 22:25073356-25073378 AAAAATTTGCAGGCTGGGTATGG - Intronic
1182130791 22:27849073-27849095 AGAGCTTTGAAGAATGGGTAGGG + Intergenic
1183732368 22:39625843-39625865 AGAGATGTACAGGCTGGGGGTGG - Intronic
1183858959 22:40655177-40655199 ACAGATTTGCTGGCTGGGTACGG + Intergenic
1183964801 22:41435247-41435269 ACTGGTTTGCAGACTGTGGAAGG - Exonic
1184752994 22:46499861-46499883 AGGGGTTTGCAGACGGTGGAGGG - Intronic
1184782794 22:46657509-46657531 AGAGACTGGAAGACTGAGGATGG - Intronic
949122397 3:402417-402439 AGAGAGTAGCAGAAAGGGGAAGG - Intronic
949415911 3:3814005-3814027 CTAGATGTGCAGACAGGGGAGGG - Intronic
949932617 3:9090925-9090947 AGAGCTTTTCAGGCTGGGCATGG - Intronic
950483787 3:13260968-13260990 AGAGGTGTGGGGACTGGGGATGG + Intergenic
951599900 3:24362213-24362235 ACAGCTTTGCAGACTGTGAAAGG - Intronic
953006124 3:38980852-38980874 AGAGATTTACTTACTGGGGGTGG + Intergenic
954540154 3:51388164-51388186 AGAGCATTGCAGGCTGGTGAGGG + Intronic
954748719 3:52801947-52801969 AGAGATCTGGAGACAGAGGAGGG - Intronic
954888964 3:53905369-53905391 AAAGATTTTAAGACTGGGCATGG + Intergenic
955664190 3:61332789-61332811 TTAGATTTGAATACTGGGGAGGG + Intergenic
955837255 3:63069794-63069816 AAAGATTTGGAGCCTGGGGAGGG + Intergenic
956990429 3:74756787-74756809 AGAGATTTGCAGGCAGGAGGAGG + Intergenic
957914892 3:86675936-86675958 AGAGATTGGAAGAGTGTGGAAGG + Intergenic
958442906 3:94178443-94178465 ACGGGCTTGCAGACTGGGGAAGG - Intergenic
959066330 3:101660909-101660931 AGAGATTTCCAAAAAGGGGATGG - Intronic
959271047 3:104210542-104210564 AGAAATTTGTAGGCTGGGCACGG - Intergenic
959346468 3:105201224-105201246 AGAGAGTGGCAGGGTGGGGAAGG + Intergenic
960109901 3:113835882-113835904 AAAGTTTTGCAGAATGAGGATGG + Intronic
960162676 3:114367547-114367569 AGAGATTTTCACGCTGGGCATGG - Intronic
961514376 3:127423562-127423584 AGAGAGTGGCAGACGGAGGAGGG - Intergenic
961672617 3:128545768-128545790 AGAGATTGGCAGGCTGGGTGTGG - Intergenic
962102401 3:132356494-132356516 AGAGATTTGCAGGGTGGAAATGG - Intronic
962448105 3:135486835-135486857 AGAGTTTAGCAGACTGGGCACGG + Intergenic
963003522 3:140705200-140705222 TGAGATTTGCAGCAGGGGGAGGG - Intergenic
963060456 3:141220941-141220963 CGACATATGCAGACTGGAGAAGG - Intergenic
963327324 3:143876992-143877014 AGAGATTTGGTGTCTGGTGAGGG + Intergenic
963519581 3:146347310-146347332 AGAGATTTTCAAAAAGGGGAGGG - Intergenic
963874874 3:150463779-150463801 ACAGATTTTCAGATTGGTGATGG + Exonic
966268177 3:178071829-178071851 AGAAATTTCCAGACAGGAGAAGG + Intergenic
969278183 4:6151051-6151073 AGACAGTGGGAGACTGGGGAAGG - Intronic
969470284 4:7383520-7383542 AGAGCATTGGAGCCTGGGGAGGG + Intronic
970147816 4:13055543-13055565 AGAGATTTAAAGACAGGGAAAGG + Intergenic
971504574 4:27352240-27352262 AGGGATTTGTAGACTGTGGGAGG - Intergenic
972458498 4:39277057-39277079 AGAAATTTGCAGAATGGACATGG - Exonic
972509813 4:39758209-39758231 ATAGATCTGCAGACAGGGCATGG - Intronic
972787977 4:42345333-42345355 AGAGATTTGCACAAGGGGGTGGG + Intergenic
