ID: 1029457327

View in Genome Browser
Species Human (GRCh38)
Location 7:100677854-100677876
Sequence GCCCCTGAGGCAGGAAGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 389
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 352}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029457327_1029457335 28 Left 1029457327 7:100677854-100677876 CCCACACTTCCTGCCTCAGGGGC 0: 1
1: 0
2: 3
3: 33
4: 352
Right 1029457335 7:100677905-100677927 GCACCGTAGCCTCCCTCTCCTGG 0: 1
1: 0
2: 2
3: 163
4: 2763

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029457327 Original CRISPR GCCCCTGAGGCAGGAAGTGT GGG (reversed) Intronic
900218770 1:1495961-1495983 GCCCCTGGGGCAGAAGGAGTGGG + Exonic
900979788 1:6039805-6039827 GCCCTTGGGGCAGGAACTGAGGG - Intronic
901058923 1:6462755-6462777 GAAACTGAGGCAGGGAGTGTGGG - Intronic
901112600 1:6810337-6810359 GCCCCTGGGGCAGGAATTGAGGG - Intronic
901145421 1:7061659-7061681 GGCCCTGAGGCAGGGAGAGCAGG + Intronic
901151883 1:7109037-7109059 GCCCATGTGGCAGGAACTGAGGG - Intronic
901221711 1:7587163-7587185 GCCTCTGTGGCAGGAGGTGGGGG + Intronic
902681399 1:18046344-18046366 GGCCCTGGGGCAGCAAGTGGAGG - Intergenic
902748908 1:18492959-18492981 GGCCAAGAGGGAGGAAGTGTGGG + Intergenic
902799624 1:18821167-18821189 GGCCCAGAGGCAGGGAGTGACGG + Intergenic
902880835 1:19370810-19370832 GGCTCTGAGGAAGGAACTGTGGG - Intronic
903755453 1:25657420-25657442 GGCCCTGAGGCTTGAAGTGGTGG + Intronic
904679165 1:32216791-32216813 GCCCCTGGGCCATGAAGTGCTGG - Exonic
905180413 1:36162148-36162170 GCACCTCAGGCAGGAAGCATGGG - Intronic
905644551 1:39616271-39616293 GCCCCCGTGGCAGGAACTGTGGG - Intergenic
906680164 1:47720917-47720939 GCCCCTGGGGCAGGAGGAGATGG - Intergenic
908967435 1:69782773-69782795 GCCACTGAGAAAGGAAGTGATGG - Intronic
909353483 1:74680652-74680674 TGCCCTTAGGGAGGAAGTGTTGG - Intergenic
911193629 1:94972238-94972260 GCCACTGAGGCAGGGAATTTTGG + Intergenic
912196410 1:107402288-107402310 GACCCTGAGGCAGGATGGATGGG - Intronic
912724580 1:112047298-112047320 GTCCCTGAGGCAGGGAATGCAGG - Intergenic
913286633 1:117232748-117232770 GCCCCTGAGGCTGATTGTGTTGG + Intergenic
913347803 1:117825607-117825629 ACCCCTGAGGCAGGCTCTGTGGG + Intergenic
913533113 1:119747184-119747206 GCCTCTGATGCAGGAAGTATGGG + Intergenic
914313311 1:146486700-146486722 GGCCCTGAGGCTGGAAGGGATGG - Intergenic
914843637 1:151268002-151268024 GGCCGTGAGGCAGGAAGTTCTGG + Intergenic
915039811 1:152959276-152959298 ACCCCTGAGACAGGATCTGTGGG + Intergenic
915135609 1:153728932-153728954 GCTCCTGAGGGAAGAAATGTGGG + Intronic
916158366 1:161881405-161881427 GCCCATGTGGCAGGAACTGAGGG - Intronic
916190293 1:162171499-162171521 GCCACTGAGGCAGGAAGAGATGG - Intronic
916730787 1:167564935-167564957 GCCCCTGAGGCAGAAGGGATTGG - Intergenic
918131278 1:181631683-181631705 GCACCTGAGGGAGGAAGAGGAGG + Intronic
918505201 1:185246359-185246381 TCACCTGAGCCAGGAAGTGGAGG - Intronic
920205937 1:204292320-204292342 ATCCCTGAAGCTGGAAGTGTTGG + Intronic
920258226 1:204671135-204671157 GGCCCAGAGGCAGGTAGTTTGGG + Intronic
920388329 1:205583158-205583180 GCCCCTGAGGGAGGTGGTGGAGG + Intronic
920693596 1:208164968-208164990 GCCTCTGAGGCGGGAAGTCAGGG + Intronic
922071900 1:222203268-222203290 GGCTCTGAAGCAGGAAGTCTGGG - Intergenic
922782261 1:228262682-228262704 GCCCTTGAGGAATGCAGTGTGGG + Intronic
1063455181 10:6178078-6178100 GGCCCTCAGGCTGCAAGTGTTGG + Intronic
1064737812 10:18400889-18400911 GCCCCGGAGGCAGAAAGGGACGG + Intronic
