ID: 1029457188

View in Genome Browser
Species Human (GRCh38)
Location 7:100677332-100677354
Sequence AGCCTGGTGGGGAACGGTGT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 201}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029457188_1029457195 -3 Left 1029457188 7:100677332-100677354 CCTACACCGTTCCCCACCAGGCT 0: 1
1: 0
2: 0
3: 24
4: 201
Right 1029457195 7:100677352-100677374 GCTGCTGGTCAGCGCCTCCCAGG 0: 1
1: 0
2: 3
3: 28
4: 282
1029457188_1029457197 2 Left 1029457188 7:100677332-100677354 CCTACACCGTTCCCCACCAGGCT 0: 1
1: 0
2: 0
3: 24
4: 201
Right 1029457197 7:100677357-100677379 TGGTCAGCGCCTCCCAGGATGGG 0: 1
1: 0
2: 2
3: 9
4: 113
1029457188_1029457202 18 Left 1029457188 7:100677332-100677354 CCTACACCGTTCCCCACCAGGCT 0: 1
1: 0
2: 0
3: 24
4: 201
Right 1029457202 7:100677373-100677395 GGATGGGAAGCTCATCATCTGGG 0: 1
1: 0
2: 0
3: 13
4: 178
1029457188_1029457201 17 Left 1029457188 7:100677332-100677354 CCTACACCGTTCCCCACCAGGCT 0: 1
1: 0
2: 0
3: 24
4: 201
Right 1029457201 7:100677372-100677394 AGGATGGGAAGCTCATCATCTGG 0: 1
1: 0
2: 1
3: 19
4: 183
1029457188_1029457196 1 Left 1029457188 7:100677332-100677354 CCTACACCGTTCCCCACCAGGCT 0: 1
1: 0
2: 0
3: 24
4: 201
Right 1029457196 7:100677356-100677378 CTGGTCAGCGCCTCCCAGGATGG 0: 1
1: 0
2: 0
3: 22
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029457188 Original CRISPR AGCCTGGTGGGGAACGGTGT AGG (reversed) Exonic
900581790 1:3413142-3413164 AGAGGGGTGGGGAAGGGTGTGGG - Intronic
901601109 1:10424039-10424061 AGCATGGTGGGGGACGGGGGAGG + Intergenic
902507846 1:16949315-16949337 AGACTGGATGGGAACGGTGCAGG - Intronic
904260658 1:29285827-29285849 TGCCTGGTGGGGAACATGGTGGG - Intronic
904929147 1:34072755-34072777 AGCCAGGTGGGCAGCAGTGTCGG - Intronic
906169554 1:43712827-43712849 AGCCTGTTGGGGGAGTGTGTGGG + Intronic
906249992 1:44303656-44303678 TGGCTGGTGGGGAGGGGTGTGGG + Intronic
911725899 1:101240275-101240297 AGCCTGGTGGTGTCGGGTGTTGG + Exonic
912239113 1:107886370-107886392 AGCATGGAGGGGAAGGGTGCTGG - Intronic
913292490 1:117286640-117286662 AGCCTGGTGGGTATCAGTATGGG + Intergenic
913557926 1:119987528-119987550 AGCCAGGTGGGGAAGGGAGTGGG + Intronic
915639370 1:157211273-157211295 AACCTGTTGGGGAATGGTGTAGG - Intergenic
918078066 1:181185483-181185505 AGCCTGGTGAGGAAGGGGATGGG + Intergenic
918420823 1:184362822-184362844 AGCCTGTTGGGCAATGGTGAGGG - Intergenic
920025234 1:202989127-202989149 AGCCTGGCCAGGAACTGTGTGGG + Intergenic
922566660 1:226605729-226605751 AGCCTTGTGGGGCAGGGTGGAGG - Exonic
923613358 1:235514976-235514998 AGCCTGCTGGGCAACAGAGTGGG + Intergenic
1062907969 10:1191455-1191477 AGCCTGGTGGTGAGCAGGGTCGG + Intronic
1065204477 10:23344146-23344168 AGGGGGGTGGGGAACGGGGTGGG + Intronic
1070987784 10:80703005-80703027 AGCCTGGAGGGGAAGGGGGCAGG + Intergenic
1071207070 10:83293751-83293773 AGCCTGGGTGGGAACTGAGTGGG + Intergenic