975095393 4:70450893-70450915 TGAGATATGCAGCCTGGAGATGG + Intronic
975974905 4:80083953-80083975 ACAGATTTGGAGTCTGGTGAGGG + Intronic
977639149 4:99335330-99335352 AGAGTTTTGCCAACTGGGAAGGG - Intergenic
977773584 4:100889967-100889989 AGAGAATAGTGGACTGGGGAAGG + Intergenic
978646895 4:110945023-110945045 AGAAATTTGAAGACTGGGCATGG + Intergenic
979631964 4:122913065-122913087 TTAGATTTGTAGATTGGGGATGG + Intronic
980569849 4:134600440-134600462 ACAGATTTGCAGAGTGAGCAGGG + Intergenic
980624277 4:135352826-135352848 AGGTATTTGCAAACTGGGGAAGG + Intergenic
981105456 4:140875516-140875538 AGTGATTTGCAGGGTGGGGCTGG + Intronic
981743170 4:148024362-148024384 TGAGATTAGCAGAGTGAGGAAGG + Intronic
982602605 4:157470450-157470472 AGAGAATTACAGACTGAAGATGG - Intergenic
984483777 4:180339201-180339223 AGAGATTTCCAGATTGAGGGAGG + Intergenic
985014328 4:185617816-185617838 TGAGCTTTGCAGGCTGAGGATGG + Intronic
985158109 4:187014341-187014363 GGAGCTATGCAGACAGGGGAAGG + Intergenic
985813525 5:2109508-2109530 AGGGAATTGAAGACTGGGGTTGG - Intergenic
986587885 5:9337391-9337413 AGAGATGTGGAAACTGAGGAAGG - Intronic
987845316 5:23276323-23276345 AGAGATTGGAAGACTTTGGAGGG + Intergenic
988529734 5:32017024-32017046 ACAGATGTGCAGATGGGGGATGG + Intronic
989467321 5:41772273-41772295 AGAGCTTTGCAGACAGTGGGAGG - Intronic
990304277 5:54479712-54479734 AGAGAGTTGCAGAATGGAAAGGG + Intergenic
990561045 5:56983109-56983131 AGGGCTTTTCAGAATGGGGATGG - Intergenic
990763102 5:59152312-59152334 AGAGATGTTCAGACAGTGGAAGG + Intronic
990867421 5:60395803-60395825 AGAGAGATGCAGAGCGGGGAGGG - Intronic
992751580 5:79867433-79867455 AGAGTCTTGCTGACTGGGAAGGG + Intergenic
995290318 5:110444028-110444050 AGAGATGTGCTGCCTGGGGTTGG + Intronic
995328219 5:110916554-110916576 AGAGCTTTGCAGACTGCAGCAGG - Intergenic
995587053 5:113659090-113659112 AGAGATGTGTACACTGGGAAAGG + Intergenic
996148886 5:120010746-120010768 AGAAAAATGCAGACTGGGCATGG - Intergenic
997849022 5:137314141-137314163 AGAGACTGTCAGGCTGGGGAGGG - Intronic
998737567 5:145159990-145160012 AGAGGTTTTCAAACTTGGGAAGG + Intergenic
1001667949 5:173448957-173448979 AGAGGCTAGGAGACTGGGGATGG + Intergenic
1002558102 5:180060047-180060069 AGAGACTTGAAGATGGGGGAAGG + Intronic
1004026023 6:11819281-11819303 AAAGATCTGCAGCCTGGGCATGG - Intergenic
1004324977 6:14666226-14666248 AGTGGGTTGGAGACTGGGGAAGG - Intergenic
1006802399 6:36767546-36767568 AGAGCTTAGCGGTCTGGGGAAGG - Intronic
1007090597 6:39182205-39182227 AATGATTTGCAGGCTGGGAAGGG - Intergenic
1007617467 6:43188712-43188734 TGAGGTTAGCATACTGGGGAGGG + Exonic
1007739784 6:44003342-44003364 AGAGACTGGGAGAGTGGGGAGGG + Exonic
1008337960 6:50329017-50329039 AGAGATATGCATATTGGGGATGG - Intergenic
1010021596 6:71165834-71165856 AGAAATTTGAAGACTGGGCATGG - Intergenic
1011580534 6:88859145-88859167 ACAGATTTTCAGACTGAGTACGG - Intronic
1012754582 6:103210200-103210222 AGGGACTTGCTGACAGGGGAGGG + Intergenic
1012905573 6:105060785-105060807 AGAGATTTGGAAACTAGGGTTGG + Intronic