1069742068 10:70691112-70691134 GGCCCAGAGGCAGGACCTGTAGG - Intronic
1069905102 10:71727554-71727576 GTCTCTGAGGCAGGAACTGGAGG - Intronic
1070761654 10:79027860-79027882 GCTTCTGAGGCAGGCAGGGTGGG - Intergenic
1070766252 10:79058122-79058144 GCTCCTGGGGCAGGAAATGGGGG - Intergenic
1072041471 10:91611081-91611103 GCCCCAGTGGCAGCAAGTCTTGG - Intergenic
1072205690 10:93203516-93203538 GTCCCTGAGTCTGGAAGGGTTGG + Intergenic
1074421136 10:113309669-113309691 GCCCCTGTGGGAGGAGGTGGGGG - Intergenic
1074438076 10:113451656-113451678 GCCCCTCAGCCTGGAAGTGCTGG - Intergenic
1074680686 10:115904046-115904068 GCACCTGTGGGAGGCAGTGTGGG + Intronic
1074981176 10:118621080-118621102 GCCCCAGAGGAAGGAAGTGAGGG - Intergenic
1075705050 10:124495462-124495484 GCATCTGAGGCAGGCAGTGGAGG + Intronic
1075991618 10:126843210-126843232 ACCCCTGAGGCAGGGAGGGCTGG + Intergenic
1076300047 10:129419010-129419032 CCCCCTGAGGGAGGCTGTGTTGG + Intergenic
1076326515 10:129627601-129627623 GGCTGTGAGGAAGGAAGTGTTGG - Intronic
1076635562 10:131880113-131880135 GCCCTGGAGGCAGGCAGGGTGGG + Intergenic
1076769326 10:132654468-132654490 GCCACTGAGGCAGCCAGTGGTGG - Intronic
1076881467 10:133241549-133241571 GCCCAGGAGGCAGGCAGTGCGGG + Exonic
1077081431 11:726212-726234 CCACCTGGGGGAGGAAGTGTGGG + Intronic
1077089480 11:771943-771965 GGCCCTGAGGCAGGGAGAGGTGG - Intronic
1077406190 11:2383514-2383536 GGCCCTGAGGCAGGAAGGAAAGG - Intronic
1077506502 11:2932102-2932124 GCCCCTGGGGCAGGGACTGTGGG - Intergenic
1077939926 11:6830169-6830191 GGCCCTGAGGCAGGAAAGTTTGG + Intergenic
1078428802 11:11271586-11271608 GCCCCTGGGGTAGGAGCTGTAGG - Intronic
1078799343 11:14627316-14627338 AACCCTGAGGCAGGAGGTCTAGG - Intronic
1079084098 11:17433068-17433090 GCCCATGAGGTATGATGTGTAGG - Intronic
1079101177 11:17543375-17543397 GCCCCTCAGGCAGGGCCTGTGGG + Intronic
1080548577 11:33347928-33347950 GCCCCTCAGCCAGTTAGTGTGGG + Exonic
1081400834 11:42640836-42640858 GAGGCTGAGGCAGGAATTGTTGG + Intergenic
1081491489 11:43572862-43572884 GTCCCTCAGGGAGGAAGTCTAGG - Intronic
1081583105 11:44365882-44365904 GCCCCTGAGGTTGGGAGTGTGGG - Intergenic
1082802043 11:57421824-57421846 GCACCTGAGACAGGAAGAGCAGG - Intronic
1083261491 11:61525447-61525469 GGCCCTGAGGCGGGAGGAGTCGG - Intronic
1083438103 11:62656905-62656927 GGCCCTGAGAAGGGAAGTGTTGG - Intronic
1084092250 11:66886295-66886317 CCCGCTGAGGCAGGGAGTGCAGG + Intronic
1084234427 11:67777570-67777592 GCTACTGAGGCAGAAACTGTGGG + Intergenic
1084268322 11:68016295-68016317 GGCCCTGAGGCAGGAGGTGCTGG + Intronic
1084857494 11:71998295-71998317 GCCCCTGGGGCAGGAGGTAGGGG + Intergenic
1084898978 11:72295525-72295547 GCAGCTGAGGCAGGAAGCTTTGG - Exonic
1085895219 11:80631147-80631169 TCCCCTGAGGTAGGGAGTTTGGG + Intergenic
1087710061 11:101538421-101538443 GCCACAGAGCCAGGAAGTCTTGG - Intronic
1089201978 11:116730081-116730103 GCCCCTGGGTGAGGAACTGTGGG - Intergenic
1089459730 11:118645507-118645529 GCCCCGCAGGCAGGTGGTGTAGG - Exonic
1091781961 12:3219500-3219522 GCTCCTGAGGCAGGAGGTGAAGG - Intronic
1093742141 12:22700909-22700931 GCCCCAGAGGCAGGAGTGGTTGG - Intergenic
1096198978 12:49667624-49667646 CCCTCTGAGGAAGGCAGTGTTGG - Intronic
1101167148 12:102050209-102050231 GGCGCTGAGGCAGGAGGTCTAGG + Intronic
1101415265 12:104503380-104503402 GCCACATAGCCAGGAAGTGTGGG - Intronic
1102009100 12:109607073-109607095 GCCCCTGGATCAGGAAGTGGTGG - Intergenic
1102522433 12:113486921-113486943 GCCACAGAGGCAGCAGGTGTAGG - Intergenic
1102858091 12:116312227-116312249 GGCCCTGAGGCAGGAATGTTTGG + Intergenic
