ID: 1029459557

View in Genome Browser
Species Human (GRCh38)
Location 7:100687133-100687155
Sequence CTGAGGCAGTGGAGGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1659
Summary {0: 1, 1: 0, 2: 18, 3: 163, 4: 1477}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029459539_1029459557 21 Left 1029459539 7:100687089-100687111 CCCTGCCACCCTGTGCAACCGCC 0: 1
1: 0
2: 0
3: 19
4: 200
Right 1029459557 7:100687133-100687155 CTGAGGCAGTGGAGGGAGGAAGG 0: 1
1: 0
2: 18
3: 163
4: 1477
1029459545_1029459557 0 Left 1029459545 7:100687110-100687132 CCCCATGCCTTGTCCACTGTGCC 0: 1
1: 0
2: 3
3: 25
4: 259
Right 1029459557 7:100687133-100687155 CTGAGGCAGTGGAGGGAGGAAGG 0: 1
1: 0
2: 18
3: 163
4: 1477
1029459544_1029459557 3 Left 1029459544 7:100687107-100687129 CCGCCCCATGCCTTGTCCACTGT 0: 1
1: 0
2: 3
3: 22
4: 261
Right 1029459557 7:100687133-100687155 CTGAGGCAGTGGAGGGAGGAAGG 0: 1
1: 0
2: 18
3: 163
4: 1477
1029459543_1029459557 12 Left 1029459543 7:100687098-100687120 CCTGTGCAACCGCCCCATGCCTT 0: 1
1: 0
2: 0
3: 7
4: 116
Right 1029459557 7:100687133-100687155 CTGAGGCAGTGGAGGGAGGAAGG 0: 1
1: 0
2: 18
3: 163
4: 1477
1029459546_1029459557 -1 Left 1029459546 7:100687111-100687133 CCCATGCCTTGTCCACTGTGCCC 0: 1
1: 0
2: 2
3: 23
4: 252
Right 1029459557 7:100687133-100687155 CTGAGGCAGTGGAGGGAGGAAGG 0: 1
1: 0
2: 18
3: 163
4: 1477
1029459537_1029459557 25 Left 1029459537 7:100687085-100687107 CCTCCCCTGCCACCCTGTGCAAC 0: 1
1: 0
2: 1
3: 60
4: 462
Right 1029459557 7:100687133-100687155 CTGAGGCAGTGGAGGGAGGAAGG 0: 1
1: 0
2: 18
3: 163
4: 1477
1029459547_1029459557 -2 Left 1029459547 7:100687112-100687134 CCATGCCTTGTCCACTGTGCCCT 0: 1
1: 0
2: 0
3: 47
4: 456
Right 1029459557 7:100687133-100687155 CTGAGGCAGTGGAGGGAGGAAGG 0: 1
1: 0
2: 18
3: 163
4: 1477
1029459541_1029459557 16 Left 1029459541 7:100687094-100687116 CCACCCTGTGCAACCGCCCCATG 0: 1
1: 0
2: 1
3: 8
4: 126
Right 1029459557 7:100687133-100687155 CTGAGGCAGTGGAGGGAGGAAGG 0: 1
1: 0
2: 18
3: 163
4: 1477
1029459538_1029459557 22 Left 1029459538 7:100687088-100687110 CCCCTGCCACCCTGTGCAACCGC 0: 1
1: 0
2: 2
3: 22
4: 238
Right 1029459557 7:100687133-100687155 CTGAGGCAGTGGAGGGAGGAAGG 0: 1
1: 0
2: 18
3: 163
4: 1477
1029459549_1029459557 -7 Left 1029459549 7:100687117-100687139 CCTTGTCCACTGTGCCCTGAGGC 0: 1
1: 0
2: 7
3: 42
4: 278
Right 1029459557 7:100687133-100687155 CTGAGGCAGTGGAGGGAGGAAGG 0: 1
1: 0
2: 18
3: 163
4: 1477
1029459542_1029459557 13 Left 1029459542 7:100687097-100687119 CCCTGTGCAACCGCCCCATGCCT 0: 1
1: 0
2: 0
3: 16
4: 117
Right 1029459557 7:100687133-100687155 CTGAGGCAGTGGAGGGAGGAAGG 0: 1
1: 0
2: 18
3: 163
4: 1477
1029459540_1029459557 20 Left 1029459540 7:100687090-100687112 CCTGCCACCCTGTGCAACCGCCC 0: 1
1: 0
2: 0
3: 46
4: 250
Right 1029459557 7:100687133-100687155 CTGAGGCAGTGGAGGGAGGAAGG 0: 1
1: 0
2: 18
3: 163
4: 1477

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029459557 Original CRISPR CTGAGGCAGTGGAGGGAGGA AGG Intronic
900000660 1:13141-13163 CTGAGGCTGAGGAAGGAGAAGGG + Intergenic
900020377 1:183660-183682 CTGAGGCTGAGGAAGGAGAAGGG + Intergenic
900081223 1:859022-859044 CTCACGCAGTGGATGGAAGATGG - Intergenic
900215047 1:1477112-1477134 CTGAGGCTCAGGTGGGAGGATGG - Intronic
900222213 1:1515180-1515202 CTGAGGCTGAGGTGGGAGGATGG - Intronic
900419139 1:2548032-2548054 CAGGGGGAGGGGAGGGAGGAGGG + Intergenic
900503223 1:3016688-3016710 GGGAGCCAGGGGAGGGAGGAAGG + Intergenic
900561673 1:3310157-3310179 GTGAGGAGGTGGAGGTAGGAAGG - Intronic
900605348 1:3521296-3521318 GTAAGGCAGTGGAGGGCGAAGGG + Intronic
900997373 1:6129877-6129899 CCAAGGCCGTGGAGGGAGGCAGG - Intronic
901167145 1:7229130-7229152 CTGGGGCAGAGGAGGGAGAGTGG + Intronic
901313167 1:8285310-8285332 GTGGGGCAGTGGAAGGAAGATGG + Intergenic
901435190 1:9243190-9243212 CAGAGGGGGTGGTGGGAGGAGGG + Intronic
901445801 1:9307399-9307421 CAGGGGCTGGGGAGGGAGGATGG - Intronic
901447911 1:9319411-9319433 AGGAGGAAGAGGAGGGAGGAAGG - Intronic
901496962 1:9627794-9627816 CAAAGGCAGTAGAGAGAGGAGGG + Intergenic
901570140 1:10153383-10153405 AGGAGGCAGAGGTGGGAGGAAGG + Intronic
901578704 1:10222360-10222382 CTGAGACAGGGGAGGTAGGTTGG + Intronic
901636067 1:10670762-10670784 GTGAGGTAGAGGAGGGAGGAGGG - Intronic
901683769 1:10931867-10931889 GGGAGGCAGAGGTGGGAGGAGGG + Intergenic
901855038 1:12039139-12039161 CTGAGGACAGGGAGGGAGGAGGG + Intergenic
902328287 1:15717011-15717033 GGGAGGCTGAGGAGGGAGGATGG + Intronic
902527401 1:17068187-17068209 TCAAGGCAGTGGAAGGAGGAAGG + Exonic
902774252 1:18664445-18664467 CTGGGGAAGGGGAGGGAGGAGGG + Intronic
902833127 1:19030269-19030291 CTGGAGCAGGGGAGAGAGGAAGG + Intergenic
903140271 1:21335075-21335097 CAGAGGCAGTGGAGGGTGGAGGG - Intronic
903178793 1:21595250-21595272 CTGCACCAGTGGAGGGAGGAGGG - Intergenic
903186141 1:21630371-21630393 GGGAGGCTGAGGAGGGAGGATGG - Intronic
903213937 1:21832954-21832976 TGGAGGCAGAGGAGGGAGGAAGG + Intronic
903294591 1:22335705-22335727 CTGAGCAGGAGGAGGGAGGAGGG - Intergenic
903601125 1:24541583-24541605 AGGAGGAAGTGGAGGGAGGCAGG - Intergenic
903929860 1:26855963-26855985 CTGAGGCAGGGGAAGGTGGAGGG - Exonic
903934091 1:26882872-26882894 CTGAGGCAGGAAAAGGAGGAGGG - Intronic
904644284 1:31954470-31954492 GGGAGGCAGAGGTGGGAGGATGG - Intergenic
904644400 1:31955075-31955097 CAGAGGCAGGGGAGGCAGGCAGG + Intergenic
904771935 1:32885790-32885812 CAGAGGCTGGGGAGGGAGGAAGG + Intergenic
904954136 1:34268805-34268827 CTGAGGCACTGGAGGCAGGCAGG + Intergenic
905025127 1:34844582-34844604 CTTGGACAGTGGAGGGTGGAGGG - Intronic
905240299 1:36576775-36576797 CTGGGGTCGGGGAGGGAGGAGGG + Intergenic
905242675 1:36590971-36590993 CTGGGGAAGGGGATGGAGGAAGG + Intergenic
905394686 1:37659627-37659649 CTGAGGTGGAGGTGGGAGGACGG - Intergenic
905519898 1:38589606-38589628 CTGGGGGAGTGGAGGGTGTAGGG - Intergenic
905630152 1:39514096-39514118 CTGAGGAGGTGGAGGGAGACAGG + Intronic
905667608 1:39772094-39772116 CTGAGGAGGTGGAGGGAGACAGG - Intronic
905690042 1:39936413-39936435 CTCAGGCAGAGGTGGGAGGAAGG + Intergenic
905788481 1:40776614-40776636 CTCAGGGATTGGAGGGAGGCCGG - Intergenic
906145688 1:43558757-43558779 CTGGGGGAGGGGAGGGAGGCAGG + Intronic
906150580 1:43585207-43585229 CTGCAGCAGTGGGTGGAGGATGG + Intronic
906202549 1:43969552-43969574 AAGAGGCAGAGGTGGGAGGATGG + Intergenic
906252476 1:44321353-44321375 CTGAGGCAGAGGGGAGAGAAGGG + Intronic
906319881 1:44809227-44809249 CTGAGTGAGTGGAGGGAGGAGGG - Intronic
906628809 1:47347312-47347334 ATGAGGCTGAGGTGGGAGGATGG - Intronic
906735975 1:48128574-48128596 CTGAGAAATTGGAGGGAGCAAGG + Intergenic
906996272 1:50797459-50797481 GTGAGGCCATGGTGGGAGGATGG + Intronic
907101628 1:51842957-51842979 CAGAGGCTGAGGTGGGAGGATGG + Intronic
907114830 1:51959405-51959427 TGGAGGCTGTGGTGGGAGGACGG + Intronic
907124387 1:52036497-52036519 CAGAGGCAGAAGAGGGTGGAAGG + Intronic
907321474 1:53605429-53605451 CTCAGGCAGTGGAGGAAGCCAGG - Intronic
907368079 1:53979062-53979084 GTGAGGCAGAGGATGAAGGAGGG + Intergenic
907523137 1:55038191-55038213 CTGAGGGAGGTGGGGGAGGAAGG - Intergenic
907663450 1:56414496-56414518 ATGGGGCAGTGGAGGGGGGATGG - Intergenic
908000145 1:59671522-59671544 CAGAGTAGGTGGAGGGAGGAAGG + Intronic
908199601 1:61780604-61780626 CTAAGGCAGAGGCAGGAGGAGGG - Intronic
908331478 1:63074970-63074992 TTGAGGATGGGGAGGGAGGAGGG - Intergenic