1013409217 6:109869252-109869274 TAACATTTGCAAACTGGGGAAGG - Intergenic
1013497279 6:110710596-110710618 GGAGATTTGCTGTCTGGTGAGGG + Intronic
1013515930 6:110885962-110885984 AAAGATTTGCCGGCTGGGCACGG + Intronic
1017068947 6:150555325-150555347 AGAGATGTGCTGGCTGGGCACGG - Intergenic
1017154460 6:151310451-151310473 AAAGTTTTGCAGGCTGGGGGCGG + Intronic
1017738699 6:157385512-157385534 GAAGAATTGCAGACAGGGGAGGG - Intronic
1018484076 6:164222599-164222621 ACAGATTTGGTGTCTGGGGAGGG - Intergenic
1019972703 7:4554365-4554387 AGTGCTTTGCACACTGTGGAGGG - Intergenic
1022277108 7:28866306-28866328 AGAGATTTCCATACAGAGGAGGG - Intergenic
1022608852 7:31847927-31847949 AGAGATTTGTAGGCCAGGGAAGG - Intronic
1022889133 7:34677772-34677794 AGAAATTTGCTCACTGGAGATGG - Intronic
1022918038 7:34980996-34981018 AGAGTTTTGAAGGATGGGGAGGG + Intronic
1024104344 7:46067032-46067054 AGAGAGATGAAGAATGGGGAGGG - Intergenic
1024501057 7:50106799-50106821 GGAAATTAGAAGACTGGGGAAGG + Intronic
1027193436 7:76011691-76011713 AGAGATTTGCAGGCAGGGCCTGG - Intronic
1028613972 7:92743884-92743906 AGGGAGTTATAGACTGGGGAAGG + Intronic
1028616025 7:92767759-92767781 AGAGGGGTGCAGAGTGGGGAGGG + Intronic
1029452488 7:100648921-100648943 AGAGATTTGCAGACTGGGGATGG - Intronic
1029631712 7:101755763-101755785 AGACATATGTAGACTGGGTATGG - Intergenic
1030503416 7:110388004-110388026 AATGATTTGGAGACTAGGGAAGG + Intergenic
1031656090 7:124357635-124357657 AGAGATTTGCAGATTCGCTAAGG - Intergenic
1031810495 7:126361873-126361895 GGAGATTTGGAGACAGGCGAAGG - Intergenic
1032391494 7:131557799-131557821 AGATATTTGCACACTGGGGGTGG + Intronic
1033140931 7:138825894-138825916 ACAGATTTTCAGGCTGGGCATGG + Intronic
1033237247 7:139648113-139648135 AGAGCCTTTCAGACTGGGGGTGG - Intronic
1033451286 7:141464342-141464364 AGAGACTTCTAGACTTGGGAGGG + Intronic
1034737165 7:153440027-153440049 ACAGATTTGGTGTCTGGGGAGGG - Intergenic
1035061368 7:156071901-156071923 AGCGTTTTTCAGACCGGGGAAGG + Intergenic
1035186984 7:157134075-157134097 AAAGATTTTCAGGCTGGGCATGG - Intergenic
1035931082 8:3780866-3780888 TGAGATTTGCAGAGTGTGGAAGG + Intronic
1036397416 8:8381169-8381191 TGTGATTTGCAGACTGTGTAGGG - Intronic
1038724354 8:30067130-30067152 ATAGATTTTGGGACTGGGGAGGG + Intronic
1039033355 8:33332905-33332927 AGATATGTGCAGATTGTGGATGG - Intergenic
1040009368 8:42648531-42648553 AGAGAATTGAAGTCTGGGGCTGG - Intergenic
1040526151 8:48226829-48226851 AGAGGAGTGCAGACTGAGGATGG - Intergenic
1041062379 8:54047979-54048001 AGAAATTTGAAGACTGGGCATGG + Exonic
1042227219 8:66523227-66523249 TGAGAGGTGGAGACTGGGGAAGG + Intergenic
1044513200 8:93108043-93108065 AAACATATGCAGGCTGGGGACGG - Intergenic
1045106662 8:98899273-98899295 AAAATTTTGCAAACTGGGGAAGG - Intronic
1047011903 8:120681685-120681707 TGATATTTGCAGAATTGGGAAGG + Intronic
1048440797 8:134457723-134457745 AGAGATCTGGACTCTGGGGAGGG + Intergenic
1048452323 8:134544212-134544234 AAGGATTTGCAGCCTGTGGAGGG - Intronic
1048761914 8:137804673-137804695 AGAGAATAGCAGGCTGGGCATGG - Intergenic