1102910977 12:116713977-116713999 GCTCCTGAGGTTGGAAGGGTAGG - Exonic
1105210748 13:18255443-18255465 GGCCCTGAGGCAGGTGGTATAGG + Intergenic
1105557309 13:21459278-21459300 GCCTCCGAGGCAGGACTTGTGGG + Exonic
1105765587 13:23555386-23555408 GCCCCTGTGTAAGCAAGTGTGGG + Intergenic
1106118633 13:26838711-26838733 GTCCCTGCGGACGGAAGTGTTGG + Intergenic
1106584971 13:31048984-31049006 GCACTGGAGGGAGGAAGTGTTGG + Intergenic
1108121788 13:47195658-47195680 GGACATGAGGCAGAAAGTGTTGG + Intergenic
1108674991 13:52728835-52728857 CCCCATGGGGTAGGAAGTGTGGG + Intronic
1113379400 13:109787679-109787701 GCCCCTGTGGAAGGAAGGGGGGG - Intergenic
1113816189 13:113172826-113172848 GACCCTGAGGCATGAAGAGGTGG - Intergenic
1114713935 14:24805040-24805062 GCCTCTGAGGCAGGCAGGGTGGG + Intergenic
1117860747 14:60090668-60090690 GCTCCAGAGTCAGGAAGTCTGGG - Intergenic
1118468350 14:66052309-66052331 GGCCCTGAGGCAAGAAGGGAGGG - Intergenic
1118719509 14:68584102-68584124 GACCCTGAGGCACGAGGTGTTGG - Intronic
1119861728 14:77940838-77940860 GCCTCAGAGACAGGCAGTGTGGG - Intergenic
1120007920 14:79380931-79380953 CTCCTTGAGGCTGGAAGTGTGGG + Intronic
1120541670 14:85758906-85758928 GGCCCTGAGCCAGGCAATGTAGG - Intergenic
1122278160 14:100605789-100605811 GCCCCAGAGGCAGGAAGGGGCGG - Intergenic
1122753202 14:103955008-103955030 TCCCTTGAGTCAGGAAGTGGAGG - Intronic
1122857625 14:104567436-104567458 GCCCCTGGGGTAGGAAGGGCCGG + Intronic
1123063948 14:105606792-105606814 GCCCCTCAGACAGGAAGGGGTGG - Intergenic
1123073262 14:105652435-105652457 GCCCCTCAGACAGGAAGGGGTGG - Intergenic
1123774622 15:23566232-23566254 GCCCCCGACTCAGGAAGTGGCGG + Exonic
1123936203 15:25195316-25195338 GCCCATGAGCCAGGCTGTGTGGG + Intergenic
1124648535 15:31457823-31457845 GCCCCTGCGGCAGGCAGGGCAGG - Intergenic
1125896789 15:43309197-43309219 GGCCCTGAGGCAGGAAGTGGGGG + Intergenic
1127392998 15:58522016-58522038 GCACCTGGGGCAGGTAGAGTTGG + Intronic
1128746715 15:70119963-70119985 CCCCCTCAGGCAGGAAGGGATGG + Intergenic
1128772749 15:70294651-70294673 GGCCCTGGGGCGGGAAGGGTTGG + Intergenic
1129384434 15:75188176-75188198 GCTCCTGAGGCTGGGAGGGTAGG - Intergenic
1129759988 15:78123781-78123803 GCCTCTGAGGAAGAAAGTCTGGG - Intronic
1129787350 15:78318705-78318727 GCCCCAGAGGCAGGAACCTTGGG + Intergenic
1130045805 15:80443678-80443700 GGGCCTGAGGCAGGAGGTGAAGG + Intronic
1131562879 15:93459557-93459579 GTCACTGAGCCAGGAAGTGGTGG + Intergenic
1132613961 16:831363-831385 GCCCCTGAGCCTGGGAGTGTAGG + Intergenic
1132945302 16:2528902-2528924 GTCCCTGAGACAGGGAGTGCTGG + Intronic
1133155690 16:3873957-3873979 GCCCCTGGGGAGGGAAGTGCTGG + Intronic
1134527837 16:14957956-14957978 GCCACAGAGGCAGAAAGTATGGG + Intergenic
1138395798 16:56703766-56703788 GGCCTTGAGGCAGGAATTCTTGG - Intronic
1138556669 16:57775017-57775039 GACCCTGATGCAGGGAGAGTGGG + Intronic
1139709995 16:68768861-68768883 GGCCCTGAGGCAGAGAGTGTTGG - Intronic
1140141177 16:72259366-72259388 GGCCTAGAGGTAGGAAGTGTGGG + Intergenic
1141113794 16:81291515-81291537 GCCCCTGAGCCAGGTAGTGATGG + Intergenic
1141714643 16:85719767-85719789 GGCCCTGAGGCAGGAACAGAGGG + Intronic
1141714665 16:85719861-85719883 GGCCCTGAGGCAGGAACAGAGGG + Intronic
1141714676 16:85719908-85719930 GGCCCTGAGGCAGGAACAGAGGG + Intronic
1141784376 16:86188856-86188878 CCCTCTAAAGCAGGAAGTGTGGG - Intergenic
1142202995 16:88770018-88770040 GCCCCTGAGAGAGGAAGTGAGGG + Intronic
1142207434 16:88790826-88790848 GCCACAGAGGCAGGCAGTGATGG - Intergenic