908523947 1:64969608-64969630 CTAAGGCAGTGGACTGGGGAAGG + Intergenic
908598565 1:65713995-65714017 GTGAGACGGTTGAGGGAGGAGGG - Intergenic
909081353 1:71116427-71116449 CTGAGGAAGTGAAGAGGGGAAGG + Intergenic
910197001 1:84652316-84652338 TGGAGGCTGAGGAGGGAGGATGG + Intronic
910791497 1:91055666-91055688 CTGAGTCAGTGGACTGGGGAAGG - Intergenic
911177899 1:94835208-94835230 GAGAGGCAGAGGTGGGAGGATGG + Intronic
911337618 1:96599687-96599709 TAGAGGCTGAGGAGGGAGGATGG + Intergenic
911344622 1:96681526-96681548 GTGAGGAAGAGGAGGAAGGAAGG - Intergenic
911588896 1:99723410-99723432 GGGAGGCAGAGGTGGGAGGATGG + Intronic
911647520 1:100352410-100352432 CTGAGGGAGGGCGGGGAGGAAGG + Intronic
911724944 1:101233384-101233406 CTGGGTCAGGGGAGGGAAGAGGG + Intergenic
911792808 1:102039934-102039956 ATCAGGCAGTGGATGGAGGCTGG + Intergenic
911799922 1:102122977-102122999 CTGTGGCGGTGAAGAGAGGATGG + Intergenic
911950167 1:104163269-104163291 GGGAGGCTGTGGGGGGAGGAGGG + Intergenic
912145948 1:106794619-106794641 CTGGGGCAGTGGGGGGAGGTGGG + Intergenic
912369752 1:109164776-109164798 CTCAGGCTGGGCAGGGAGGATGG + Intronic
912435884 1:109660695-109660717 CTGAGGGATTTGGGGGAGGATGG + Intronic
912755540 1:112321769-112321791 CAGAGGGAGTGGAGAGAGGATGG - Intergenic
912832716 1:112967928-112967950 CAGAGGGAGGGTAGGGAGGAAGG - Intergenic
912875584 1:113355359-113355381 GGGAGGCTGAGGAGGGAGGATGG - Intergenic
912949461 1:114110782-114110804 CTGAGGTAGTGCAGCGAGGATGG - Intronic
912952928 1:114133038-114133060 CTGAGGGTATGCAGGGAGGAAGG - Intronic
912956518 1:114157432-114157454 CTGGGGACTTGGAGGGAGGAGGG - Intergenic
913124451 1:115772259-115772281 CTGGTGCAGAGGAGGCAGGAAGG - Intergenic
913214501 1:116609349-116609371 CGGAGGCTGAGGTGGGAGGATGG - Intronic
913665895 1:121048700-121048722 CTGAGGCAGGTGAGGGGGCAAGG - Intergenic
914017293 1:143831976-143831998 CTGAGGCAGGTGAGGGGGCAAGG - Intergenic
914718793 1:150272451-150272473 ATGAGGCCTTGGAGGAAGGAAGG + Intronic
914743532 1:150484693-150484715 GTGTTGCAGTGGAGGAAGGAAGG - Intergenic
914751472 1:150537805-150537827 GAGAGGCAGTGGAGGCCGGAGGG + Intergenic
915150704 1:153828963-153828985 CAGAGGCTGAGGTGGGAGGATGG + Intronic
915243792 1:154542330-154542352 TGGAGGCTGAGGAGGGAGGATGG - Intronic
915276819 1:154794755-154794777 AGGTGGCACTGGAGGGAGGAAGG + Intronic
915304625 1:154970374-154970396 CCCAGGCAGAGGAGGCAGGATGG + Exonic
915354193 1:155246092-155246114 CAGAGGTTGTGGAGAGAGGATGG + Intergenic
915458999 1:156058445-156058467 CTTAGACAATGGGGGGAGGATGG + Exonic
915511816 1:156390799-156390821 GTGAGGAATTGCAGGGAGGAGGG - Intergenic
915517504 1:156421734-156421756 CAGAGGCAGAGGAGGGAGCTAGG - Intronic
915583658 1:156831401-156831423 CTGGGGCAGTGGTGACAGGAGGG + Intronic
915602204 1:156929494-156929516 CAGAGGTGGTGGAGGGAAGAAGG + Intronic
915657786 1:157376115-157376137 GGGAGGCAGAGGTGGGAGGATGG - Intergenic
915731644 1:158058406-158058428 CTGGGGCAGGGCAGGGAGGGAGG - Intronic
915744586 1:158146199-158146221 CTGAGGCACTTGAGAGAGAATGG - Intergenic
915841085 1:159213568-159213590 GGGAAGAAGTGGAGGGAGGAAGG + Intergenic
915972324 1:160363373-160363395 TTGAGGGAGGGGAGGGAGGTTGG - Intergenic
916210525 1:162356416-162356438 CAGAGGCAGTGGAGGGCAGGAGG + Intronic
916513409 1:165493613-165493635 CTGAGACAGTGGAGGCGGGCGGG - Intergenic
916689894 1:167180125-167180147 GGGAGGCTGTGGTGGGAGGATGG + Intergenic
916966191 1:169945130-169945152 CTGAGGCAGTGGGGGGCGGGGGG + Intronic
917063715 1:171068644-171068666 GTGAGGCAGAGGAGGGAGAGAGG + Intergenic
917091490 1:171357998-171358020 GAAAGGCAGAGGAGGGAGGATGG - Intergenic
917322387 1:173796792-173796814 GGGAGGCTGAGGAGGGAGGATGG + Intergenic
917976393 1:180242115-180242137 CTGAAGCAGTGGGGAGAGTAGGG - Intronic
918043940 1:180929850-180929872 ACGTGGCAGTGGAGGGAGCAGGG + Intronic
918134480 1:181659282-181659304 CACAGGCATTGGTGGGAGGAAGG + Intronic
918138863 1:181703035-181703057 GAGAGGCAGAGGAAGGAGGATGG - Intronic
918586335 1:186193204-186193226 CTGAGGATGAGAAGGGAGGAAGG + Intergenic
918612068 1:186504225-186504247 CAAGGGCAGTGGAGGGAGGAGGG + Intergenic
918845169 1:189600522-189600544 CTGAGTCAGTGGACTGGGGAAGG - Intergenic
919571315 1:199252510-199252532 AGGAGGCTGTGGTGGGAGGATGG - Intergenic
919693071 1:200544735-200544757 GTGAGGAAGGGGAGGGAGGGAGG + Intergenic
919739460 1:200973333-200973355 GAGAGGCAGGGGAGGGATGAGGG + Intronic
919758754 1:201083323-201083345 CTGAGGGAGGGGACAGAGGATGG + Intronic
919773463 1:201177901-201177923 GTGAGGCAGTGGAGAAAGCAAGG + Intergenic
919933618 1:202237155-202237177 CTGAGAGAGTGCAGGGAGGCAGG - Intronic
920008975 1:202854018-202854040 GGGAGGCAGAGGTGGGAGGATGG - Intergenic
920025321 1:202989870-202989892 GGGAGGCTGTGGTGGGAGGATGG - Intergenic
920162720 1:204011654-204011676 CTGAGGCAGGGGGAGCAGGAGGG + Intergenic
920176471 1:204104860-204104882 CTGTCGTTGTGGAGGGAGGAAGG + Intronic
920199300 1:204249709-204249731 CTGAGACTTTGAAGGGAGGAGGG - Intronic
920542366 1:206788768-206788790 CTAAGGCAGTGCAGGCAGGATGG + Intergenic
921016983 1:211200987-211201009 GGGAGGCAGAGGCGGGAGGATGG + Intergenic
921068844 1:211642561-211642583 CAGAGGTAGTGAAGGCAGGAGGG - Intergenic
921168399 1:212524276-212524298 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
921262296 1:213395034-213395056 CTGCGGCAGGGGAAGGAGGGTGG - Intergenic
921298681 1:213728710-213728732 GGGAGGTAGTGGTGGGAGGAGGG + Intergenic
921360841 1:214329840-214329862 CAGAGGCAGCTGAGGGAGGCAGG + Intronic
921378446 1:214499042-214499064 GGGAGGCAGAGGTGGGAGGATGG - Intronic
921559890 1:216644531-216644553 CAGAGGCTGAGGTGGGAGGATGG - Intronic
921703196 1:218290570-218290592 CAGAGGCTGAGGTGGGAGGATGG - Intronic
921939476 1:220825152-220825174 ATGAGGCTGAGGTGGGAGGATGG - Intergenic
922019765 1:221691808-221691830 GGGAGGCAGAGGTGGGAGGATGG + Intergenic
922322443 1:224500566-224500588 GGGAGGCTGAGGAGGGAGGATGG + Intronic
922574889 1:226654944-226654966 AGGAGGAAGAGGAGGGAGGAGGG + Intronic
922614145 1:226951228-226951250 CTGAGAAAGTGGAGGGATGAAGG + Intronic
922702431 1:227769698-227769720 CTGTGGTTGTGGAGGGTGGAGGG + Intronic
922883904 1:229003491-229003513 CAGGGGGAGGGGAGGGAGGAAGG + Intergenic
923314058 1:232762298-232762320 CTGAGGAAGAGGAAGAAGGATGG - Intergenic
923455930 1:234165623-234165645 GGGAGGCAGAGGTGGGAGGATGG - Intronic
924145517 1:241070675-241070697 CAGAGACAGTGCAGGGAGGCTGG + Intronic
924286921 1:242496953-242496975 CTCAGCCAGAGGATGGAGGAAGG - Intronic
924505697 1:244681487-244681509 CTGGGGCGGGGGAGGGAGGATGG + Intronic
924941714 1:248816731-248816753 TTGAGGCAGTGGCGGTGGGAGGG - Intronic
924944701 1:248838451-248838473 CTGGGGCGGGGGAGCGAGGAAGG - Exonic
1062779487 10:188486-188508 AGGAGGCTGAGGAGGGAGGATGG + Intronic
1062838641 10:652487-652509 CTGAGGCTGTGGGCGGAGGAGGG - Exonic
1062878066 10:957899-957921 AGGAGGCTGAGGAGGGAGGAGGG - Intergenic
1063362402 10:5469160-5469182 GGGAGGGAGTGGAGGGAGAAAGG - Intergenic
1063411493 10:5840041-5840063 CGGAGGCTGAGGTGGGAGGATGG - Intronic
1063528204 10:6804288-6804310 GTGGGGTAGGGGAGGGAGGAGGG - Intergenic
1063536128 10:6885438-6885460 CTGAGGCAGTGGGGAGAGAGAGG + Intergenic
1063938949 10:11107822-11107844 AGGGGGCAGAGGAGGGAGGAGGG - Intronic
1064037559 10:11926833-11926855 AGGAGGAATTGGAGGGAGGAAGG + Intronic
1064156861 10:12909659-12909681 ATGAGGCTGTGGAGAGTGGAAGG + Intronic
1064295366 10:14074235-14074257 ATGAAGCAGTGGATGGGGGAGGG + Intronic
