ID: 1029456235

View in Genome Browser
Species Human (GRCh38)
Location 7:100673914-100673936
Sequence ACCGCCACAGGTACCTTCGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 41
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 34}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029456224_1029456235 16 Left 1029456224 7:100673875-100673897 CCGCCCGCGCACCGCCAGCGACC 0: 1
1: 0
2: 1
3: 19
4: 136
Right 1029456235 7:100673914-100673936 ACCGCCACAGGTACCTTCGCTGG 0: 1
1: 0
2: 1
3: 5
4: 34
1029456226_1029456235 12 Left 1029456226 7:100673879-100673901 CCGCGCACCGCCAGCGACCTCCG 0: 1
1: 0
2: 0
3: 8
4: 92
Right 1029456235 7:100673914-100673936 ACCGCCACAGGTACCTTCGCTGG 0: 1
1: 0
2: 1
3: 5
4: 34
1029456227_1029456235 5 Left 1029456227 7:100673886-100673908 CCGCCAGCGACCTCCGCCGCAGA 0: 1
1: 0
2: 0
3: 11
4: 104
Right 1029456235 7:100673914-100673936 ACCGCCACAGGTACCTTCGCTGG 0: 1
1: 0
2: 1
3: 5
4: 34
1029456228_1029456235 2 Left 1029456228 7:100673889-100673911 CCAGCGACCTCCGCCGCAGAGTC 0: 1
1: 0
2: 0
3: 6
4: 69
Right 1029456235 7:100673914-100673936 ACCGCCACAGGTACCTTCGCTGG 0: 1
1: 0
2: 1
3: 5
4: 34
1029456225_1029456235 13 Left 1029456225 7:100673878-100673900 CCCGCGCACCGCCAGCGACCTCC 0: 1
1: 0
2: 2
3: 6
4: 125
Right 1029456235 7:100673914-100673936 ACCGCCACAGGTACCTTCGCTGG 0: 1
1: 0
2: 1
3: 5
4: 34
1029456230_1029456235 -8 Left 1029456230 7:100673899-100673921 CCGCCGCAGAGTCCCACCGCCAC 0: 1
1: 0
2: 1
3: 10
4: 160
Right 1029456235 7:100673914-100673936 ACCGCCACAGGTACCTTCGCTGG 0: 1
1: 0
2: 1
3: 5
4: 34
1029456229_1029456235 -5 Left 1029456229 7:100673896-100673918 CCTCCGCCGCAGAGTCCCACCGC 0: 1
1: 0
2: 0
3: 7
4: 140
Right 1029456235 7:100673914-100673936 ACCGCCACAGGTACCTTCGCTGG 0: 1
1: 0
2: 1
3: 5
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029456235 Original CRISPR ACCGCCACAGGTACCTTCGC TGG Exonic