1142638471 17:1271639-1271661 GGCTTTGAGGCAGGAGGTGTGGG + Intergenic
1142997299 17:3768514-3768536 GGGCCTGAGGCAGGAAATGCTGG - Intronic
1143325053 17:6093226-6093248 GCCGCTAAAGAAGGAAGTGTTGG - Intronic
1143349541 17:6277343-6277365 GCCCTGGAGGCAGGGGGTGTGGG - Intergenic
1143499799 17:7332018-7332040 GCACCTGTGGTAGGGAGTGTTGG - Intergenic
1143742891 17:8966681-8966703 GCCCCTGGGGAAGGGAGTGAGGG + Intergenic
1144779517 17:17800804-17800826 GCCACTGAGGCAGGAAGGGGTGG - Intronic
1145924091 17:28633032-28633054 GCACCTCAGGCAGGAACTCTGGG + Exonic
1146634298 17:34492699-34492721 GCCCCTGGTGCAGGAAATGGAGG + Intergenic
1148940780 17:51209373-51209395 GGCCCTGGAGCAGGAAGTGGTGG - Intronic
1149558832 17:57593837-57593859 GCCCCACAGGCTGGAAGTGAGGG + Intronic
1150235622 17:63590622-63590644 GCCCTTGGGGCAGGCAGTTTGGG + Exonic
1151633758 17:75329352-75329374 TCCCCAGAGGCAGCACGTGTTGG + Intronic
1151645911 17:75431584-75431606 GCTACTGAGGCAGTAGGTGTGGG - Intergenic
1152307326 17:79528922-79528944 GGCCCTGAAGCAGGAACTGAGGG - Intergenic
1152595174 17:81234340-81234362 GCACCTGGGGCAGGGAGAGTGGG - Intronic
1153207198 18:2716519-2716541 GCCCCTGAGGCAGGTAGGGAGGG + Intronic
1153265106 18:3262126-3262148 CCCCTTCAGGCAGGAAGTGTCGG + Intronic
1154198254 18:12281672-12281694 GCCCCTGGGGCATGAAGTGGGGG - Intergenic
1155834981 18:30569649-30569671 GCCCCAGATGCAGAAAGTGCAGG + Intergenic
1157167171 18:45368509-45368531 CCCAATGTGGCAGGAAGTGTGGG - Intronic
1158139448 18:54241667-54241689 GCCTCAGGGGGAGGAAGTGTGGG + Intergenic
1159461368 18:68725562-68725584 GGCCATGAGTCAGGAAATGTAGG - Intronic
1159891727 18:73959249-73959271 CCTCCTGAGGCAGGAGGTGCAGG - Intergenic
1159975875 18:74711492-74711514 GGCCATGAGCCAGCAAGTGTGGG + Intronic
1160875610 19:1295071-1295093 GACACTGAGGCAGGAGGTGGGGG + Intronic
1160949282 19:1657913-1657935 GCCCCTGAGTCAGGAGCTGTGGG - Intergenic
1161647398 19:5461961-5461983 GCCAGTGAGGCAGGAGGTTTGGG - Intergenic
1162112048 19:8404635-8404657 GCCCCTGTGGCAGGGAGGGATGG + Intronic
1162395560 19:10416606-10416628 GCCCCCGCGGGAGGAAGGGTGGG + Intronic
1163985295 19:20941276-20941298 CCACCTGGGGCAGGAAGAGTGGG - Intronic
1165938260 19:39402786-39402808 TCCCCCTAGGCCGGAAGTGTTGG + Intergenic
1165958913 19:39518662-39518684 GAGCCTGAGGCAGGAAGACTGGG + Intronic
1166145660 19:40833147-40833169 GGTCCTGAGGGAGGAAGTTTGGG + Intronic
1166149769 19:40864049-40864071 GGTCCTGAGGGAGGAAGTTTGGG + Intronic
1166155685 19:40909534-40909556 GTCTCTGAGACAGGAAGTTTGGG + Intergenic
1166996296 19:46721181-46721203 GGTCCTGAGGCAGGAGGTGGGGG + Intronic
1167006965 19:46782525-46782547 GCCCGTGGGGCAGGAGGTGGAGG - Exonic
1167387259 19:49171338-49171360 GTCCCTGAGGCAAGAAGAGAAGG - Exonic
1167473798 19:49689104-49689126 GGCCCTGAGGGTGGAAGGGTGGG - Exonic
1167494937 19:49812142-49812164 GGTTCTGAGGAAGGAAGTGTTGG + Intronic
1168061641 19:53896213-53896235 GGCCTAGAGGCAGGGAGTGTAGG + Intronic
1168291493 19:55359725-55359747 GCCCCTGGGGATGGAAGAGTAGG + Exonic
925408525 2:3625327-3625349 GAGCCTGAGGCAGGATGTGCAGG + Intronic
926052613 2:9754366-9754388 GCCCGTGAGGTAGGAGGTGTTGG - Intergenic
926162666 2:10499860-10499882 GACCCTGAAGAAGGAAGTGAAGG + Intergenic
926673743 2:15601456-15601478 GAACCTGAGGAAGGAATTGTAGG - Intronic
926738623 2:16093300-16093322 GCCCCTGAGGGAGGCAGAGGTGG - Intergenic
933157886 2:78994232-78994254 TCCCCTGAGGCCGGAAGAGGAGG - Intergenic
934852637 2:97711221-97711243 GCCTCTGGGACAGGAAGTGGGGG + Intergenic