1064629968 10:17300133-17300155 GAGAGGCTGAGGAGGGAGGATGG + Intergenic
1065838681 10:29682002-29682024 CTGAGGGAGTGGGGACAGGAAGG - Intronic
1065960398 10:30729577-30729599 GAGAGGCTGAGGAGGGAGGATGG - Intergenic
1067051892 10:43026395-43026417 CTGTGTCACTGGAAGGAGGAAGG + Intergenic
1067366213 10:45631210-45631232 CGGAGGCAGAGGCGGGAGAATGG + Intronic
1067438370 10:46294411-46294433 CTGGGAAAGTGGAGGGAGGCAGG + Intronic
1067582366 10:47453796-47453818 CTGAGGTGGAGGAGGGATGAGGG - Intergenic
1067964169 10:50890155-50890177 TTGAGCCAGGGCAGGGAGGATGG - Intergenic
1068443450 10:57089754-57089776 CTGAGGGAGTGAAGGGCTGATGG + Intergenic
1068577724 10:58703267-58703289 TTGAGTCTGTGGTGGGAGGATGG - Intronic
1068664497 10:59658717-59658739 CTAAGGCAGTGATGGGAGAAGGG - Intronic
1068775497 10:60863993-60864015 CTCAGGCAGTGGAGGGGGAGGGG - Intergenic
1068950831 10:62775467-62775489 CTGAGGCTGAGGAGGCAGCATGG - Intergenic
1069400715 10:68042516-68042538 GGGAGGCTGTGGTGGGAGGATGG + Intronic
1069689818 10:70343073-70343095 GTGAGGCAGATGAGGGAGAAAGG - Intronic
1069879547 10:71583268-71583290 CTGAGGCCGCAGAGGGAGGCAGG + Intronic
1070244142 10:74714168-74714190 AGGAGGCAGAGGTGGGAGGATGG + Intergenic
1070269376 10:74938048-74938070 GGGAGGCTGAGGAGGGAGGATGG - Intronic
1070442850 10:76463639-76463661 CGGTGGCAGGGGAGGGGGGAAGG + Intronic
1070571608 10:77643935-77643957 CCGAGGCACTGGAGACAGGATGG - Intergenic
1070585430 10:77762457-77762479 CTGGGGAAGGGGAGGAAGGAGGG - Intergenic
1070756011 10:78993708-78993730 CCGAGGCAGTGGGGGGTGGCGGG + Intergenic
1071475706 10:86023447-86023469 CTGAGCCAGTGGAGACGGGATGG - Intronic
1071597004 10:86935604-86935626 AGGAGGCAGCTGAGGGAGGAGGG - Exonic
1072034370 10:91551051-91551073 GAGAGGCTGTGGTGGGAGGATGG - Intergenic
1072313277 10:94177881-94177903 GAGAGGTAGTGAAGGGAGGAAGG - Intronic
1072587251 10:96793560-96793582 GGGAGGCTGTGGTGGGAGGATGG + Intergenic
1072631927 10:97152200-97152222 AGGAGGCTGTGGAGGGAGGCTGG - Intronic
1072687541 10:97547388-97547410 CTGGGGCAGAAGAGGGAGGATGG - Intronic
1072702733 10:97655677-97655699 CGGAGGCTGAGGTGGGAGGATGG - Intronic
1072737507 10:97889106-97889128 CAGGGGCAGTGGAGGCGGGAGGG + Intronic
1072802781 10:98404992-98405014 GTGAGGGAGGGGAGGGAGGATGG + Intronic
1072875030 10:99163417-99163439 CTGAGGAGGTGGAAAGAGGAAGG - Intronic
1073104955 10:101027257-101027279 GTGAGGGAGGGGAGGGTGGAGGG - Intronic
1073163302 10:101420404-101420426 CAGACCCAGTGGAGTGAGGAGGG - Intronic
1073232422 10:101983384-101983406 GGGAGGCTGAGGAGGGAGGATGG - Intronic
1073357391 10:102868199-102868221 GGGAGGCTGAGGAGGGAGGATGG + Intronic
1073359856 10:102889664-102889686 CGGGGGGGGTGGAGGGAGGAAGG - Intronic
1073394021 10:103203457-103203479 GGGAGGCTGAGGAGGGAGGATGG - Intergenic
1073396323 10:103221099-103221121 CAGAGGCTGAGGTGGGAGGATGG + Intergenic
1073531013 10:104232100-104232122 CGGAGGGAGAGGAGGGAGGAGGG + Intronic
1073632412 10:105161991-105162013 CAGGGGCAGGGGCGGGAGGAGGG - Intronic
1073667092 10:105545784-105545806 TTGAGTCAGTGAATGGAGGAAGG + Intergenic
1073727231 10:106247629-106247651 CTGTGGCAGTGGATGGGGGTTGG - Intergenic
1073791957 10:106949492-106949514 CAGAGGCTGTGTAGGGATGAGGG - Intronic
1073984478 10:109192857-109192879 CTGAGGAAGTGGAAGGAGTAAGG - Intergenic
1074001539 10:109378698-109378720 CAGGGCCAGTGCAGGGAGGAGGG + Intergenic
1074129727 10:110563346-110563368 CGGAGGCTGAGGTGGGAGGACGG - Intergenic
1074436950 10:113442351-113442373 CTGAGGTAGTGGAGAGAGAAAGG - Intergenic
1074874204 10:117601707-117601729 AGGAGGCAGAGGTGGGAGGATGG + Intergenic
1074988662 10:118681801-118681823 CTTGGCCAGTGGAGGAAGGAAGG + Exonic
1075040849 10:119105390-119105412 CGGAGGCCGAGGCGGGAGGATGG - Intronic
1075086452 10:119417309-119417331 CTGAGGCAGGCTGGGGAGGAGGG - Intronic
1075291020 10:121230983-121231005 ATGAGGCAGTGTTGGGAGGGAGG - Intergenic
1075294618 10:121263329-121263351 ATGAGGCAATGGAGGAAGGCTGG - Intergenic
1075388821 10:122077548-122077570 ATGAGGCAGGAGAGGGAGGTTGG + Intronic
1075565464 10:123500481-123500503 CAGAAGCAGAGGAAGGAGGAAGG - Intergenic
1075592454 10:123702778-123702800 CTGAGGCACTAGAGGAAGGATGG + Intergenic
1075891577 10:125955886-125955908 CTAAGGCAGTGGAAGGAAGCAGG + Intronic
1076053774 10:127355009-127355031 CTGAGGCAACTGAGGGAGGGAGG - Intronic
1076318981 10:129564506-129564528 ATGAGGAAGTGGAGGAAGAAGGG - Intronic
1076420218 10:130326138-130326160 CTGTGGGGTTGGAGGGAGGAAGG + Intergenic
1076935398 10:133565439-133565461 CGGAGGTAGTGGTGGGAGGCAGG - Exonic
1077032240 11:473771-473793 CTGATGCTGGGGCGGGAGGAAGG - Intronic
1077252876 11:1568322-1568344 CAGAGGGAGGGGAGGGAGGAGGG + Intronic
1077276991 11:1716439-1716461 CAGAGGCTGAGGTGGGAGGACGG + Intergenic
1077355343 11:2114271-2114293 GTGAGGTGGTGGAGGGTGGAGGG - Intergenic
1077884181 11:6373877-6373899 GGGAGGCTGAGGAGGGAGGATGG + Intergenic
1078093589 11:8282979-8283001 CTGTGGCAGCGGAAGGAGAAAGG - Intergenic
1078498355 11:11842349-11842371 GTGAGGCAGTCGGGGGTGGACGG + Intronic
1078744938 11:14103514-14103536 CTGGCCCAGTGGTGGGAGGATGG - Intronic
1078858478 11:15225904-15225926 CTGAGGCAGGGGAGAGAGCATGG + Intronic
1079104099 11:17559445-17559467 CCCAGGCCGTGGAGTGAGGATGG - Intronic
1079105780 11:17571490-17571512 AAGGGGCAGTGAAGGGAGGAAGG - Intronic
1079244786 11:18744098-18744120 CTGAGGGCGGCGAGGGAGGAGGG + Exonic
1079357835 11:19744631-19744653 CTGAGACAGTGGGGTGAGGTTGG - Intronic
1079403015 11:20121409-20121431 AGGAGGAAGGGGAGGGAGGATGG - Intronic
1079636124 11:22743611-22743633 TTGTAGCAGTGGAGGGAGGGAGG - Intronic
1079642982 11:22829850-22829872 CCGAGCCAGTGGAGGGCGGTGGG - Exonic
1080329225 11:31115972-31115994 CTGTGGCAGTGGGGGGGGGGGGG + Intronic
1080684629 11:34504851-34504873 CTGAGAAAGAGGAGGGAGGGTGG + Intronic
1080695202 11:34597690-34597712 CTGAGGGACAGGAGAGAGGAGGG + Intergenic
1080890287 11:36403151-36403173 CTGAGGAAATGGAGGATGGATGG + Intronic
1081291459 11:41330674-41330696 CTGAGGCTGAGGTGGGAGGATGG - Intronic
1081607418 11:44536093-44536115 ATGATGCAGAAGAGGGAGGAGGG + Intergenic
1081680195 11:44997122-44997144 CTGAGACAGAGGGGAGAGGAGGG + Intergenic
1081773938 11:45665327-45665349 CGGAGGAAGAGGAGGGAGGAGGG - Exonic
1081775965 11:45676109-45676131 CTTGGGCAGTGGAGGAGGGAGGG - Intergenic
1082631008 11:55541952-55541974 GGGAGGCAAAGGAGGGAGGATGG + Intergenic
1082797549 11:57388972-57388994 CTGAGGCTGAGGTGGGAGCATGG - Intronic
1082824402 11:57567509-57567531 CGGAGGGGATGGAGGGAGGAGGG + Intronic
1082834173 11:57639769-57639791 CTTAGGGAGTGCAGGGAGAAAGG - Intergenic
1083163315 11:60868771-60868793 CTGAGGCAGCTGAGGAAGGGAGG - Intronic
1083269528 11:61564816-61564838 CTGGGCCAGTGGATGGGGGAAGG - Intronic
1083420989 11:62553213-62553235 ATGAGGCTGTGAAGGAAGGAGGG + Intronic
1083480396 11:62940891-62940913 AGGAGGCAGAGGTGGGAGGATGG + Intronic
1083563642 11:63694575-63694597 CGGAGGCTGAGGTGGGAGGACGG - Intronic
1083624322 11:64064368-64064390 CACAGGCATTGGATGGAGGATGG + Intronic
1083651932 11:64209005-64209027 CTAAGGCCGGGCAGGGAGGATGG + Intronic
1083704100 11:64501285-64501307 GTGAGGCTGAGGTGGGAGGATGG - Intergenic
1083766835 11:64845269-64845291 CTGAGGCTTGGGAAGGAGGAAGG + Intergenic
1083833335 11:65247611-65247633 CTGGGGCTGTGGAGGGAGAACGG + Intergenic
1083857710 11:65401330-65401352 GGGAGGCAGGGGAGGGAGGCTGG - Intronic
1083857716 11:65401343-65401365 GGGAGGCAGGGGAGGGAGGCAGG - Intronic
