ID: 1029459064

View in Genome Browser
Species Human (GRCh38)
Location 7:100685110-100685132
Sequence ATCCAGCTGAGTCCCGGGGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 3, 3: 8, 4: 100}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029459064_1029459078 24 Left 1029459064 7:100685110-100685132 CCCACCCCGGGACTCAGCTGGAT 0: 1
1: 0
2: 3
3: 8
4: 100
Right 1029459078 7:100685157-100685179 TGAGATAGGAGGTGGAAAGAAGG 0: 1
1: 0
2: 5
3: 61
4: 613
1029459064_1029459069 -5 Left 1029459064 7:100685110-100685132 CCCACCCCGGGACTCAGCTGGAT 0: 1
1: 0
2: 3
3: 8
4: 100
Right 1029459069 7:100685128-100685150 TGGATCCCCCGAATATCATCTGG 0: 1
1: 0
2: 0
3: 4
4: 39
1029459064_1029459080 28 Left 1029459064 7:100685110-100685132 CCCACCCCGGGACTCAGCTGGAT 0: 1
1: 0
2: 3
3: 8
4: 100
Right 1029459080 7:100685161-100685183 ATAGGAGGTGGAAAGAAGGGCGG 0: 1
1: 0
2: 7
3: 72
4: 774
1029459064_1029459077 16 Left 1029459064 7:100685110-100685132 CCCACCCCGGGACTCAGCTGGAT 0: 1
1: 0
2: 3
3: 8
4: 100
Right 1029459077 7:100685149-100685171 GGAAGGCATGAGATAGGAGGTGG 0: 1
1: 0
2: 9
3: 62
4: 588
1029459064_1029459082 30 Left 1029459064 7:100685110-100685132 CCCACCCCGGGACTCAGCTGGAT 0: 1
1: 0
2: 3
3: 8
4: 100
Right 1029459082 7:100685163-100685185 AGGAGGTGGAAAGAAGGGCGGGG 0: 1
1: 0
2: 3
3: 65
4: 794
1029459064_1029459081 29 Left 1029459064 7:100685110-100685132 CCCACCCCGGGACTCAGCTGGAT 0: 1
1: 0
2: 3
3: 8
4: 100
Right 1029459081 7:100685162-100685184 TAGGAGGTGGAAAGAAGGGCGGG 0: 1
1: 1
2: 2
3: 49
4: 566
1029459064_1029459070 -1 Left 1029459064 7:100685110-100685132 CCCACCCCGGGACTCAGCTGGAT 0: 1
1: 0
2: 3
3: 8
4: 100
Right 1029459070 7:100685132-100685154 TCCCCCGAATATCATCTGGAAGG 0: 1
1: 0
2: 1
3: 3
4: 58
1029459064_1029459079 25 Left 1029459064 7:100685110-100685132 CCCACCCCGGGACTCAGCTGGAT 0: 1
1: 0
2: 3
3: 8
4: 100
Right 1029459079 7:100685158-100685180 GAGATAGGAGGTGGAAAGAAGGG 0: 1
1: 2
2: 2
3: 96
4: 790
1029459064_1029459076 13 Left 1029459064 7:100685110-100685132 CCCACCCCGGGACTCAGCTGGAT 0: 1
1: 0
2: 3
3: 8
4: 100
Right 1029459076 7:100685146-100685168 TCTGGAAGGCATGAGATAGGAGG 0: 1
1: 0
2: 1
3: 25
4: 337
1029459064_1029459075 10 Left 1029459064 7:100685110-100685132 CCCACCCCGGGACTCAGCTGGAT 0: 1
1: 0
2: 3
3: 8
4: 100
Right 1029459075 7:100685143-100685165 TCATCTGGAAGGCATGAGATAGG 0: 1
1: 0
2: 0
3: 9
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029459064 Original CRISPR ATCCAGCTGAGTCCCGGGGT GGG (reversed) Exonic
900227913 1:1541280-1541302 TTCCTGCTGAGGCCGGGGGTCGG - Intergenic