1072607806 10:96998959-96998981 AGGGTGGTGGGGAATGGTGGTGG + Exonic
1073079995 10:100853762-100853784 AGCCTTGTGGGGCATGGTGTGGG - Intergenic
1074556541 10:114496490-114496512 AGCCTGTTGGGGGAGGGTGGCGG + Intronic
1075310907 10:121412698-121412720 ATCCTGGCTGGGAACGGTGGGGG - Intergenic
1077368477 11:2170795-2170817 AGCCTGGTGGGGGAGGGTAGGGG + Intronic
1077553948 11:3217205-3217227 GGCCGGGTGGGGACCAGTGTGGG + Intergenic
1078845420 11:15115056-15115078 AGCCTAGTTGGGAACAGTGCAGG + Intronic
1079004267 11:16781202-16781224 GGCCTGGTGGGGAACCGGATGGG + Intronic
1079489512 11:20972016-20972038 GGCCTGCTGGGGAGCGGGGTGGG + Intronic
1081163809 11:39785010-39785032 AGCCAGCTGGGGAGCGGTGAGGG + Intergenic
1081756696 11:45549789-45549811 AGCCTGCTGGGGAAAGCTGGTGG + Intergenic
1082846799 11:57732819-57732841 AGCCTGGTGGGGGGTGGGGTGGG + Intronic
1083280216 11:61622231-61622253 AGCATGGGGGGGTAGGGTGTGGG + Intergenic
1084177037 11:67428379-67428401 AGCCTGGTGGGGAACAAAGATGG - Intergenic
1084747543 11:71182866-71182888 TGCATGGTGGGGCACGCTGTGGG - Intronic
1085510935 11:77087896-77087918 AGCCTGTGGGTGAAGGGTGTGGG - Intronic
1089832300 11:121339245-121339267 CGCCTGGGAAGGAACGGTGTTGG + Intergenic
1090263127 11:125336227-125336249 AGCCTTGTGGGGAGAGGTGAGGG - Intronic
1091590984 12:1842829-1842851 AGCCTTGGGGTGGACGGTGTGGG + Intronic
1091617020 12:2057436-2057458 CGCCTGGTGATGAAAGGTGTAGG + Intronic
1092154587 12:6274055-6274077 GGGCTGGTGGGGAGGGGTGTGGG + Intergenic
1092995016 12:13941467-13941489 AGCCAGGTGAGGAACGGGATTGG + Intronic
1095054378 12:37582238-37582260 AGCCTGGTGGGTAGAGGGGTGGG + Intergenic
1097069867 12:56346988-56347010 GGCCTGGTGGGGCAGGGTGTTGG - Intronic
1098597715 12:72293876-72293898 AGTCAGGTGTGGAACGGTGAGGG + Intronic
1101278480 12:103226718-103226740 AGCCTGGTGAGGAACAGCCTGGG + Intergenic
1101882576 12:108635377-108635399 AACCTGCTGGGGAAGGGTGAGGG - Intergenic
1105830609 13:24160683-24160705 GGCCTGGTGGGGAGCGGGGCTGG + Intronic
1107730560 13:43344199-43344221 AGCCTGCAGGTGAACGGTGGCGG + Intronic
1108216376 13:48188911-48188933 AGTCTGGTGGTGAAGGGTCTGGG - Intergenic
1111388393 13:87560784-87560806 AGACTTGTAGGGAACGGTGAGGG + Intergenic
1112644826 13:101318247-101318269 AGCCAGGTGGGGAGCAGTGCGGG + Intronic
1114595793 14:23910634-23910656 AGGCAGGTAGGGAACGCTGTGGG + Intergenic
1122190910 14:100042923-100042945 AGTCTGGTGGATAACAGTGTGGG + Intronic
1122833750 14:104421075-104421097 AGCCTGGCAGGGAGGGGTGTTGG + Intergenic
1122856144 14:104561092-104561114 AGCCAGGTGGGGATGGGTGAGGG + Intronic
1122893738 14:104745083-104745105 GGCCTCCTGGGGAACGCTGTGGG - Intronic
1123043686 14:105500926-105500948 AGCCTGGAGGCCCACGGTGTCGG + Intergenic
1128330320 15:66751414-66751436 AGCCTGGAAGGGAAGGGAGTGGG - Intronic
1128422160 15:67503443-67503465 AGACTGGTGGAGAATGATGTTGG + Intergenic