1083883928 11:65561662-65561684 CTGAGGCGGCGGTGGGAGGGGGG - Intergenic
1083897771 11:65628750-65628772 CTGGGGCAGTGGGGGGTGGTGGG + Intronic
1083942350 11:65903190-65903212 CTGGGGCAGCTGAGGGAGCAGGG + Intergenic
1084020208 11:66412813-66412835 CTGAGGCAGGAGAGGGTGGCGGG - Intergenic
1084026888 11:66456155-66456177 CTGGAGCAGGGGAGGGAGGGAGG + Intronic
1084215032 11:67642489-67642511 CTGGGGAAGTGGATGGAGGAAGG - Intergenic
1084577610 11:69999841-69999863 TGGAGGCATTGGAGGCAGGAGGG + Intergenic
1085122158 11:73974162-73974184 CTGTGGCTGTGGAGGGTGGAAGG + Intergenic
1085279614 11:75321279-75321301 CTGAGGAAGAGGTGGGGGGATGG - Intronic
1085503304 11:77041269-77041291 CTGGGGTAGTGGTGGGAAGAAGG - Exonic
1085696008 11:78705274-78705296 CAGAGTCAGTGGAGGGAGAGAGG + Intronic
1085741642 11:79082467-79082489 CTGAGGCCGTGGAAGGAAGCAGG - Intronic
1087040858 11:93798599-93798621 ATGAGGCAGTGAAAGGAGTAGGG + Intronic
1087491766 11:98837075-98837097 CTGAGGGTGTGGAGGGTGGAGGG - Intergenic
1087527154 11:99330164-99330186 GGGAGGGAGGGGAGGGAGGAGGG + Intronic
1087585184 11:100110080-100110102 ATGAGGCTGAGGTGGGAGGATGG + Intronic
1087669576 11:101089679-101089701 TTGAGGGAGAAGAGGGAGGAAGG + Intronic
1087693463 11:101348593-101348615 CTGAGAAAGTTGAGGGAGGAAGG + Intergenic
1088295606 11:108290524-108290546 CAGAGGCTGAGGTGGGAGGATGG + Intronic
1088327298 11:108614029-108614051 ATGAGGCTGTGGCAGGAGGATGG + Intergenic
1088356773 11:108952317-108952339 GGGAGGCTGTGGTGGGAGGAAGG + Intergenic
1088391459 11:109319478-109319500 CTGAGGCACTGCAGGCAGGAAGG - Intergenic
1088613929 11:111603604-111603626 TTGAGGCAGTGGAAGGAAGGGGG - Intronic
1088704703 11:112451519-112451541 CAAAGGCAATGGATGGAGGATGG - Intergenic
1088822078 11:113464976-113464998 GAGGGGCAGTGGAGGTAGGAAGG - Intronic
1089128490 11:116193834-116193856 GGGAGGCCGAGGAGGGAGGAGGG - Intergenic
1089140087 11:116277455-116277477 GGGAGGCAGAGGTGGGAGGATGG + Intergenic
1089417522 11:118304735-118304757 CTGAGGCTGGGAGGGGAGGAGGG - Exonic
1089435098 11:118458326-118458348 GGGAGGCCGAGGAGGGAGGATGG - Intronic
1089540014 11:119184128-119184150 CAGAGGCAGTGGAGGCTGGAAGG + Intergenic
1089568224 11:119384011-119384033 ATTAGGCAGTGTGGGGAGGAGGG + Intergenic
1090399693 11:126441143-126441165 CTGAGACACAGGTGGGAGGAGGG - Intronic
1090405795 11:126475247-126475269 CTGAGCCAGTGGAGTCAGGACGG - Intronic
1090464534 11:126922552-126922574 CAGAGCCAGTGGAGGATGGAGGG - Intronic
1090534280 11:127623816-127623838 CTGAAGCCCTGGAGGGAGAAAGG + Intergenic
1090632536 11:128662735-128662757 GTGAGGCAGGGAAGAGAGGAAGG + Intergenic
1090640182 11:128723276-128723298 CTCAGGCAGTGTAGGCGGGATGG + Intronic
1090640361 11:128724608-128724630 CTCAGGCAGTGTAGGCAGGAGGG - Intronic
1090673182 11:128965159-128965181 GGGTGGCAGGGGAGGGAGGAAGG - Exonic
1090761468 11:129840408-129840430 ATGAGGAAGTGCAGGGAGGAGGG + Intronic
1090815492 11:130290494-130290516 CAGTGGCAGTGGAGAAAGGAAGG - Intronic
1091059269 11:132446322-132446344 GAGAGGCAGAGGAGGGAGGGAGG + Intronic
1091129850 11:133136560-133136582 AAGAGGCAGAGGTGGGAGGAAGG + Intronic
1091228134 11:133970429-133970451 CTTAGGCAGTGGAGGGTCGGGGG - Intergenic
1091252341 11:134154423-134154445 CTGAGGAAGAGGACGCAGGAGGG - Intronic
1091555836 12:1572840-1572862 CAGTGGCGGTGGAGGGGGGATGG + Intronic
1091785273 12:3239523-3239545 CTCGGGCAGTGGAGCGGGGAAGG - Intronic
1091849277 12:3682191-3682213 CTGAGGGTGGGGAAGGAGGAAGG - Intronic
1091916587 12:4274705-4274727 CCGGGGAGGTGGAGGGAGGAGGG + Intronic
1092049806 12:5460345-5460367 TGGTGGCAGAGGAGGGAGGAGGG - Intronic
1092083419 12:5736540-5736562 CTTGGGCACTGGAGGGAGGGAGG - Intronic
1092238248 12:6822739-6822761 AGGAGGCTTTGGAGGGAGGAGGG - Intronic
1092239874 12:6829836-6829858 CTGAGGAGGCGAAGGGAGGAGGG - Intronic
1092905064 12:13093556-13093578 CTGTGGCAGTGGATGGAAGCTGG - Intronic
1092923187 12:13250604-13250626 GTGAGTCAGTGGACTGAGGAGGG - Intergenic
1094040310 12:26114615-26114637 CTGGAGCAGGGAAGGGAGGAAGG + Intergenic
1094122122 12:26985916-26985938 CTGAGGCAGAGGCAGGAGAATGG - Intronic
1094196767 12:27757904-27757926 GGGAGGCTGTGGTGGGAGGATGG + Intergenic
1094292180 12:28863807-28863829 GGGAGGGAGGGGAGGGAGGAAGG - Intergenic
1094301463 12:28969268-28969290 ATGATGCAGGGGAGGGATGATGG - Intergenic
1094379893 12:29831328-29831350 CTGAGGCTGTGCAGGGTGGCAGG + Intergenic
1095206385 12:39443766-39443788 CTGACTCCGGGGAGGGAGGAGGG - Intergenic
1095430667 12:42130840-42130862 AGGAGGCTGTGGTGGGAGGATGG + Intronic
1095464961 12:42480727-42480749 CAGAGGCAGTGAAGAGTGGACGG + Intronic
1095753876 12:45741300-45741322 GGGAGGCTGTGGTGGGAGGATGG - Intronic
1095811770 12:46379615-46379637 CTGAGGGAGTGGAGGGGAGGAGG - Intergenic
1095818867 12:46455101-46455123 TGGAGGCAGTGGAGGGAAGATGG - Intergenic
1096138325 12:49221285-49221307 CAGAGGCTGAGGTGGGAGGATGG - Intronic
1096175290 12:49511540-49511562 CTGAGGTATTGGAGTGAGCAAGG + Intronic
1096358884 12:50966503-50966525 CTGAGGGTGTGGAGGTGGGAAGG - Intronic
1096518405 12:52170809-52170831 ATTAGGGAGTGAAGGGAGGAGGG - Exonic
1096624959 12:52889084-52889106 CTCAGGCACAGGATGGAGGAGGG - Intergenic
1096627060 12:52902480-52902502 CTGAGGCAGGGGCAGGAGAATGG - Intronic
1097214981 12:57403705-57403727 GTGAGGCTGAGGTGGGAGGAGGG + Intronic
1097279273 12:57834529-57834551 ATGGGGCAGAGGAGGAAGGAGGG + Intronic
1097386915 12:58961022-58961044 AGGAGGCAGGGGTGGGAGGAAGG + Intergenic
1097540754 12:60939155-60939177 TTGAGGCAGTGGACTGAGAAAGG + Intergenic
1098184712 12:67883910-67883932 CTCAGGCAGTGAAGGGAGGCTGG - Intergenic
1098311779 12:69156057-69156079 CAGAGGCTGAGGCGGGAGGATGG + Intergenic
1098622525 12:72620416-72620438 ATGAGGCTGAGGTGGGAGGATGG + Intronic
1098716119 12:73830074-73830096 CTGAGGGAGAGAAGGGAGGGTGG - Intergenic
1098917866 12:76275899-76275921 CAGAGAGAGGGGAGGGAGGAAGG + Intergenic
1098986073 12:77013728-77013750 CTGAGGAAGAGGAAGGAGAAGGG - Intergenic
1100588230 12:95999266-95999288 CAGAGGCTGAGGTGGGAGGATGG + Intergenic
1100595478 12:96068237-96068259 GGGAGGCTGAGGAGGGAGGATGG - Intergenic
1100633348 12:96409958-96409980 TTGAGGAAGTAGAGGGAGAAGGG - Intergenic
1100726517 12:97414569-97414591 CTGAGGTATTGGAGGGAGGAAGG - Intergenic
1100767266 12:97881066-97881088 CTGAGGAGGTGGAGTGAGAATGG - Intergenic
1101207276 12:102501197-102501219 CGGAGGCTGAGGCGGGAGGATGG + Intergenic
1101213175 12:102555005-102555027 CTGAGACAATGGAAGGAGAAAGG - Intergenic
1101237717 12:102806222-102806244 CTGAGGCACTGCAGGGGGGGAGG + Intergenic
1101245210 12:102878373-102878395 CTGAGCCAGTGTAGTGGGGAAGG + Intronic
1101480203 12:105089272-105089294 CAGAGGCCGAGGCGGGAGGATGG - Intergenic
1101911229 12:108861517-108861539 CGGAGGCAGAGGCAGGAGGATGG - Intronic
1102038637 12:109786681-109786703 CTGGGGCAGTGGGGCCAGGATGG - Intronic
1102050629 12:109859157-109859179 CAGAGGCTGAGGTGGGAGGATGG - Intronic
1102243346 12:111339354-111339376 CTGAGGCAGAGGAGGGAGGGAGG - Intronic
1102460433 12:113096625-113096647 ATGTGGCAGGGGAGGGAGGGAGG + Intronic
1102571911 12:113831893-113831915 CTGCAGCAGTGCAGGGAGGCTGG - Intronic
1102637785 12:114339440-114339462 CTGGAGCAGTGGAGGGCGGGAGG + Intergenic
1102959695 12:117084709-117084731 CTGAGTCAGGGGAGGGAGGCTGG - Intronic
1102989379 12:117303786-117303808 CTGAGTTTGTGCAGGGAGGATGG + Intronic
1103164031 12:118754835-118754857 CTGAGCCACTGGCTGGAGGAGGG - Intergenic