1049580713 8:143409271-143409293 AGAGCTGTCCAGGCTGGGGAGGG + Intergenic
1050547669 9:6722385-6722407 AGAGATTTGGAGGCTGGGCTTGG + Intronic
1050751264 9:8940582-8940604 AGAGATGTGCAGGCTGGGTGCGG - Intronic
1050757609 9:9026821-9026843 AGAGGTTTGGAGAATGGGGTCGG - Intronic
1050989446 9:12130374-12130396 ATAGATATACATACTGGGGAAGG - Intergenic
1051490140 9:17654093-17654115 AGAGAGCTGCAGACTGGGGGAGG + Intronic
1052983160 9:34463878-34463900 AGAGATTTTGAGCCTGGTGATGG + Intronic
1053754767 9:41294280-41294302 AGAGATTGACAGCCTGTGGAGGG + Intergenic
1054260289 9:62858583-62858605 AGAGATTGACAGCCTGTGGAGGG + Intergenic
1057336488 9:94159743-94159765 AGGGGTTTGCAAACTGGTGATGG - Intergenic
1059652432 9:116327341-116327363 AGAAATGTGCAGATTGGGAAGGG + Intronic
1059771558 9:117431231-117431253 ACAGCTTTGGAGACAGGGGAGGG + Intergenic
1060759799 9:126237613-126237635 AGAGAGCTGGAGACTGGGGGTGG + Intergenic
1060828229 9:126698509-126698531 AGAGTTGAGCAGACTGGGGCTGG - Exonic
1061377859 9:130236712-130236734 GGGAATGTGCAGACTGGGGAGGG - Exonic
1062431082 9:136527157-136527179 AGAGAGGTACAGACTGGGGCGGG - Intronic
1202801389 9_KI270720v1_random:2677-2699 AGAGTTTTGCAGTCTGGTGGGGG + Intergenic
1185836799 X:3352198-3352220 AGTGAATTGCAGACAGGGAAAGG + Intergenic
1186070857 X:5818308-5818330 ATAAATTTGCAGATTGGGAAGGG + Intergenic
1186423407 X:9444394-9444416 AGGGTTTTGAAGAGTGGGGAGGG - Intergenic
1186492051 X:9981469-9981491 ATAGATTTGATGACGGGGGAGGG + Intergenic
1186596309 X:10985357-10985379 AGAGACTTGAAGAATGTGGAGGG - Intergenic
1188054818 X:25528583-25528605 AGAGATTGGCTTACAGGGGACGG - Intergenic
1188483164 X:30654130-30654152 AGAGGGTTGAATACTGGGGAGGG + Intronic
1188672250 X:32894323-32894345 AGAGGTTTACATACAGGGGAGGG + Intronic
1188913443 X:35879711-35879733 AGGGATCAGAAGACTGGGGATGG - Intergenic
1190046735 X:47117483-47117505 AGCTATTTGGAGACTGAGGAAGG + Intergenic
1191851124 X:65587269-65587291 GGAGATTTTCAGAGTGGGGAGGG - Intergenic
1193198774 X:78663500-78663522 AAAGGTTTGCAGACTGCTGAAGG + Intergenic
1194306930 X:92259152-92259174 AGAGGTTGGAAGACTGTGGAGGG - Intronic
1194946227 X:100071275-100071297 AAGGATTTTCAGACGGGGGAAGG - Intergenic
1194979364 X:100424553-100424575 AGAGATTGGAAGGCTGGGAAAGG + Intergenic
1195068809 X:101260566-101260588 AGAACTTCGCACACTGGGGAAGG - Exonic
1195715894 X:107818496-107818518 AGAGGTTGGAAGACTGTGGAGGG + Intergenic
1196873491 X:120135669-120135691 AGTGACTTGCGGAGTGGGGAGGG - Intergenic
1197134662 X:123047084-123047106 AGATATTTGCTCACTGGGGCTGG + Intergenic
1197176765 X:123494428-123494450 AGAGATTTCCAAACTGGAGGAGG - Intergenic
1197249505 X:124200201-124200223 ACAGATTGGGAGACTGAGGAGGG + Intronic
1198279010 X:135123953-135123975 AGTGGCTTGCAGAGTGGGGAGGG + Intergenic
1198291948 X:135248567-135248589 AGTGGCTTGCAGAGTGGGGAGGG - Intergenic
1198297981 X:135305546-135305568 AGTGGCTTGCAGAGTGGGGAGGG - Intronic
1199388389 X:147249811-147249833 AGAGATTTGCAGGCTACGGTTGG + Intergenic