935322012 2:101898320-101898342 GCCCTTGAGGCAGGCTTTGTTGG + Intergenic
936507446 2:113118747-113118769 GCCCCTGAGGCTGGGCGTGGTGG + Intronic
938766407 2:134463066-134463088 GCCCTTGGGGTAGGCAGTGTGGG - Intronic
939467849 2:142581310-142581332 GCCCCTCAGGAATGAAGTTTTGG + Intergenic
941289527 2:163658285-163658307 GCCCCGGAGGCCAGATGTGTTGG - Intronic
942036220 2:172013262-172013284 GCCTCTGAGGCAGGAGGGGGTGG - Intronic
945190918 2:207186598-207186620 GCCACTGAGGGAGGAAATGCAGG + Intergenic
948171409 2:235906406-235906428 ACCCCTGAGGACGGAAGTCTTGG - Intronic
948181097 2:235981159-235981181 GGCCCCGAGGCAGCATGTGTTGG - Intronic
1169137979 20:3209306-3209328 GTCCCTTAGGCAGGAGGGGTGGG + Intronic
1169152872 20:3304295-3304317 GCCACTGAGGCAGGCAGGGAGGG - Intronic
1169729084 20:8767216-8767238 GCCCCTGAGGCAGAAACTCTAGG - Intronic
1170263518 20:14439869-14439891 GTCCCAGAGGCAGGAAGTCATGG + Intronic
1170688075 20:18587521-18587543 GCCACTGAGGCAGGAAGACAAGG + Intronic
1171291890 20:23987132-23987154 GGCCCTGAGGCAGGTGGTATAGG + Intronic
1171417481 20:24992816-24992838 GCCCATGAGGCCGGAAGGGGCGG - Exonic
1172226478 20:33308331-33308353 GGCCCTGAGGCAGGGATTGTTGG + Intronic
1172357810 20:34292051-34292073 GGCCCTGAGGCAGGAATGGCTGG - Intronic
1172750211 20:37245473-37245495 GCCCCTGAGGAAGGCAGGGCAGG - Intergenic
1173199543 20:40944410-40944432 GGCACTGAGGCAGGAAGAGGAGG + Intergenic
1173694415 20:44996340-44996362 GCCCCTGAGGAAGGCAGGGTTGG - Intronic
1173747163 20:45446624-45446646 AGCCCTGAGGAGGGAAGTGTGGG - Intergenic
1174395174 20:50242844-50242866 GCCCCTGAGGAAGGAAGACATGG + Intergenic
1175319421 20:58074808-58074830 GCCACACAGGCAGGAAGTGCTGG - Intergenic
1175382707 20:58574817-58574839 CCCCACGAGGGAGGAAGTGTAGG + Intergenic
1175405628 20:58724227-58724249 GACCCTGATGCTGGAATTGTCGG + Intergenic
1175613559 20:60372855-60372877 GCTTCTGTGGCAGGAACTGTGGG + Intergenic
1176043979 20:63083003-63083025 GCCCGTGAGGCAGGTGGTCTGGG + Intergenic
1176140438 20:63542557-63542579 GGCCCCGAGGCAGGACGTGTGGG - Exonic
1177668857 21:24199058-24199080 TCCCTTGAGGCAGGAAGTAGAGG - Intergenic
1178419951 21:32435397-32435419 GCTACTGAGGCAGGAACTGTGGG - Intronic
1179423697 21:41255756-41255778 GCCCCTTAGGTAGGAATTTTGGG - Intronic
1179825102 21:43959938-43959960 GGCTCTCAGGCAGGAAGTGAGGG + Intronic
1180147790 21:45930896-45930918 GCCCCAGTGGGAGGAGGTGTGGG + Intronic
1180765507 22:18343974-18343996 GGCCCTGAGGCAGGTGGTATAGG - Intergenic
1181199707 22:21210055-21210077 GGCCCTGAGGCAGGTGGTATAGG + Intronic
1181400055 22:22645803-22645825 GGCCCTGAGGCAGGTGGTATAGG - Intronic
1181649309 22:24249987-24250009 GGCCCTGAGGCAGGTGGTATAGG + Intergenic
1181667396 22:24407539-24407561 GCGGCTGCGGCAGGAAGTGAAGG + Intronic
1181702029 22:24626901-24626923 GGCCCTGAGGCAGGTGGTATAGG - Intronic
1181978238 22:26747730-26747752 GGCTCTGAGGCAGGACGTGCTGG + Intergenic
1182237051 22:28883993-28884015 GCCCGTGAGGCCGGTGGTGTAGG - Exonic
1182961144 22:34476393-34476415 GTCCCTGTGGCTGGAAGTGCAGG + Intergenic
1183060053 22:35330799-35330821 GCCCCAGAACCAGGAAGTGGTGG - Intronic
1183263315 22:36810402-36810424 CCCCCTAACGCAGGAAGGGTGGG - Intronic
1183300353 22:37056126-37056148 GCCCCTTCCACAGGAAGTGTGGG + Intronic
1183604933 22:38862758-38862780 GCCCCTGAGCCAGGAGGTCCTGG - Exonic
1184208799 22:43023272-43023294 CCCCTTGGGGCAGGGAGTGTGGG - Intergenic
1184880471 22:47301063-47301085 GCCACTGAGGAAGGACCTGTGGG - Intergenic
1203263623 22_KI270734v1_random:1407-1429 GGCCCTGAGGCAGGTGGTATAGG + Intergenic
