ID: 1029456229

View in Genome Browser
Species Human (GRCh38)
Location 7:100673896-100673918
Sequence GCGGTGGGACTCTGCGGCGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 140}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029456229_1029456235 -5 Left 1029456229 7:100673896-100673918 CCTCCGCCGCAGAGTCCCACCGC 0: 1
1: 0
2: 0
3: 7
4: 140
Right 1029456235 7:100673914-100673936 ACCGCCACAGGTACCTTCGCTGG 0: 1
1: 0
2: 1
3: 5
4: 34
1029456229_1029456238 2 Left 1029456229 7:100673896-100673918 CCTCCGCCGCAGAGTCCCACCGC 0: 1
1: 0
2: 0
3: 7
4: 140
Right 1029456238 7:100673921-100673943 CAGGTACCTTCGCTGGCAAAAGG 0: 1
1: 0
2: 0
3: 8
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029456229 Original CRISPR GCGGTGGGACTCTGCGGCGG AGG (reversed) Exonic