901025594 1:6277228-6277250 AACCAGCTGAGTGCTGGGGTAGG + Intronic
906058721 1:42934882-42934904 ATCCAGATGAGACCCAGGGCAGG - Intronic
906372256 1:45264024-45264046 ATGCACCTGAGGCCCTGGGTAGG - Intronic
907326394 1:53641209-53641231 CTCCAGCTGAGTACCTGGGCTGG + Intronic
912511809 1:110194883-110194905 CTCCAGCTGTGTCCCAGTGTGGG - Intronic
922485825 1:225972455-225972477 ATGCTGCTGTGCCCCGGGGTGGG + Intergenic
924878926 1:248136915-248136937 CTCCATCTGAGTCCCTGGTTAGG + Intergenic
1062885185 10:1010917-1010939 CTCCACCAGAGTCTCGGGGTGGG - Intronic
1062885236 10:1011107-1011129 CTCCACCAGAGTCTCGGGGTGGG - Intronic
1064022820 10:11823435-11823457 GGACACCTGAGTCCCGGGGTAGG + Exonic
1067089586 10:43259805-43259827 ATCCAGCTGAGCCCCAAGGTGGG + Intronic
1068266115 10:54652278-54652300 CTCCAGCTGAGTCTCAGGATTGG - Intronic
1073031481 10:100529590-100529612 ATCCTGCGAAGTCCCGGGCTCGG - Intronic
1073327614 10:102651521-102651543 ATTCAGGTGAGTCCCAGGGGAGG - Intronic
1075092699 10:119452495-119452517 ATGCAGGTGAGTCCAGGGGAGGG - Intronic
1082865869 11:57899680-57899702 ATACAGCTGATACCCTGGGTTGG - Intergenic
1084554470 11:69867766-69867788 ATCCAGCTGAGTCCCTGGCCTGG - Intergenic
1092387946 12:8050586-8050608 ATCCTGCTGAGTCCTGGGTGGGG - Exonic
1101412877 12:104483808-104483830 ACCCAGGTGAGGCCTGGGGTCGG + Intronic
1102519126 12:113468110-113468132 ATCCAGGTGCGGCCCGGGGCGGG - Exonic
1103991608 12:124803158-124803180 AACCAGCTGAGCTCCGGGGCTGG + Intronic
1104676247 12:130714373-130714395 AGCCTGCAGAGTCCGGGGGTGGG - Intronic
1106565790 13:30883534-30883556 ATCCTGCTGCCTCCCTGGGTGGG - Intergenic
1109190238 13:59314524-59314546 ATCGAGCTCAGACCTGGGGTAGG - Intergenic
1113738434 13:112694322-112694344 ACATAGCTGAGTCCCTGGGTAGG + Intronic
1117517492 14:56516454-56516476 TTCCAGCAGAGTCTTGGGGTCGG - Intronic
1119409638 14:74422370-74422392 TGCCAGCTGAGTCCCGGAGAAGG + Intronic
1122743723 14:103886146-103886168 AGCCAGCTCAGTGCCGGGGCTGG - Intergenic
1123188042 14:106538749-106538771 ATCCAGCTTTGTCCTGGAGTTGG - Intergenic
1123190272 14:106562675-106562697 GTCCAGCTGTGTCCTGGGGTTGG - Intergenic
1123961182 15:25402537-25402559 ATCCAGCTTGGTGCTGGGGTGGG + Intronic
1128612383 15:69084482-69084504 GTCAAGCTGAGTCCCAGGGAGGG + Intergenic
1129539980 15:76341324-76341346 AACCCGCAGAGTCCCGAGGTCGG - Intronic
1132629506 16:910347-910369 TCCCTGCTGAGCCCCGGGGTGGG - Intronic
1132897585 16:2236357-2236379 ACCCAGCTGAGTCGAGGGGGCGG + Exonic
1135884770 16:26295846-26295868 GTGCAGCTGAGTGCTGGGGTCGG + Intergenic
1136869936 16:33797740-33797762 ATCCAGCTTTGTCCTGGAGTTGG + Intergenic