1129348505 15:74939643-74939665 AGGTTGGTGGGAAACGGTGAGGG - Intergenic
1132116208 15:99138173-99138195 AGGCTGGATGGGAACGGTGTGGG - Intronic
1132501858 16:288015-288037 AGCCCGATGGGGAACAGTGTTGG - Exonic
1132568772 16:635093-635115 AGCCTGGTGGGCAAGGGGGTAGG + Intronic
1133168162 16:3963721-3963743 AGCCTGGAGGGGAAAGGGGAGGG + Exonic
1134640729 16:15827513-15827535 AGCCTGGTGGGGCTGGGAGTGGG + Intronic
1135113696 16:19709146-19709168 GGCCTGGTGGGGTATGGAGTGGG - Intronic
1135724808 16:24846091-24846113 ACCCTGGTGGAGGACGGTGTGGG + Exonic
1135949351 16:26898738-26898760 AGCCTGCTGGGTGATGGTGTTGG - Intergenic
1137735945 16:50723299-50723321 AGCCTGGTGGGGAACAACATTGG + Exonic
1138341460 16:56292101-56292123 AGCCTGCTGGGGAACGCTGATGG - Intronic
1138531560 16:57637248-57637270 ACCCTGGTCGGGAATGTTGTAGG + Intronic
1139296023 16:65901660-65901682 AGTCTGATGGGGAAAGGGGTAGG - Intergenic
1139304064 16:65968437-65968459 GGCCTGGTGGGAAAGGGTGATGG + Intergenic
1142325693 16:89413058-89413080 AGCCTGGAGGGGGAGGGAGTAGG + Intronic
1142686194 17:1578205-1578227 GGCCTGGTGGGCGAGGGTGTGGG - Intronic
1142763924 17:2055650-2055672 GGCCAGGAGGGGAACGGGGTCGG + Intronic
1143020908 17:3916805-3916827 ACCCTGGTGGGGGAGGGTGGAGG - Intergenic
1143782455 17:9236348-9236370 AGCCTGGTGGAGTGCCGTGTGGG + Intronic
1144327171 17:14193556-14193578 AGCCTGGTGGGAAAGAGTGCTGG + Intronic
1144476059 17:15590419-15590441 AGCCTGGTGGGAAAGAGTGCTGG + Intronic
1144666277 17:17104537-17104559 AGCCTGGTGGGGAGCCGTGAAGG + Intronic
1145371671 17:22311473-22311495 AGCCTGGTGGTGAGAGGAGTGGG + Intergenic
1146548031 17:33755946-33755968 AGCAGGGTGGGGAAGGGAGTGGG + Intronic
1147162873 17:38578280-38578302 AGCCTGGGGAGGAAGGGGGTGGG - Intronic
1147234415 17:39046537-39046559 GGCATGGTGGGGAAGGGAGTGGG - Intergenic
1147871193 17:43588800-43588822 AGGCTGGTGTGGAAAGGGGTGGG - Intergenic
1149009115 17:51836570-51836592 TACCTGGTGGGGAAGGGTGGGGG - Intronic
1150189445 17:63222552-63222574 AGAGTGGTGGGTAAAGGTGTAGG + Intronic
1150468807 17:65418301-65418323 AGGCTGGAGTGCAACGGTGTGGG + Intergenic
1152467856 17:80475922-80475944 GGCCGGGTAGGGAACGGGGTGGG + Intronic
1152740790 17:82017488-82017510 AGCCTGGTGGACCATGGTGTGGG + Intergenic
1152747758 17:82049114-82049136 AACCTGGGAGGGAAGGGTGTGGG + Exonic
1153820323 18:8826251-8826273 GAGCTGGTGGGGAAGGGTGTGGG - Intronic
1156240845 18:35252419-35252441 AGCCTGGTAAGGAGGGGTGTGGG - Exonic
1157488535 18:48106828-48106850 AGCGGGGTGGGGAATGGGGTGGG + Intronic
1157551300 18:48583457-48583479 AGTTTGGTGGGGAAAGGAGTCGG + Intronic
1160439466 18:78878374-78878396 AGCCTGGAATGGGACGGTGTTGG - Intergenic
1160591242 18:79945740-79945762 GGCCTGGAGGGGGCCGGTGTGGG - Intronic
1160807674 19:999765-999787 ATCCTGGAGAGGAACGGGGTGGG + Intergenic
1161522043 19:4730107-4730129 AGCCCGCTGGGGAGGGGTGTGGG - Intergenic
1163311412 19:16517125-16517147 AGCCTGCTGGGGACAGGTGCTGG + Intronic