949943600 3:9173154-9173176 GCCGCTGAAGCAGGGAGTGTGGG - Intronic
950398240 3:12750491-12750513 GCAGCTGAGCCAGGAAGTGCAGG + Intronic
950670364 3:14522110-14522132 GTCCCTGAGGCAGGAGTTGGGGG - Intronic
950702452 3:14759747-14759769 GCCCCTGGAGCAGGAGGAGTTGG + Intronic
950702893 3:14762232-14762254 GCCCCTGTAGCAGGAAATGCTGG + Intronic
952866312 3:37857546-37857568 GCCCCTGAGGAAGGAACATTGGG - Intergenic
953694429 3:45146472-45146494 GTCGCTGAGGCAGGAAGAGGAGG - Intergenic
953847447 3:46439027-46439049 GCCTCTGAGCCAGGCAGTGATGG + Intronic
953982542 3:47419878-47419900 GCCCCTCCAGCAGCAAGTGTTGG - Intronic
954444815 3:50540912-50540934 GCCCCTGCGTCAGGGAGGGTGGG - Intergenic
954852448 3:53615213-53615235 ACCCCTGAGGAAGGAAGGTTTGG - Intronic
956184202 3:66547021-66547043 GGTGCTGAGGCAGGAAGTGGTGG - Intergenic
958985416 3:100775215-100775237 TCTCCAGAGGCAGGAACTGTTGG + Exonic
961133907 3:124492902-124492924 GCCTGTGAGGCAGGCAGTGCTGG - Intronic
961326487 3:126112288-126112310 GCCCCTGTGGCAGGTAGGCTTGG - Intronic
961884053 3:130084115-130084137 GCTACTGAGGTAGGAACTGTGGG + Intronic
963851834 3:150217261-150217283 GCCCATGAGGGAGGCAGTATTGG + Intergenic
964624208 3:158743765-158743787 TCCCCTGAGGTATGAAGAGTTGG - Intronic
964636338 3:158861445-158861467 GCCTCTGAGGCAGTGATTGTTGG + Intergenic
968950397 4:3688518-3688540 GGCCCTGAGGGAGGAGGTGCAGG + Intergenic
969805583 4:9605868-9605890 GTCCCAGGAGCAGGAAGTGTCGG + Intergenic
969820723 4:9718176-9718198 GCTACTGAGGCCGGAACTGTGGG - Intergenic
969918292 4:10511520-10511542 GGCCCTGAGGAAGGAGGTGGAGG - Intronic
970687306 4:18583194-18583216 TCCCCTGAGGCAGGTAGTGTAGG - Intergenic
974099858 4:57404810-57404832 GCAGCTAATGCAGGAAGTGTTGG + Intergenic
976929795 4:90551891-90551913 GCTCCAGAGGCTGGAAGTGCAGG + Intronic
980008083 4:127563819-127563841 GTTGCTGAGGCTGGAAGTGTTGG - Intergenic
980931406 4:139186299-139186321 TCACCTGAGTCAGGAAGTGGAGG + Intergenic
982089110 4:151865086-151865108 GCCTCTGAGGAAGGAAATCTGGG - Intergenic
982165653 4:152611608-152611630 CCCCCTGAGGAAGTAAGTGATGG - Intergenic
983310982 4:166061129-166061151 GCCACTGAAGCAGTAATTGTTGG + Intronic
985621945 5:960396-960418 ACCCCAGGGGCAGGAAGTGCTGG - Intergenic
985725758 5:1515070-1515092 TCCCCTGATGCAGGATGTGCTGG - Intronic
985725781 5:1515166-1515188 TCCCCTGATGCAGGATGTGCTGG - Intronic
985725805 5:1515262-1515284 TCCCCTGATGCAGGATGTGCTGG - Intronic
987904595 5:24059617-24059639 CCCCATGAGGCTGTAAGTGTGGG - Intronic
988051844 5:26041560-26041582 GCTGCTTAGGCAGGCAGTGTAGG - Intergenic
990734514 5:58845313-58845335 GCGCCACAGCCAGGAAGTGTGGG + Intronic
995848728 5:116522149-116522171 GTCTCTGAGGGAGGAGGTGTAGG + Intronic
997292691 5:132748636-132748658 GACCCTGAGACAGCCAGTGTAGG - Intronic
997975586 5:138439764-138439786 GCCCCCTAGGGAGGAAGTCTGGG + Intronic
997977937 5:138451143-138451165 ACCCCTGAGGCAGCAAGGGATGG + Intergenic
998486732 5:142509529-142509551 GCCCCTGGTGCTGGAAGAGTTGG + Intergenic
999118211 5:149183642-149183664 GCCCCTGAGGCATGACCTGATGG - Intronic
1000793339 5:165633666-165633688 GACCCTGAGGCAGGAAGATCAGG - Intergenic
1001297183 5:170506241-170506263 GTCCCAGAGGCAGGGAGTGATGG - Intronic
1001772383 5:174305994-174306016 GACTCTGAGGCAGAAAGTCTGGG + Intergenic
1002079126 5:176727317-176727339 GCCCCGGAGGCAGGGAGTAGGGG + Intergenic
1006081923 6:31572790-31572812 GCCCCAGAAGGAGGAGGTGTAGG - Exonic
1006302390 6:33200437-33200459 GCCGCTGAGGGAGGAAGGGCGGG + Exonic