1138096155 16:54213568-54213590 ATCCAGGAGAGTCTGGGGGTGGG + Intergenic
1203102235 16_KI270728v1_random:1318314-1318336 ATCCAGCTTTGTCCTGGAGTTGG - Intergenic
1145286098 17:21506845-21506867 CTCCTGCTGGGTCCCAGGGTGGG - Intergenic
1145391505 17:22459446-22459468 CTCCTGCTGGGTCCCAGGGTGGG + Intergenic
1145754835 17:27382772-27382794 ATCCAGCTTGGTCCTGGGCTGGG + Intergenic
1147429118 17:40361055-40361077 ATCCAGCTCTGTCTTGGGGTGGG + Exonic
1147647041 17:42040197-42040219 GTCCAGCGAAGGCCCGGGGTAGG + Intronic
1151678762 17:75613394-75613416 CTCCAGCTGGGTCGGGGGGTGGG - Intergenic
1152653867 17:81510910-81510932 ATCAAGGTGAGTCGAGGGGTTGG - Exonic
1153660890 18:7325297-7325319 ATACAGCTGAGTCCTGGAGGCGG - Intergenic
1156495401 18:37522378-37522400 CTCCAGCTGGGTCCTGGGCTGGG - Intronic
1157831687 18:50862064-50862086 ATCCAGAAGAGTCCCGGGCCAGG + Intergenic
1160868290 19:1265765-1265787 TCCCAGCTGAGTCCAGGGCTGGG - Intronic
1161014505 19:1977095-1977117 ATCCAGCTGGGTCACCGTGTTGG - Intronic
1161029373 19:2050784-2050806 TTCAAGGTGAGGCCCGGGGTCGG - Exonic
1165786440 19:38464629-38464651 AGCCAGCAGAGTCCTGGGGGTGG - Exonic
929950895 2:46408877-46408899 CTCCTGCTGGATCCCGGGGTTGG - Intergenic
931777931 2:65556169-65556191 AGCCAGCTCACTCCCGGGGGTGG + Intergenic
933707752 2:85304333-85304355 GTCCAGGTGAGTCCCGGGGCTGG + Exonic
938542308 2:132294334-132294356 CACCAGCTGGGTCCTGGGGTGGG + Intergenic
948665958 2:239535171-239535193 CTCCAGCTGAGACCAGAGGTGGG - Intergenic
948790459 2:240374066-240374088 GTCCACCTGGGTCCAGGGGTTGG - Intergenic
1171141722 20:22749385-22749407 CTCCATCTGAGTCCCGGGGTTGG - Intergenic
1171461990 20:25303202-25303224 TTCCAGCTGAGTTCCCAGGTTGG + Intronic
1171871189 20:30527177-30527199 CACCAGCTGGGTCCTGGGGTGGG + Intergenic
1171989436 20:31684492-31684514 ACCCAGCTGAGCCCAGGGGAAGG + Intronic
1172529410 20:35619500-35619522 GTCGAGCTGAGGCCCGGGCTGGG + Intronic
1175670726 20:60900692-60900714 GTGCAGCTGAGTCTCGGGGGGGG - Intergenic
1175992761 20:62797588-62797610 CTCCAGCTGAGACCCTGGGGAGG + Intronic
1176039616 20:63058454-63058476 ATCCAGCTGAGACACAGGGCTGG + Intergenic
1178466555 21:32853685-32853707 AACCACCTGAGTGCAGGGGTGGG - Intergenic
1179959848 21:44762068-44762090 GTCCAGCTGAGTTCCGGGGTTGG + Intergenic
1180864255 22:19106810-19106832 AGCCAGCAGAGCCCCTGGGTGGG + Intronic
1181902791 22:26169688-26169710 ATCCCGCGGAGTCCCGCGGCGGG - Exonic
1183055011 22:35299886-35299908 TGTCAGCTGATTCCCGGGGTTGG + Exonic
954701079 3:52451211-52451233 CTCCAGCTGAGTCCTGGGGTTGG - Exonic
954912397 3:54121387-54121409 TGCAAGCTGGGTCCCGGGGTGGG + Intergenic