1164080709 19:21859422-21859444 AGCCTGGTGAGGAGCGGCCTGGG - Intergenic
1164703382 19:30302296-30302318 AGCCAGGTGGGGAACGTGCTGGG + Intronic
1165632309 19:37312314-37312336 AGCGTGGTGGGGAGAGGAGTAGG - Intergenic
1165670400 19:37673677-37673699 ATCCAGGTGGGTAAGGGTGTTGG - Intronic
1166309611 19:41955649-41955671 AGCCTTGTGGGCCACGGTGAGGG - Intergenic
1166839442 19:45687725-45687747 TGCCTGGTGGGGAACAGGGAGGG + Exonic
1166916970 19:46202034-46202056 GGCCTGGTGAGGAGCAGTGTGGG + Intergenic
1168060583 19:53889866-53889888 AGCCTGGAGGGGAAAGCTGCGGG - Exonic
928820413 2:35355219-35355241 AGCCAGGGGTGGAACGGTGAGGG + Intergenic
930658392 2:54029750-54029772 AGCATGCTGGGGAACATTGTAGG + Intronic
931697941 2:64885823-64885845 GGCCTGGGGGGTAATGGTGTGGG - Intergenic
933137841 2:78759538-78759560 AGCCTGGTGAGGAGCAGTCTGGG - Intergenic
934726737 2:96625958-96625980 AGGCGGGTGGGGCACGGGGTGGG - Intronic
935172170 2:100618720-100618742 AGACTTGTGGGGAAGAGTGTGGG - Intergenic
935708565 2:105877443-105877465 AGGCTGGAGGGGTACTGTGTGGG - Intronic
936033383 2:109089627-109089649 AACCTGGTGGGGACATGTGTTGG + Intergenic
937014339 2:118589869-118589891 AACCTGGTGGGGGATGGGGTAGG - Intergenic
937214164 2:120300460-120300482 AGGCTGGGGCGGAAGGGTGTTGG - Intergenic
937435241 2:121874554-121874576 GGCCTGGTGGGGAAGGGGATTGG + Intergenic
939981686 2:148790171-148790193 GGCCTGTTGGGGAAGGGTGGGGG - Intergenic
941912473 2:170776920-170776942 AGCCTTCTGGGGGACGGGGTGGG - Intergenic
943180116 2:184530315-184530337 AGCCAGGTGTGGAACGATGAGGG + Intergenic
946573236 2:221047107-221047129 AACCAGGTGGGGAAGGGTTTGGG - Intergenic
948811396 2:240480288-240480310 GGCCTGGTGGGGACGGGAGTGGG - Intronic
1169136903 20:3203177-3203199 AGCCTGGTGGGGAGAGGGTTTGG - Intronic
1170775379 20:19370889-19370911 AGCCTGGTGGGTCCCGGTGGTGG + Intronic
1172060676 20:32185230-32185252 AGTTGGGTGGAGAACGGTGTGGG - Intergenic
1172091740 20:32437588-32437610 AGCCTGATGTGGCACGGAGTGGG + Exonic
1173869436 20:46332318-46332340 GGCCTGGTGGGGAGCGGTGGTGG + Intergenic
1174287626 20:49483814-49483836 AGGCTGGAGGGGAGCGGGGTGGG - Intergenic
1179791054 21:43756276-43756298 AGCCTTGTGGGGAAGGGAGCCGG - Exonic
1180626858 22:17199366-17199388 AGCCTGGTGGGGAGGCATGTGGG - Intronic
1180799624 22:18625728-18625750 GGCCTGGTAGGGAATGGTGCAGG + Intergenic
1180818289 22:18806942-18806964 CTCTTGGTGGGGAACGGTTTGGG - Intergenic
1181204512 22:21241397-21241419 CTCTTGGTGGGGAACGGTTTGGG - Intergenic
1181222092 22:21369538-21369560 GGCCTGGTAGGGAATGGTGCAGG - Intergenic
1181592801 22:23895284-23895306 AGCGAGGTCGGGAACGGTGTTGG + Exonic
1181637852 22:24182532-24182554 GGCCTGGTAGGGAATGGTGCAGG - Intronic
1182996000 22:34812979-34813001 ATCCTGGTGGGGCATGGGGTGGG - Intergenic
1184984395 22:48119517-48119539 AGGGTGGTGGGGAACTGTGAGGG - Intergenic
1185030231 22:48439093-48439115 ATCCTGGTGTGGAAAGGAGTTGG - Intergenic