1103198982 12:119070909-119070931 CAGAGGCAGTGGAGTAAAGACGG - Intronic
1103252080 12:119508655-119508677 CTGAAGCTGAGGAGGGAGGCAGG + Intronic
1103355016 12:120313450-120313472 GGGAGGCAGAGGTGGGAGGATGG - Intergenic
1103497961 12:121377499-121377521 CGGAGGCTGAGGTGGGAGGATGG - Intronic
1103649355 12:122421664-122421686 GTGGGGCTGTGCAGGGAGGAGGG + Intronic
1103682032 12:122701840-122701862 CTGAGGCAGATGTGGGAAGAAGG + Exonic
1103683780 12:122715301-122715323 CTGAGGCAGATGTGGGAAGAAGG + Exonic
1103846268 12:123903797-123903819 CAGAGGCAGTGGGCGGAGGCTGG - Intronic
1103939790 12:124495493-124495515 GTGTGGCAGTGGATGGAGGAGGG - Intronic
1104063475 12:125287171-125287193 CAGAAGCAGAGGAGGGAGGGAGG - Intronic
1104328828 12:127825498-127825520 CTGGGGCAGAGCAGTGAGGACGG - Intergenic
1104468603 12:129009951-129009973 CTGGGGCAGAGGAGGGGGTAAGG + Intergenic
1104588938 12:130068968-130068990 CTGAGGCTGTGTGGGGAGGGAGG + Intergenic
1104603458 12:130169461-130169483 CAGGGACAGAGGAGGGAGGAGGG + Intergenic
1104604406 12:130177423-130177445 GGGAGGCCGAGGAGGGAGGATGG - Intergenic
1104698256 12:130880825-130880847 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1104759688 12:131289479-131289501 CTGAGGCTGTGCAGGGAGGAGGG - Intergenic
1104772727 12:131373881-131373903 CGGAGGCTGAGGTGGGAGGATGG - Intergenic
1104803285 12:131569347-131569369 CTGAGGAGAGGGAGGGAGGAGGG - Intergenic
1104821025 12:131677734-131677756 CTGAGGCTGTGTAGGGAGGAGGG + Intergenic
1104919860 12:132285149-132285171 CTGAGGGAGGGCAGGCAGGAGGG - Intronic
1105218230 13:18302821-18302843 CGGAGGCTGAGGTGGGAGGATGG - Intergenic
1105515402 13:21085254-21085276 AGGAGGCAGAGGTGGGAGGATGG + Intergenic
1105774040 13:23639752-23639774 CTGAGGCAGTGGTGGGAGGGAGG + Intronic
1106458581 13:29948727-29948749 CTGTGGCGGTGGAAGGAGGTGGG - Intergenic
1106615461 13:31323097-31323119 CTGTTGCAGGGGACGGAGGAGGG + Intronic
1107112545 13:36713454-36713476 CAGAGGCTGGGGAGGGTGGAGGG - Intergenic
1107164125 13:37265479-37265501 CACAGGCTGTGGAGGGAGCATGG - Intergenic
1107480661 13:40783165-40783187 GGGAGGCAGAGGTGGGAGGATGG + Intergenic
1108057230 13:46497037-46497059 GGGAGGCAGAGGTGGGAGGATGG + Intergenic
1108441898 13:50462708-50462730 CTCAGGGAGTGGGGGCAGGAAGG + Intronic
1108459636 13:50652402-50652424 CTCAGGAAGTGGAGGGAGTTTGG - Intronic
1108584676 13:51860139-51860161 GGGAGGCCGAGGAGGGAGGATGG - Intergenic
1108688222 13:52839168-52839190 TTGAGGCTGAGGAGGGAGGCAGG + Intergenic
1110479660 13:75959542-75959564 CTGAGTCAGGGGAAGGAGGCTGG + Intergenic
1111226984 13:85287718-85287740 GTGAGGCAGGAGAGAGAGGAGGG + Intergenic
1111600303 13:90464795-90464817 AGGAGGCTGAGGAGGGAGGATGG - Intergenic
1111773023 13:92623059-92623081 GGGAGGCTGTGGTGGGAGGATGG + Intronic
1112005374 13:95249114-95249136 CAGAGGCTGAGGTGGGAGGATGG + Intronic
1112373540 13:98816887-98816909 ATGAGGCTGTGGAGGTGGGAAGG + Intronic
1112728360 13:102330744-102330766 ATGAGGCCATGAAGGGAGGAGGG - Intronic
1113433117 13:110267254-110267276 ATGACCCAGTGGAGGGAGGAGGG + Intronic
1114441002 14:22747528-22747550 GGGAGGCTGAGGAGGGAGGATGG + Intergenic
1114450093 14:22819683-22819705 CTGAGTCAGGGGAGAGGGGAAGG + Intronic
1114482561 14:23044701-23044723 CTGAGGCTGGGGAGTGAGCAAGG - Intergenic
1114532221 14:23403210-23403232 CGGAGTGAGTGGAGGGAGAAGGG + Intronic
1115241477 14:31254559-31254581 GGGAGGCTGAGGAGGGAGGATGG - Intergenic
1115529923 14:34317588-34317610 CTGAGGAACTGAAGGCAGGAAGG + Intronic
1115658636 14:35468087-35468109 CTGAGGCAGTGGGGGTGGGGGGG + Intergenic
1115662142 14:35507115-35507137 ATCAGACAGAGGAGGGAGGAAGG + Intergenic
1116133236 14:40887729-40887751 AAGACTCAGTGGAGGGAGGAAGG + Intergenic
1116560249 14:46369565-46369587 CTGAGGCAGTGAAGGGATCAGGG + Intergenic
1116889831 14:50257472-50257494 TGGAGGCCGAGGAGGGAGGATGG - Intronic
1116962805 14:50983993-50984015 CTGAGGGAGGGGAGGAGGGATGG + Intronic
1117398025 14:55330684-55330706 GGGAGGCTGTGGTGGGAGGATGG + Intronic
1117579487 14:57137819-57137841 GGGAGGCAGAGGTGGGAGGATGG - Intergenic
1117671948 14:58117057-58117079 CTGGAGAAGTGGAGGCAGGAGGG - Intronic
1117875290 14:60245760-60245782 ATGATGTAGGGGAGGGAGGAAGG + Exonic
1118171973 14:63396296-63396318 AAGAAGCAGTGGGGGGAGGAGGG + Intronic
1118638582 14:67771121-67771143 TTGAGACAGAGGAGGGTGGAAGG - Intronic
1118837238 14:69485606-69485628 CTCAGGCTAAGGAGGGAGGAAGG + Intronic
1118985888 14:70754574-70754596 CTGAGGCTGAGGCGGGAGAATGG - Intronic
1119162801 14:72467392-72467414 CTGAGGCAGTAAAAGCAGGAAGG - Intronic
1119170893 14:72535691-72535713 ATGAGGAAGTAGAGGGAGCAAGG - Intronic
1119456106 14:74756836-74756858 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1119500488 14:75122901-75122923 GGGAGGCTGAGGAGGGAGGATGG - Intronic
1119505261 14:75167372-75167394 AAGAGGCAGGGGAGGGAGGAAGG - Intronic
1119634650 14:76264124-76264146 GACAGGCAGAGGAGGGAGGATGG + Intergenic
1119703956 14:76772765-76772787 GCGAGGCAGTCGGGGGAGGAGGG - Intronic
1119715149 14:76853855-76853877 CGGAGGCCGAGGTGGGAGGATGG - Intronic
1119726906 14:76926952-76926974 CTCAGGCAGCTGAGGAAGGAAGG - Intergenic
1120468811 14:84896597-84896619 CTCAAGCAGTGGAGGAAGGATGG - Intergenic
1120953726 14:90063526-90063548 CTGGAGCAGGGGAGGGAGGTTGG + Intronic
1120963152 14:90143310-90143332 GGGAGGCTGAGGAGGGAGGATGG - Intronic
1121055368 14:90847372-90847394 CTCAGGGAGTGGGGGCAGGAGGG + Intergenic
1121186691 14:91978601-91978623 CTGAGGCTGAGGCAGGAGGATGG - Intronic
1121321516 14:92994351-92994373 CTGAGGCAGGGGCGGGAGAGTGG + Intronic
1121435212 14:93914783-93914805 CTGAGGCAGTGGAGAAGAGATGG - Intergenic
1121537591 14:94701494-94701516 CAGAGTCAGTGCAGTGAGGAGGG + Intergenic
1121557703 14:94850848-94850870 AGGAAGGAGTGGAGGGAGGAAGG + Intergenic
1121641067 14:95485248-95485270 CTGATGCAGTTGAGGCAAGAAGG - Intergenic
1121656902 14:95603772-95603794 GGGAGGCAGAGGCGGGAGGATGG + Intergenic
1121739864 14:96243725-96243747 CTGAGGCAGAGGAGAGTGGGTGG - Exonic
1121797195 14:96744824-96744846 GGGAGGCAGAGGTGGGAGGATGG + Intergenic
1122307444 14:100774701-100774723 GTGAGGCTGAGGCGGGAGGATGG - Intergenic
1122565823 14:102655048-102655070 GGGAGGCTGAGGAGGGAGGATGG - Intronic
1122692811 14:103539169-103539191 CTGAGGCACGGAAGGGAGCATGG - Intergenic
1122805365 14:104253672-104253694 CTGAGGGAGTGGAGGGCTGGGGG + Intergenic
1122874333 14:104656602-104656624 CTGAGGACGTGGAGGGCGGTGGG + Intergenic
1122882638 14:104696974-104696996 CTGAAGCAGTGGCGGGGGTAGGG - Intronic
1122920020 14:104876165-104876187 CTGGGGCAGGGGATGGAGCAGGG + Intronic
1123035277 14:105469391-105469413 CTGAGGCCGTGGTGGGCGGTGGG + Intronic
1123677822 15:22729222-22729244 CTGAGGAAGAGGAGGAAGGAGGG + Intergenic
1123684034 15:22784966-22784988 TGGAGGCAGAGGTGGGAGGATGG - Intronic
1124256497 15:28146889-28146911 AAGAGGCAGGGGAGGAAGGAGGG + Intronic
1124330023 15:28803486-28803508 CTGAAGAAGAGGAGGAAGGAGGG + Intergenic
1124567733 15:30832204-30832226 AAGAGGCAGGGGAGGAAGGAGGG - Intergenic
1124899801 15:33811404-33811426 CTGAGGCAGAGGCAGGAGAATGG + Intronic
1124937327 15:34185657-34185679 CTGAGACAATGCAGGGAAGAAGG + Intronic
1125102135 15:35926463-35926485 GGGAGGCAGTGGTGGGAAGATGG + Intergenic
1125294261 15:38185198-38185220 TAGAGGAAATGGAGGGAGGAGGG + Intergenic
1125456518 15:39865552-39865574 GTGAGGAGGTGGAAGGAGGATGG + Intronic
1125477345 15:40055972-40055994 CTGAGTCAGGTGTGGGAGGAGGG + Intergenic