1006321454 6:33321938-33321960 CCCCCGGAGGGAGGAAGTGGTGG + Exonic
1006944903 6:37778604-37778626 GCCCCTGAAGCAGGTGGTGAGGG - Intergenic
1007495892 6:42260163-42260185 ACCTGTGAGGCAGGAAGTGGGGG + Intronic
1007690265 6:43696482-43696504 TCCCCTGTGGCAGGCAGTTTTGG - Intergenic
1007695141 6:43727251-43727273 GGCCCTGTGCTAGGAAGTGTGGG - Intergenic
1007706368 6:43793782-43793804 GCCCCTGAGGCTGGGACTGGTGG + Intergenic
1008513364 6:52297592-52297614 GCCCCTGGAGGAGGAAGTGCTGG - Intergenic
1008801852 6:55378130-55378152 GCCACTGAAGCACGAAATGTGGG - Intronic
1010153392 6:72763270-72763292 GCCCCACAGGCAGGATGTGTTGG + Intronic
1010493230 6:76499829-76499851 GCCCCTGAAGCTGGAAATCTTGG + Intergenic
1011429186 6:87267150-87267172 GCTCCTGAGGCAGTGAGTGGGGG - Intergenic
1013128285 6:107206946-107206968 GCCACTGTGGCAGGTAGTATGGG + Intronic
1015038990 6:128693434-128693456 GTAGCTGAGGCAGGAAGTGATGG - Intergenic
1017118019 6:150996991-150997013 GCCCCTGAGGTAGTGAGTCTGGG - Intronic
1017253027 6:152302174-152302196 GCCCGGGAGGCAGGATGTGTAGG + Intronic
1018898674 6:168039503-168039525 GCCCCGGAGGCAGCAAGGGAAGG + Intronic
1018903989 6:168064669-168064691 CCCCCAAAGGCAGGCAGTGTGGG - Intronic
1019062374 6:169265682-169265704 GCACTTGAGGAAGGAAGTGCAGG + Intergenic
1019510902 7:1416812-1416834 GCCACTGAGGCTGGAAATGAGGG - Intergenic
1021692375 7:23243077-23243099 GCCAATGAGACAGGAAATGTGGG + Intronic
1022503231 7:30895449-30895471 GCCCCAGAGGCAGGAAGCAGGGG - Intergenic
1023401302 7:39794170-39794192 GCCACTGAGGCAGGAGGAGCTGG - Intergenic
1023827395 7:44018823-44018845 GCCCCGGACACAGGAAGTGGCGG - Intergenic
1023991824 7:45133158-45133180 GCCCCAGAGGCAAGGAATGTAGG + Intergenic
1024117751 7:46209433-46209455 GCCCTGGAGGCTGGAAGTCTGGG + Intergenic
1024232616 7:47374172-47374194 GCCCATGAAGCAGGAAGCATGGG + Intronic
1024476400 7:49816527-49816549 GTCCCAGAGGCAGGAAGAATGGG + Intronic
1025937422 7:66048381-66048403 GACCATGAGCCAAGAAGTGTAGG + Intergenic
1026113803 7:67479450-67479472 GCCCGGGAAGCAGGAAGTGGAGG - Intergenic
1026969567 7:74459811-74459833 GCCCCAGAGGCAGCAGTTGTAGG - Intronic
1029457327 7:100677854-100677876 GCCCCTGAGGCAGGAAGTGTGGG - Intronic
1029582739 7:101448114-101448136 ACCCCTGGGGCAGGCAGAGTTGG + Intronic
1029738551 7:102478570-102478592 GCCCCGGACACAGGAAGTGGCGG - Intronic
1029755681 7:102572234-102572256 GCCCCGGACACAGGAAGTGGCGG - Intronic
1029773630 7:102671314-102671336 GCCCCGGACACAGGAAGTGGCGG - Intronic
1030398585 7:109019382-109019404 GCCCAAGAGGCTGGAGGTGTGGG + Intergenic
1033555194 7:142482838-142482860 GCCCCTGACCCAGGACCTGTTGG - Intergenic
1034472781 7:151264550-151264572 GCACCTGGGGTAGGAACTGTGGG + Intronic
1035115221 7:156518109-156518131 GCCCATGAGGGAGGCTGTGTGGG + Intergenic
1035255186 7:157621329-157621351 GCCCCGGGGGCAGGAAGCCTGGG - Intronic
1035461636 7:159042823-159042845 GGCACTGAGGCAGGGAGGGTGGG - Intronic
1035488804 7:159253857-159253879 GAGCCTAAGGAAGGAAGTGTGGG + Intergenic
1035731678 8:1858067-1858089 GCCCCTGAGACAGGAGGTGCTGG + Exonic
1035735447 8:1883941-1883963 GCCCCTGAGCCAGGATTTGCAGG + Intronic
1036729238 8:11247380-11247402 GCCCCTGAGGCAGGCAATGAGGG + Intergenic
1037836509 8:22217790-22217812 GGCCTTGAGTCAGGCAGTGTTGG + Intergenic
1038066602 8:23969897-23969919 GCCACTGAGGAAGGCATTGTTGG + Intergenic
1039269284 8:35863332-35863354 TCCCCTGGGGCAGGAAGGGGCGG - Intergenic
1040507902 8:48068084-48068106 GCCCCTGCGGCAAGACGTGCAGG - Intergenic
1045651763 8:104348018-104348040 GTCCATGAGCCAGGAAATGTAGG + Intronic
