ID: 1029453957

View in Genome Browser
Species Human (GRCh38)
Location 7:100657902-100657924
Sequence CAGCTCTGACAACTTGGGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029453950_1029453957 12 Left 1029453950 7:100657867-100657889 CCAGTACCACAGTTTTGGTAGCA No data
Right 1029453957 7:100657902-100657924 CAGCTCTGACAACTTGGGGTAGG No data
1029453952_1029453957 6 Left 1029453952 7:100657873-100657895 CCACAGTTTTGGTAGCAAAGGCA No data
Right 1029453957 7:100657902-100657924 CAGCTCTGACAACTTGGGGTAGG No data
1029453947_1029453957 30 Left 1029453947 7:100657849-100657871 CCAGGTTCTTCTGGGCTCCCAGT No data
Right 1029453957 7:100657902-100657924 CAGCTCTGACAACTTGGGGTAGG No data
1029453949_1029453957 13 Left 1029453949 7:100657866-100657888 CCCAGTACCACAGTTTTGGTAGC No data
Right 1029453957 7:100657902-100657924 CAGCTCTGACAACTTGGGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029453957 Original CRISPR CAGCTCTGACAACTTGGGGT AGG Intergenic
No off target data available for this crispr