1125550511 15:40541163-40541185 CTCACGCAGAGGAGAGAGGAGGG - Intronic
1125594446 15:40875304-40875326 CGGAGGCTGAGGTGGGAGGATGG + Intergenic
1125624847 15:41099675-41099697 GGGAGGCTGAGGAGGGAGGATGG + Intronic
1125965119 15:43868501-43868523 TTCAGGCAGTGCAGGAAGGAAGG + Intergenic
1126087294 15:45022466-45022488 CTGAGGCTGTGGGTGGAGCACGG - Intergenic
1126113621 15:45189337-45189359 CTGAGGCAGTGGGGGAAAGGGGG - Intronic
1126125524 15:45292137-45292159 CTTGGCCAGTGGAGGCAGGATGG - Intergenic
1126678412 15:51181715-51181737 CGGAGGCAGTGAGAGGAGGAGGG + Intergenic
1126751053 15:51876956-51876978 CGGAGGCTGAGGTGGGAGGATGG + Intronic
1126849075 15:52786785-52786807 AGCAGGCAGTGGGGGGAGGAGGG + Intronic
1127456513 15:59160512-59160534 CGGAGGCTGAGGTGGGAGGATGG - Intronic
1127595577 15:60478914-60478936 CTCATGCAGGGGCGGGAGGAGGG - Intronic
1127877725 15:63125075-63125097 CTTAGGGAGTCCAGGGAGGAAGG + Intronic
1127982920 15:64047169-64047191 GTGAGGGGGTGAAGGGAGGAAGG + Intronic
1128056408 15:64702978-64703000 CTGGAGCAGATGAGGGAGGATGG + Intronic
1128146141 15:65333419-65333441 CAGAGGAAGGGGAGGGGGGATGG + Intronic
1128363454 15:66979561-66979583 ATGAGAAAGGGGAGGGAGGAAGG - Intergenic
1128514467 15:68333797-68333819 CAGAGGCTGGGGAGGGAGGCTGG - Intronic
1128575590 15:68772333-68772355 CAGATTCAGTGGAGGGAAGATGG - Intergenic
1128649306 15:69398824-69398846 CTGAGTCAGAGGAGGGCAGAGGG + Intronic
1129005486 15:72369640-72369662 CAGAGGCTGAGGTGGGAGGATGG - Intronic
1129102177 15:73275548-73275570 CGGAGGCTGAGGTGGGAGGATGG + Intronic
1129200156 15:73993876-73993898 CTGAGGTGGTGGGGGCAGGAGGG - Intronic
1129414361 15:75367005-75367027 CTGAGCCAGTGAAGGGAGGAAGG + Intronic
1129644565 15:77419193-77419215 CAGAGGCAGGCGGGGGAGGAGGG + Intronic
1129737640 15:77974982-77975004 CAGAAGCAATGGAGGGAGGCAGG - Intergenic
1129793167 15:78355415-78355437 CAGAGGCTGAGGTGGGAGGATGG + Intergenic
1129878332 15:78991649-78991671 CTGAGGAAGCGGGGGGAGGCGGG + Intronic
1129889976 15:79065531-79065553 CTGGGGCATTGGCAGGAGGAAGG + Intronic
1130048057 15:80461382-80461404 CAGAGGGAGTGAAGGGAGGCCGG + Intronic
1130099142 15:80878892-80878914 CTGGGGCAGTGGAGGGAAGAGGG - Intronic
1130323858 15:82863042-82863064 AAGAAGCAGTGGAGAGAGGAGGG - Intronic
1130345817 15:83043729-83043751 CTTATGCACTGGAGGGATGAGGG + Intronic
1130352674 15:83106149-83106171 TAGAGGCAGTGGAGAGATGAGGG - Intergenic
1130553735 15:84908660-84908682 GTGAGGCTGGGAAGGGAGGAGGG - Intronic
1130843967 15:87726930-87726952 GTGAGTCAGAGGAGGGAAGATGG + Intergenic
1130857734 15:87856092-87856114 AAGAGGCAGTGGAAGGAAGAAGG - Intergenic
1130859001 15:87869266-87869288 CAGAGTCAGTGGGGAGAGGAGGG + Intronic
1131014154 15:89043513-89043535 AGGAGGAAGAGGAGGGAGGAGGG + Intergenic
1131030645 15:89183729-89183751 CAGAGGTAGGGAAGGGAGGAGGG - Intronic
1131072800 15:89476687-89476709 CTGATGCAGTGGAGGCAGGGAGG + Intronic
1131284853 15:91048376-91048398 CAGAGGCTGAGGAAGGAGGATGG - Intergenic
1131446462 15:92502041-92502063 CTGAGGTTCTGCAGGGAGGAGGG - Intergenic
1131468058 15:92671389-92671411 AGGAGGCTGAGGAGGGAGGATGG - Intronic
1131764972 15:95665762-95665784 ATGAGGCAGTGAAGGCAGGGAGG + Intergenic
1131798110 15:96041295-96041317 CTCAGAGAGTGGAGGGTGGAAGG + Intergenic
1131825738 15:96321761-96321783 CTGAGGCCGAGGAGGAAGGCAGG - Intergenic
1132313917 15:100877479-100877501 GTGGTGCAGTGCAGGGAGGAGGG - Intergenic
1132452847 15:101977804-101977826 CTGAGGCTGAGGAAGGAGAAGGG - Intergenic
1132454050 16:12822-12844 CTGAGGCTGAGGAAGGAGAAGGG + Intergenic
1132481674 16:169393-169415 CTGGGGCAGGGAGGGGAGGAGGG - Intergenic
1132685153 16:1159046-1159068 CTGAGGCACTTCAGGGTGGAGGG + Intronic
1132745563 16:1434794-1434816 CTCCGGCTGTGGAGTGAGGAGGG - Exonic
1132754483 16:1475919-1475941 CAGAGGCTGAGGCGGGAGGATGG - Intergenic
1132889032 16:2195359-2195381 CTGTGGGGGTGGAGGGAGGAGGG + Intronic
1133132739 16:3687741-3687763 CAGAGGCTGAGGAGGAAGGATGG + Intronic
1133142768 16:3760194-3760216 CTGAGGCTGAGGCAGGAGGATGG - Intronic
1133200594 16:4202028-4202050 GGGAGGCAGAGGTGGGAGGATGG - Intronic
1133206468 16:4237173-4237195 CGGAGGCAGAGGCAGGAGGATGG - Intronic
1133236806 16:4391181-4391203 GGGAGGCTGTGGTGGGAGGACGG + Intronic
1133299964 16:4776433-4776455 CTGGGGCAGGGGAATGAGGAAGG + Intergenic
1133305220 16:4804195-4804217 AAGAGGGAGAGGAGGGAGGATGG + Exonic
1133308770 16:4829136-4829158 CTGAGGGAGTGGTGAGAGCAAGG - Intronic
1133418014 16:5621514-5621536 TTGAGGAAATGGAGGGAGGGAGG + Intergenic
1133742170 16:8659963-8659985 GTGAGGCTGAGGTGGGAGGATGG - Intergenic
1133748976 16:8709909-8709931 CTCAGGCGGCGGAGGGAGGATGG - Intronic
1133784209 16:8962906-8962928 CTCAGGCAGCGGAGGGACGGAGG - Intronic
1134084785 16:11348904-11348926 CTGGGGCAGTGGTGGAAGGTAGG + Intronic
1134333555 16:13272465-13272487 CTGAGGTCGAGGTGGGAGGATGG - Intergenic
1134350595 16:13434279-13434301 CTGAGTCAGTGGACTGAGAAAGG - Intergenic
1134604642 16:15560686-15560708 TGGAGGCTGAGGAGGGAGGATGG + Intronic
1135236695 16:20763468-20763490 GTGAGGCAGAGGAAGGAGAATGG + Intronic
1135262973 16:20997384-20997406 CTGAGGCAGTGGATTGACCATGG - Exonic
1135283921 16:21176793-21176815 AAGAGGCTGAGGAGGGAGGATGG + Intronic
1135593416 16:23722188-23722210 CTGAAACAGTGGAGGGTGGGAGG - Intergenic
1135713459 16:24738957-24738979 GGGAGGCAGTGGTGAGAGGATGG - Intronic
1135719097 16:24799724-24799746 AATAGGCAGTGAAGGGAGGAAGG - Intronic
1135892693 16:26371685-26371707 GTGGGGGAGGGGAGGGAGGAAGG + Intergenic
1136471108 16:30480890-30480912 CGGAGGCTGACGAGGGAGGATGG + Intronic
1136477714 16:30524052-30524074 CTGAGGAAGAAGAGGGAGGCTGG + Exonic
1136483957 16:30559212-30559234 CGGAGGCAGTGGGGAGAGTAGGG + Intergenic
1136495534 16:30641239-30641261 CGGAGGCTGAGGTGGGAGGATGG - Intergenic
1136498516 16:30658452-30658474 CTGAGGAGGAAGAGGGAGGAGGG + Exonic
1136690515 16:32025075-32025097 GTAATGGAGTGGAGGGAGGAGGG + Intergenic
1136791102 16:32968635-32968657 GTAATGGAGTGGAGGGAGGAGGG + Intergenic
1136878712 16:33885297-33885319 GTAATGGAGTGGAGGGAGGAGGG - Intergenic
1137445516 16:48529569-48529591 ATGTGGCCATGGAGGGAGGAGGG - Intergenic
1137456095 16:48618965-48618987 GGGAGGCTGTGGTGGGAGGATGG + Intronic
1137684251 16:50374784-50374806 CTGAGGAGGGGGAGGGAGGCAGG + Intergenic
1137699937 16:50490214-50490236 CATGGGCACTGGAGGGAGGATGG + Intergenic
1137715856 16:50597976-50597998 CACTGGCAGTAGAGGGAGGAGGG + Intronic
1137738955 16:50746140-50746162 GTGAGGCTGAGGTGGGAGGATGG - Intronic
1137977926 16:53046578-53046600 GGGAGGCTGAGGAGGGAGGATGG + Intergenic
1138143607 16:54588988-54589010 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1138159860 16:54743456-54743478 TGGAGGCAGTGCAGGGAGAAAGG - Intergenic
1138245334 16:55463020-55463042 CTGATGCAGTGGAGGAATGAAGG - Intronic
1138346046 16:56320831-56320853 CTGGGACAGTGGTGGGAAGAGGG + Intronic
1138493092 16:57388355-57388377 CTGAGGCGGGGGTGGGAGAATGG - Intergenic
1138560781 16:57799904-57799926 CTGAGCCTGTGGAGGGAGAAGGG + Intronic
1138574270 16:57897544-57897566 CTGGGGCAGAGAAGGGAGGAAGG + Intronic
1139139687 16:64246198-64246220 CTGAAAGTGTGGAGGGAGGAAGG + Intergenic
1139310364 16:66023376-66023398 CACAGGCAGCCGAGGGAGGAAGG + Intergenic
1139405709 16:66716093-66716115 GGGAGGCAGGGCAGGGAGGATGG + Intergenic
1139511978 16:67432718-67432740 CTGAGGCAGAGTAGGGGGGAAGG + Intronic
1139586618 16:67908046-67908068 CCCAGGCAGAGGAGTGAGGAGGG + Intronic