955401957 3:58598469-58598491 CTCAAGCTGAGGCCCTGGGTGGG + Intronic
956458150 3:69444017-69444039 GTCCAGCTGAGTCCCTGGTATGG - Intronic
960882464 3:122358939-122358961 ATCAAGCTGAGTCCCAGGCTGGG - Intergenic
961193561 3:124982791-124982813 AGCCAGCTGTGTCCAGGGGATGG - Intronic
967971009 3:194999540-194999562 ATTCAGCTGAGACCCGGAGGAGG + Intergenic
968286749 3:197513305-197513327 ATCCAGGTGTGTCCCGGGGAGGG + Intronic
968286759 3:197513338-197513360 ATCCAGGTGTGTCCCCGGGAGGG + Intronic
968286820 3:197513503-197513525 ATCCAGGTGTGTCCCCGGGAGGG + Intronic
968286831 3:197513536-197513558 ATCCAGGTGTGTCCCCGGGAGGG + Intronic
975326267 4:73062207-73062229 ATCAAGCTGAGTGCAGTGGTTGG - Intronic
978339534 4:107707432-107707454 ATCCTGCTTAGTACCAGGGTAGG + Intronic
986139558 5:5017290-5017312 AACCAGCTGAGTCCAGTGGAAGG + Intergenic
989721208 5:44530801-44530823 ATCCAGCTGAGTTTCTGGATCGG + Intergenic
994974201 5:106780692-106780714 ACCCAGCAGAGTCCCAGTGTTGG + Intergenic
998905871 5:146904439-146904461 ATCAAGCCCAGTCCTGGGGTAGG + Intronic
1001228231 5:169963812-169963834 ACCCAGCAGAGTCCCCGGGAAGG + Intronic
1002060911 5:176625561-176625583 ACCCAGCTGAGGCTGGGGGTAGG + Intronic
1004321393 6:14634210-14634232 ATCCACCTGAGTCGGGGGGGTGG + Intergenic
1006912466 6:37572264-37572286 AACCAGCGGAGACCCTGGGTGGG - Intergenic
1008433271 6:51445612-51445634 ATCCTCCTGAGTCCTGGGGCAGG - Intergenic
1016520748 6:144943993-144944015 ATCCTGCTGAATCCAGGAGTAGG + Intergenic
1017277665 6:152588821-152588843 ATCCAGGTGGGTCCCTGGGAGGG + Intronic
1020083010 7:5296576-5296598 GTCAAGCTGAGTCGGGGGGTGGG + Intronic
1027237202 7:76305116-76305138 AGCCCGCAGAGTCTCGGGGTGGG + Intergenic
1029459064 7:100685110-100685132 ATCCAGCTGAGTCCCGGGGTGGG - Exonic
1035235480 7:157495057-157495079 ACCAATCTGAGTCCCGGGGCTGG + Intergenic
1042448557 8:68918390-68918412 ATGCATATGAGTCCCGGGATGGG - Intergenic
1043207491 8:77464747-77464769 ATCCAGCTGAATCCCTGTTTTGG + Intergenic
1050717760 9:8548979-8549001 ATCCAGCTGTGGCCCGGGCACGG - Intronic
1057690614 9:97280840-97280862 ATTCAGCTCAGTCCTGGGCTGGG + Intergenic
1057822051 9:98340071-98340093 CACCAGCTGTGTCCCGGGGTAGG + Intronic
1061445842 9:130636729-130636751 AACCAGCTGAGTCCAGGGCCAGG - Intronic
1062263767 9:135677204-135677226 ATGCAGCTGTGTCCCTGGGCGGG - Intergenic
1190583106 X:51907749-51907771 GCCCAGCAGAGTCCTGGGGTAGG + Intergenic
1198052072 X:132959526-132959548 CACGAGCTGAGTCCTGGGGTGGG + Intronic
1198862356 X:141084469-141084491 GTGCAGCTAAGTGCCGGGGTTGG + Intergenic
1198900338 X:141502917-141502939 GTGCAGCTAAGTGCCGGGGTTGG - Intergenic