1185380374 22:50505040-50505062 AGCCTGGTGGGTAGCGCTGCAGG - Exonic
1203222413 22_KI270731v1_random:54018-54040 CTCTTGGTGGGGAACGGTTTGGG + Intergenic
1203268417 22_KI270734v1_random:32796-32818 CTCTTGGTGGGGAACGGTTTGGG - Intergenic
949378508 3:3417467-3417489 GGTCTGGTGGGGAATGGTTTTGG - Intergenic
950096412 3:10333306-10333328 AGGCTGGTGGGGTGCGGTGGGGG + Intronic
950207737 3:11093402-11093424 AGCCAGGTGTGGAACGGTGAGGG - Intergenic
952497995 3:33932909-33932931 AGGCTGTTGGGGAAGGGGGTGGG + Intergenic
954879721 3:53825096-53825118 AGTCTGGTGGGGAGTGGTGTGGG - Intronic
955826329 3:62951576-62951598 ACCCCGGTGGGGACCTGTGTTGG - Intergenic
956580275 3:70804025-70804047 AGCCTGGGGGGGAATTTTGTGGG + Intergenic
958977540 3:100683594-100683616 AGCCAGGTGTGGAGCGGTGAGGG - Intronic
959237694 3:103745885-103745907 AGGATGGTGGGGAACATTGTAGG + Intergenic
959325341 3:104929854-104929876 AGCTTGGTGGGGATGGGTGGGGG - Intergenic
959573214 3:107907925-107907947 AGACTTCTGGGGAAGGGTGTGGG - Intergenic
961552667 3:127677966-127677988 AGGCTGGAGGGGAAGGCTGTGGG + Intronic
962194428 3:133348656-133348678 ACCCTGGAGGGGCATGGTGTAGG + Intronic
963056483 3:141190368-141190390 AGCCCGGTGGGGAAGGGGGCTGG - Intergenic
965442717 3:168735643-168735665 AGCTGGGAGGGGAAAGGTGTTGG + Intergenic
966851039 3:184165081-184165103 AGCCTGGTGGGGAACGACTGTGG + Intronic
968519611 4:1029557-1029579 AGCATGGCGGGGCAGGGTGTGGG + Intergenic
968626176 4:1627680-1627702 GGCCTGCAGGGGAAGGGTGTCGG + Intronic
970608851 4:17707383-17707405 AGCCTGGTGGGGAAATATCTGGG + Intronic
974475966 4:62380742-62380764 ACACTGGTGGTGAACTGTGTTGG + Intergenic
978781500 4:112559828-112559850 AGCCTAGTGGGTAAGAGTGTGGG - Intronic
978897534 4:113907026-113907048 AGCCTGGTGGGGCAGGTTGAGGG - Intronic
981823660 4:148914948-148914970 AGTCTGGTGGATAACAGTGTGGG - Intergenic
986607036 5:9532768-9532790 AGCCTGGTGGAGAAAGGGCTTGG - Intronic
987192848 5:15497036-15497058 AGCCAGGTGGGGGTGGGTGTTGG + Intergenic
988628798 5:32906797-32906819 AGCCTAATGGGGAATGGTGGTGG + Intergenic
992576309 5:78117152-78117174 AAGGTGGTGGGGAATGGTGTTGG - Intronic
1002132788 5:177091751-177091773 TGCCTGGTAGAGAACGCTGTGGG + Exonic
1002949207 6:1792211-1792233 AGCCTGGTGGGGAAAGGGGATGG - Intronic
1004800691 6:19143884-19143906 AGCGTGCTGGGGAACATTGTAGG - Intergenic
1006981820 6:38153660-38153682 CGCCAGGTGGGGAAGGGTGGGGG + Exonic
1007178462 6:39912157-39912179 AGGCTGGCAGGGCACGGTGTCGG - Intronic
1011161660 6:84397512-84397534 GGCCTGTTGGGGAATGGGGTTGG + Intergenic
1013314158 6:108924931-108924953 AGTCAGGTGGGGAAAGGGGTGGG + Intronic
1015092203 6:129372087-129372109 ATTCTGGTGGGGAAGGTTGTGGG - Intronic
1015946282 6:138504568-138504590 AGCCCTGTGGGGAAAGGTGGTGG + Intronic
1018394394 6:163366514-163366536 AGCCTGGTGGGAAACACTGCGGG + Intergenic
1019420100 7:946677-946699 AGCCTGGAGGGGCGCGGGGTGGG - Intronic