1046939895 8:119920868-119920890 GCCCCTGAAGCAGCAAATGAGGG - Intronic
1047331733 8:123895467-123895489 CCCCATGAGGAAGGAACTGTTGG + Intronic
1048842684 8:138579251-138579273 GCCCCTGAGGCAGGTATGCTGGG + Intergenic
1049269670 8:141687626-141687648 GTCACTCAGCCAGGAAGTGTGGG - Intergenic
1049361672 8:142214986-142215008 GCCCCTGAGGTGGGAAGCGCTGG - Intronic
1049365089 8:142233240-142233262 GCCCGTGAGGCACGAAGAGCTGG + Intronic
1049528552 8:143142146-143142168 ACCCCTGAGGCTGGAAGAGGCGG + Intergenic
1049791703 8:144475328-144475350 GCCCCTGAGCCCGGTAGTGGGGG - Intronic
1050125531 9:2352998-2353020 GGCCGTGAGGCAAGAAATGTGGG - Intergenic
1051747137 9:20305846-20305868 GTCCCAGAGGCTGGAAGTCTGGG + Intergenic
1053463061 9:38285422-38285444 GGCCCTGGGGCAGGACGTGCTGG - Intergenic
1053678060 9:40458197-40458219 ATTCCTGAGGCAGGAAGTCTGGG - Intergenic
1054285672 9:63166743-63166765 ATTCCTGAGGCAGGAAGTCTGGG + Intergenic
1054291132 9:63293734-63293756 ATTCCTGAGGCAGGAAGTCTGGG - Intergenic
1054389151 9:64598269-64598291 ATTCCTGAGGCAGGAAGTCTGGG - Intergenic
1054506565 9:65918101-65918123 ATTCCTGAGGCAGGAAGTCTGGG + Intergenic
1055247458 9:74264304-74264326 GCACTTGAGGTAGCAAGTGTGGG + Intergenic
1056795563 9:89656422-89656444 GCCCAAGAGGAAGGAAGTGGTGG - Intergenic
1056931425 9:90880992-90881014 ACCCAAGAGGCAGGAAGTGGGGG + Intronic
1057190223 9:93083157-93083179 GCTCAAGAGGCAGGAAGTGGTGG + Intronic
1059407772 9:114112556-114112578 GCCCCTCAGGCAGGGCTTGTAGG - Intergenic
1060102884 9:120856119-120856141 GCCCCTGTGGCAGCAGCTGTGGG + Exonic
1060601419 9:124880711-124880733 GAGCCAGAGGCAGGATGTGTGGG - Intronic
1060802986 9:126556625-126556647 GGCCCAGAGCCAGGAAGTGGTGG - Intergenic
1061953613 9:133950066-133950088 GCCCCTGAGCCATGAGGAGTGGG + Intronic
1062235036 9:135503739-135503761 GCCCCTGAAGTAGCGAGTGTGGG - Exonic
1062598826 9:137311108-137311130 GGCCCTGGGGCTGGAGGTGTTGG + Intronic
1062601048 9:137318721-137318743 GCCCCTGAGCCAGGCAGGGAGGG - Intronic
1203655319 Un_KI270752v1:18414-18436 ATCCATGAGGCAGGCAGTGTTGG + Intergenic
1186607865 X:11110577-11110599 TCCCCTGGTGCAGAAAGTGTTGG - Intergenic
1187125985 X:16454821-16454843 GCCCCAGAGTCAGGAGTTGTTGG - Intergenic
1187552092 X:20316255-20316277 ACCCCAGTGGCAGGAAATGTTGG + Intergenic
1189636343 X:43014327-43014349 GACTCTGAGGAAGAAAGTGTGGG - Intergenic
1190282808 X:48942066-48942088 GCCCCAGTGGGAGGAAGGGTCGG + Intronic
1190951003 X:55142796-55142818 ACCCCTGAGGTAGGTGGTGTGGG - Intronic
1191170090 X:57436424-57436446 GTCACTGAAACAGGAAGTGTTGG + Intronic
1191958420 X:66672322-66672344 GAGCCTGAGGCAGGAAGTGTGGG - Intergenic
1195397413 X:104426222-104426244 GCAGCAGAGGCAGGAAATGTAGG - Intergenic
1196613387 X:117739508-117739530 GTCCCTGAGGCAGAGAGTATAGG - Intergenic
1196867079 X:120079848-120079870 GGCCCTGTGGCAAGAAATGTGGG + Intergenic
1196876020 X:120156434-120156456 GGCCCTGTGGCAAGAAATGTGGG - Intergenic
1198142567 X:133819261-133819283 GCCCCTGACGCCGTAAGTGTTGG - Intronic
1198920767 X:141723641-141723663 GGCCATGAGCCAGGAAATGTGGG + Intergenic
1200045391 X:153398179-153398201 GCAGGTGAGGCAGGAGGTGTAGG - Intergenic
1200045402 X:153398233-153398255 GCAGGTGAGGCAGGAGGTGTAGG - Intergenic
1200045424 X:153398341-153398363 GCAGGTGAGGCAGGAGGTGTAGG - Intergenic
1200045445 X:153398449-153398471 GCAGGTGAGGCAGGAGGTGTAGG - Intergenic
1200366219 X:155667499-155667521 GGCACAGAGGCAGAAAGTGTAGG + Intronic
1201574203 Y:15444738-15444760 AACCCTAAGGCAGGAAGAGTAGG - Intergenic