1139651874 16:68366255-68366277 CTGCAGCAGTGAAGGAAGGACGG - Intronic
1139661068 16:68421231-68421253 GTGAAGCAGATGAGGGAGGATGG - Intronic
1139827224 16:69766685-69766707 CTGAGGAAGTGAGGGAAGGAAGG - Intronic
1139939730 16:70596562-70596584 CTGAGGCAGTGGTGGGAAATGGG - Intronic
1140050919 16:71480286-71480308 CTGAGGCAGTGCTGGGATGAGGG - Intronic
1140230456 16:73113240-73113262 CAGAGGAAGTGAAGGGAGGAAGG + Intergenic
1140317809 16:73916012-73916034 GAGAGGCAGAGGAGGGAGGAGGG - Intergenic
1140354896 16:74297157-74297179 CTGGGGCAGGGGCGGGAGGCTGG - Intronic
1140566512 16:76049063-76049085 GGGAGGCTGTGGTGGGAGGAGGG + Intergenic
1140648239 16:77057523-77057545 CTTGGACAGTGGTGGGAGGAGGG + Intergenic
1140692616 16:77498833-77498855 CAGAGGCGGGGGAGGAAGGAAGG + Intergenic
1141141661 16:81500409-81500431 GGGAGGGAGGGGAGGGAGGAGGG - Intronic
1141142988 16:81509454-81509476 CAGAGGCAGTGCACGCAGGAAGG - Intronic
1141332735 16:83126959-83126981 ATGAAGGAGTAGAGGGAGGAGGG + Intronic
1141360631 16:83392172-83392194 ATGAGGCAGTGGGGCCAGGATGG - Intronic
1141498404 16:84426227-84426249 CAGGGGCAGGAGAGGGAGGAAGG + Intronic
1141621313 16:85238042-85238064 TAGGGGCAGTGGAGAGAGGAGGG + Intergenic
1141651435 16:85395119-85395141 CTGAGGATGAGGAGGAAGGATGG + Intergenic
1141683079 16:85555351-85555373 CTGAGTCAGTGGTGGGACGCCGG + Intergenic
1141772180 16:86096187-86096209 CTGGGGCAGTGGAGCAGGGATGG - Intergenic
1141834510 16:86529842-86529864 TGGAGGCTGAGGAGGGAGGATGG + Intergenic
1141956594 16:87376079-87376101 CTGTGGCAGTGGAGGGCAGGGGG - Intronic
1142228691 16:88889357-88889379 CTGGGGCAGCGGAGGGAGGGAGG + Intronic
1142419932 16:89963945-89963967 CTTAGGGAGTGGAGGGCGGGGGG + Intronic
1203093310 16_KI270728v1_random:1230096-1230118 GTAATGGAGTGGAGGGAGGAGGG + Intergenic
1142519610 17:495672-495694 GGGAGGCCGAGGAGGGAGGATGG - Intergenic
1142521454 17:507667-507689 TTGGGGCTGTGGAGGGAGGGAGG + Intergenic
1142548192 17:720426-720448 GTGAGGGAGTTGGGGGAGGATGG + Intronic
1142548247 17:720661-720683 GTGAGGGAGTTGGGGGAGGATGG + Intronic
1142548267 17:720748-720770 GTGAGGGAGTTGGGGGAGGATGG + Intronic
1142548308 17:720935-720957 CTGAGGGAGTTGGGGGAGGATGG + Intronic
1142620815 17:1164769-1164791 CGGAGGCTGAGGTGGGAGGATGG - Intronic
1142632242 17:1232551-1232573 CGCAGGCTGAGGAGGGAGGATGG - Intergenic
1142737983 17:1913656-1913678 GGGAGGCTGGGGAGGGAGGATGG + Intergenic
1142951206 17:3481964-3481986 CAGAGGCAGTGGTGAGAGGAAGG + Intronic
1142975874 17:3643932-3643954 AGGCGGCAGTGGTGGGAGGATGG + Intronic
1142990754 17:3729210-3729232 ATGACGCTGTGGAGGGAAGAAGG - Intronic
1143087324 17:4425859-4425881 GGGAGGCAGAGGTGGGAGGATGG + Intergenic
1143390591 17:6556972-6556994 CAGAGGGAGCGGAGAGAGGAAGG + Intergenic
1143461617 17:7108034-7108056 CTGTGGCAGTGCAGGGAGCCTGG - Intronic
1143580826 17:7824632-7824654 CTGAGCCAGAGGCGGAAGGATGG - Exonic
1143628086 17:8122307-8122329 GTGGGGCAGCGGAGGGAGGGAGG - Intronic
1143866407 17:9926816-9926838 GTAAGCCAGTGCAGGGAGGAGGG + Intronic
1144235651 17:13258025-13258047 AGGAGGCAGTGGAGGGGGAAGGG - Intergenic
1144329448 17:14211120-14211142 CAGTGGCAGTGGAGGGGGGGTGG - Intergenic
1144825185 17:18101785-18101807 CTGAGGCAGCAAGGGGAGGAAGG + Intronic
1144847280 17:18226472-18226494 CTGGAGCAGTGGGGGAAGGAAGG - Intronic
1144955763 17:19018108-19018130 CTGAGGGAGAGGGTGGAGGAAGG - Intronic
1145035528 17:19537833-19537855 CTGAGGCACTGAAAGGAGGCTGG - Intronic
1145242372 17:21247530-21247552 CCGAGGCCCAGGAGGGAGGAAGG + Intronic
1145242672 17:21248907-21248929 CTCAGGCCCAGGAGGGAGGAGGG - Intronic
1145246515 17:21273255-21273277 CTGAGGCTGTGGTGGCAGGTAGG - Intergenic
1145911734 17:28547155-28547177 CTGAGTCAATGTTGGGAGGAAGG - Exonic
1145994437 17:29097359-29097381 TTGAGGCAGACAAGGGAGGATGG + Intronic
1146003108 17:29143335-29143357 CGGAGGCTGAGGTGGGAGGATGG - Intronic
1146010570 17:29191236-29191258 CTGAAGGAGAGGAAGGAGGAAGG - Intergenic
1146315765 17:31805703-31805725 CTGGGGCATGGAAGGGAGGAGGG + Intergenic
1146327457 17:31899190-31899212 CAGAGGCTGAGGTGGGAGGATGG + Intronic
1146329497 17:31916369-31916391 CGGAGGCTGTGGAGGGAGAATGG - Intergenic
1146507317 17:33416598-33416620 CAGTGGCAGCTGAGGGAGGATGG + Intronic
1146519700 17:33516797-33516819 CCCAGGCATGGGAGGGAGGAGGG - Intronic
1146739579 17:35270771-35270793 CTGGGGTAGGGGAGGGAGGGTGG - Exonic
1146748568 17:35354483-35354505 CTGTGGCAGTGGAGGAGGGGGGG - Intronic
1146798237 17:35798062-35798084 CGGAGGCTGAGGTGGGAGGATGG - Intronic
1147153374 17:38531211-38531233 GTAATGGAGTGGAGGGAGGAGGG + Exonic
1147186386 17:38715589-38715611 CTGAAGGAGAGGAGAGAGGAAGG - Intronic
1147266394 17:39237307-39237329 GTCAGGCAGAGGAGGGAGGGAGG + Intergenic
1147360582 17:39927363-39927385 CAGAGGGAGTGGGGGGTGGAGGG - Intronic
1147403697 17:40195697-40195719 CTGAGGGAGGGGAGAGGGGATGG + Intergenic
1147459808 17:40560985-40561007 ATGAGTCAGTGGAGGGCGGGTGG - Intronic
1147689103 17:42304666-42304688 CTGGAGCAGTGGGGGCAGGAGGG - Intronic
1147725521 17:42564197-42564219 CAGAGGGAGTGGATGGGGGACGG + Intronic
1147786468 17:42981719-42981741 CTGAGGCTGAGGCGGGAGGATGG - Intronic
1148012388 17:44493646-44493668 GGGAGGCAGAGGTGGGAGGATGG + Intronic
1148090536 17:45020326-45020348 CTGAGGCAGAGGAGCTAGGAAGG + Intergenic
1148242076 17:46006421-46006443 CAGAGGCTGAGGAGGGTGGAGGG + Intronic
1148459742 17:47832382-47832404 CTAAGACAGTTGAGTGAGGATGG - Intronic
1148562031 17:48611782-48611804 CAGAGGCAGCGAAGGAAGGAAGG + Intronic
1148813110 17:50307472-50307494 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1148860561 17:50602322-50602344 CTGGGGCAGGGCAGGGAGGAAGG - Intronic
1149217399 17:54373608-54373630 ATGGGGCTGAGGAGGGAGGATGG + Intergenic
1149595323 17:57861808-57861830 CTGGGGCCCTGGAGGGAGGGGGG - Exonic
1149637953 17:58185404-58185426 CTGAGGGTGTGCAGGGAGGAGGG - Intergenic
1149685671 17:58533153-58533175 CTCAGCCAGGGGAGGGAAGAGGG + Intronic
1149758035 17:59204289-59204311 GTGAGGCTGAGGTGGGAGGATGG + Intronic
1150245423 17:63671108-63671130 CTGATGAAGTGGAGAGAGGAAGG + Intronic
1150386467 17:64765519-64765541 CTGAGAATGGGGAGGGAGGAGGG - Intergenic
1150637462 17:66924231-66924253 TTCAGGCAATAGAGGGAGGATGG + Intergenic
1150697735 17:67420371-67420393 GGGAGGGAGGGGAGGGAGGAAGG - Intronic
1150710146 17:67524201-67524223 GTGAGGCTGTGGCGGGAGGATGG + Intronic
1150752454 17:67877870-67877892 GAGAGGCAGAGGCGGGAGGATGG - Intronic
1150796808 17:68245340-68245362 GGGAGGCAGAGGTGGGAGGATGG - Intergenic
1150822920 17:68450247-68450269 CTGAGGACGTGGTGGGAGAAGGG + Intronic
1150963551 17:69940876-69940898 CTGAGGCTGTGCAGGGAAGCAGG - Intergenic
1151569828 17:74920727-74920749 TGGAGGGAGTGGAGGGGGGAGGG + Intronic
1151671975 17:75575864-75575886 GGGAGGCAGTGGAGAGCGGAAGG + Intergenic
1151759174 17:76090894-76090916 CAGAGACAGGGAAGGGAGGAGGG + Intronic
1151953065 17:77365922-77365944 CCGATGCAGTGCAGGGATGAGGG - Intronic
1152163694 17:78686713-78686735 CAAAGGCAGGGGAGGGAAGATGG + Intronic
1152182013 17:78828427-78828449 CTGAGGGAGAGCTGGGAGGAGGG - Intronic
1152210786 17:79001958-79001980 GTGGGGCTGGGGAGGGAGGAGGG - Intronic
1152217237 17:79040797-79040819 GTGAGGCTGAGGTGGGAGGATGG + Intronic
1152272221 17:79331388-79331410 CAGAGGCTTTGGAGGCAGGAAGG - Intronic
1152444760 17:80335327-80335349 AAGAGGCAGAGGAGGCAGGAGGG + Intronic
1152469606 17:80483354-80483376 CTGAGGGTGCAGAGGGAGGACGG + Intergenic