1019544459 7:1566836-1566858 AGTCTTGTGGGGAGCAGTGTTGG - Intergenic
1025297765 7:57789774-57789796 AGACTGGTGGGGAGAGGGGTGGG + Intergenic
1026804615 7:73422153-73422175 AGCCTGGGGGACAACGGGGTGGG + Intergenic
1026989202 7:74573724-74573746 AGCCTTGTGGGGAGGGGTGTGGG + Intronic
1027532872 7:79357229-79357251 AGCCTGATGAGGTACAGTGTTGG - Intronic
1028381601 7:90206109-90206131 TGGCTGGTGGGGAAGAGTGTGGG - Intronic
1028903008 7:96122175-96122197 AGTCTGGTGGGGAGGGGTGTAGG - Intronic
1029453469 7:100655584-100655606 AGCCTGGTGGGGAAGGGTTGGGG + Exonic
1029457188 7:100677332-100677354 AGCCTGGTGGGGAACGGTGTAGG - Exonic
1030270977 7:107667941-107667963 AGTCTGGTGGAGAAGGGTTTGGG + Intronic
1032448547 7:132005196-132005218 ACCCTGGTGGGGATCAGGGTTGG + Intergenic
1032468280 7:132160536-132160558 GGACTGGAGGGGAACGGGGTGGG + Intronic
1033671902 7:143501085-143501107 AGCCTGGTGGCTAAAGGTGTAGG + Intergenic
1034197794 7:149261820-149261842 AGCTGCGTGGGGAACGGGGTCGG - Intergenic
1035006423 7:155665199-155665221 AGCCTGGCGCGGAACGGTCGTGG + Exonic
1035707659 8:1689481-1689503 AGGCTGGTGGAAAATGGTGTAGG - Intronic
1040302270 8:46194240-46194262 AGCCTGCTGGGGATAGGTTTGGG - Intergenic
1046439216 8:114236622-114236644 AGCCAGAAGGGGAACGGAGTGGG - Intergenic
1047893600 8:129340663-129340685 AGGGTGGTGGGGAAGTGTGTAGG - Intergenic
1048848853 8:138625175-138625197 AGCCTGGTGGGGAGCAGGGAAGG + Intronic
1049879752 8:145053532-145053554 AGCCTGGTGGGGGAAGGAGATGG + Intronic
1051946684 9:22577758-22577780 AGCCTGTTGGGGGATGGTGTTGG + Intergenic
1053427501 9:38020403-38020425 AGACTGGTGGGGAAGGGTGCTGG - Intronic
1053795844 9:41726257-41726279 AGACTGGTGGGGAGAGGGGTGGG - Intergenic
1054184251 9:61938328-61938350 AGACTGGTGGGGAGAGGGGTGGG - Intergenic
1054654255 9:67650167-67650189 AGACTGGTGGGGAGAGGGGTGGG + Intergenic
1057158174 9:92863257-92863279 GGCCTGTTGGGGAAGGGTGGGGG + Intronic
1059638893 9:116196794-116196816 GGCCTGGTGGTGAAGGGTGGAGG + Intronic
1061188558 9:129069176-129069198 AGCGTGGTGGGGAGCGGAGCGGG + Intronic
1061504191 9:131021878-131021900 AGCAGGGTGAGGAACGGTGAAGG + Intronic
1062314303 9:135958556-135958578 TGCCTGGAGGGGAATGATGTCGG - Intronic
1187349962 X:18504228-18504250 AGCCTGGTGGGCATGGTTGTGGG - Intronic
1188190224 X:27163423-27163445 AGCCTCGTGGGGAAAGTTTTTGG - Intergenic
1189001100 X:36947948-36947970 AGGGTGGTGGGGAACTGGGTGGG - Intergenic
1190641052 X:52482889-52482911 GGCCAGGAGGGGAAGGGTGTGGG - Intergenic
1190646620 X:52529976-52529998 GGCCAGGAGGGGAAGGGTGTGGG + Intergenic
1191882567 X:65857450-65857472 AGCCTCGTGGGGAAGGATGTGGG - Intergenic
1195070212 X:101271996-101272018 AGCCTTGTGGGGATGGGGGTGGG + Intronic
1195704969 X:107732132-107732154 ATCCTGGAGGGGAAGGGTGGGGG - Intronic
1200154910 X:153970229-153970251 AGCCCGCTGGGTAACGGTGTGGG + Intronic
1201307592 Y:12563973-12563995 AGCCTGGTGGGGAGCGACGTGGG + Intergenic