1152671844 17:81612937-81612959 CAGCTGCAGGGGAGGGAGGAGGG - Intronic
1152814110 17:82397438-82397460 GTGAGGCAGTGGGGGGTGGATGG + Intronic
1152825909 17:82464637-82464659 CTCAGGCAGTGGTGGGGGGCTGG + Intronic
1152968587 18:139872-139894 CTCAGGCAGCTGAGGCAGGAGGG - Intergenic
1153236467 18:2993038-2993060 CAGAGGCTGAGGTGGGAGGATGG + Intronic
1153342410 18:3989027-3989049 GTGCAGCAGTGGAGGCAGGAGGG - Intronic
1153699993 18:7683272-7683294 GAGAGGCTGAGGAGGGAGGATGG - Intronic
1153801650 18:8676184-8676206 CTGAGCCAGTGGCTGGAGGGTGG + Intergenic
1153833136 18:8940716-8940738 CTGATTCAGTGGAGACAGGAGGG - Intergenic
1154347301 18:13552599-13552621 GTTAGGAAGTGGAGGGAGGAGGG - Intronic
1154357571 18:13633498-13633520 CTGAGGCAGGGGTGGGCTGAGGG - Intronic
1154948224 18:21183349-21183371 CTGAGGCAGTGGTGGCAGTGAGG - Intergenic
1155010025 18:21767914-21767936 CGGGGGCAGTGGGGGGAGCAGGG - Intronic
1155996301 18:32334444-32334466 CACAGGGAGTGGGGGGAGGATGG + Intronic
1156232900 18:35172236-35172258 CTGGGGCAGTGGCAGGAGCATGG - Intergenic
1156292401 18:35759450-35759472 CAGAGGCTGGGGAGGGGGGAGGG + Intergenic
1156347524 18:36271064-36271086 GGGAGGCTGTGGCGGGAGGATGG - Exonic
1156356544 18:36346851-36346873 TTAAGGCAGTGAAGGGAGGCAGG - Intronic
1156449401 18:37258574-37258596 CTGAGGCAGGTGAGTGGGGAGGG + Intronic
1156524925 18:37758001-37758023 GTGTGGCAGTGTAGGGAGGCAGG + Intergenic
1156536447 18:37869194-37869216 CTAGGTCATTGGAGGGAGGAGGG + Intergenic
1156551404 18:38022742-38022764 GAGAGGCAGTGGAGGGAGGGAGG - Intergenic
1156551470 18:38023627-38023649 CTGAGGCTGTGGTGGGAGTGGGG - Intergenic
1156737464 18:40277896-40277918 CAGAGGCTTTGGAGGGAGCATGG + Intergenic
1157192051 18:45589828-45589850 CTGGGGCAGGGAGGGGAGGAGGG + Intronic
1157257732 18:46153394-46153416 CACAGGCAGTGGAGGGAGAGGGG + Intergenic
1157294301 18:46431514-46431536 CTGGGGCTGTGGAGGGTGCAGGG + Intronic
1157493415 18:48139171-48139193 GTGCGGGAGTGGAGGCAGGAGGG + Intronic
1157547943 18:48560673-48560695 AGGAGGCTGAGGAGGGAGGATGG - Intronic
1158257750 18:55572407-55572429 CTGAGAAAATGGAGTGAGGAGGG + Intronic
1158630440 18:59109388-59109410 CTAAGGCATTGGAGGGAGGGAGG + Intergenic
1158962777 18:62600506-62600528 CTGAGGCAGAGGTAGGGGGAGGG + Intergenic
1159605071 18:70466518-70466540 GTGAGGCAGAGAAGGGAGGTGGG + Intergenic
1159995522 18:74960647-74960669 CTGAGTCAGTGCTGGGTGGAGGG + Intronic
1159995530 18:74960683-74960705 CTGAGTCAGTGCTGGGTGGAGGG + Intronic
1159995561 18:74960827-74960849 CTGAGTCAGTGCTGGGTGGAGGG + Intronic
1159995568 18:74960863-74960885 CTGAGTCAGTGCTGGGTGGAGGG + Intronic
1160388166 18:78510479-78510501 CTAAGGAAGTGGAGTGAGGACGG + Intergenic
1160476692 18:79196376-79196398 ATAAAACAGTGGAGGGAGGATGG + Intronic
1160797321 19:951894-951916 GAGAGGCAGAGGCGGGAGGATGG + Intronic
1160799366 19:960660-960682 CTGAGGCCCTGGTGGGAAGAGGG - Intronic
1160848988 19:1180670-1180692 CTGGGGAAGTGGGTGGAGGAAGG - Intronic
1160975533 19:1790549-1790571 GAGGGGCAGTGGAGGGAGAAGGG - Intronic
1160983468 19:1827149-1827171 CTGAGGCTGGGGAGGGCAGAGGG + Exonic
1161186178 19:2922454-2922476 CTGAGGAGGTGGCTGGAGGAGGG + Intergenic
1161220414 19:3115736-3115758 CCGAGGCTGTGAGGGGAGGAGGG + Intronic
1161220458 19:3115864-3115886 CTGAGGCTGTGAGGGGAGGAGGG + Intronic
1161220480 19:3115929-3115951 CCGAGGCTGTGAGGGGAGGAGGG + Intronic
1161323950 19:3654104-3654126 CGGAGGCTGAGGTGGGAGGATGG - Intronic
1161413275 19:4129309-4129331 CGGAGGCTGAGGTGGGAGGATGG - Intergenic
1161458511 19:4382137-4382159 CTCTGACAATGGAGGGAGGAGGG - Intronic
1161551725 19:4916706-4916728 CGGAGGGAGAGAAGGGAGGAAGG - Intronic
1161684807 19:5697490-5697512 CTGAGGCAGAGGGAGGAGGGGGG + Intronic
1161749256 19:6082535-6082557 GGGAGGCTGTGGTGGGAGGATGG - Intronic
1161756429 19:6137460-6137482 GTGAGGAGGGGGAGGGAGGAAGG + Intronic
1161758638 19:6153741-6153763 GGGAGGCAGAGGTGGGAGGATGG + Intronic
1161833897 19:6631717-6631739 AGGAGGCTGAGGAGGGAGGATGG - Intergenic
1161913892 19:7214798-7214820 GGGAGGGAGGGGAGGGAGGAGGG - Intronic
1162164144 19:8740836-8740858 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1162165215 19:8748305-8748327 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1162166280 19:8755759-8755781 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1162167346 19:8763215-8763237 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1162168287 19:8769515-8769537 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1162169354 19:8776968-8776990 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1162170034 19:8782280-8782302 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1162171119 19:8789933-8789955 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1162185255 19:8899974-8899996 GTGGGGCTGGGGAGGGAGGATGG + Exonic
1162186055 19:8905986-8906008 GTGGGGCTGGGGAGGGAGGATGG + Exonic
1162202104 19:9028029-9028051 ATGAGGCTGAGGTGGGAGGATGG - Intergenic
1162262563 19:9544687-9544709 GAGAGGCAGTGGAAGGGGGAAGG - Intergenic
1162309374 19:9896499-9896521 CGGAGGCCGGGGTGGGAGGATGG - Intronic
1162355889 19:10184571-10184593 AGGAGGCTGTGGTGGGAGGATGG + Intronic
1162376193 19:10306708-10306730 GGGAGGCTGAGGAGGGAGGATGG + Intronic
1162522715 19:11191471-11191493 CTGTGGCCTTTGAGGGAGGAAGG - Intronic
1162535980 19:11262845-11262867 CTGAGCCTGAGGAGGGAGGGAGG + Intergenic
1162687432 19:12399746-12399768 CTGAGGCTGAGGTGGGATGATGG - Intronic
1162691745 19:12439589-12439611 CTGAGGCTGAGGTGGGATGATGG - Intronic
1162716141 19:12635574-12635596 CAGAGGCTGAGGTGGGAGGATGG + Intronic
1162788489 19:13051050-13051072 ACTTGGCAGTGGAGGGAGGAGGG + Intronic
1163077521 19:14907880-14907902 CTGGGGCAGTTGAGGGAGAAGGG + Intergenic
1163102747 19:15107808-15107830 CTGAGGGCCTGGAGGGTGGAGGG + Intronic
1163193390 19:15696530-15696552 CTGAGGCAGGGATGGGATGATGG + Intronic
1163299292 19:16433582-16433604 CAGAGGCTGAGGTGGGAGGATGG + Intronic
1163709120 19:18835100-18835122 CAGGGGCTGTGGAGGTAGGACGG - Intronic
1163766303 19:19165253-19165275 GGGAGGCAGTGGAGGGTGGCAGG + Intronic
1163779710 19:19239922-19239944 CAGAGGAATGGGAGGGAGGAAGG - Intronic
1163799634 19:19356724-19356746 GTGAGGCGGTGGAGGGAGTGGGG - Exonic
1163817445 19:19475483-19475505 CTGGGGCAGTGGAGGGGGGGGGG - Intronic
1164404110 19:27927162-27927184 GTGAGGCAGTGGAGAGAGGAAGG + Intergenic
1164676358 19:30104247-30104269 CTGAGGAAGGGGAGGCAGGGGGG - Intergenic
1164839249 19:31380271-31380293 CTGCGGGAGGGGAGGTAGGAAGG + Intergenic
1164909313 19:31992796-31992818 CTGAGGGAGGGGAGCCAGGATGG - Intergenic
1164948365 19:32315255-32315277 GGGAGGCCGAGGAGGGAGGATGG + Intergenic
1164956668 19:32392362-32392384 GGGAGGAAGGGGAGGGAGGAAGG + Intergenic
1165030908 19:32997728-32997750 GGGAGGCAGAGGTGGGAGGATGG - Intronic
1165069760 19:33248516-33248538 GAGAGGGAGAGGAGGGAGGATGG + Intergenic
1165258777 19:34596246-34596268 CTGTGGCTGAGCAGGGAGGATGG + Exonic
1165671450 19:37682816-37682838 AGGAGGCTGTGGCGGGAGGATGG + Intronic
1165762492 19:38329823-38329845 CTGAGCCATGGAAGGGAGGAGGG + Intergenic
1165793564 19:38506188-38506210 TTGAGCCAGGGGAGGGTGGAGGG + Intronic
1165891911 19:39117728-39117750 CTGAAGATCTGGAGGGAGGAAGG - Intergenic
1165915029 19:39253238-39253260 GTGAGGCTGGGGTGGGAGGATGG - Intergenic
1165988945 19:39794951-39794973 AGGAGGCTGAGGAGGGAGGATGG - Intergenic
1166109123 19:40611985-40612007 GTGAGGCCGGGGAGGGAGGGAGG + Intronic
1166151757 19:40880245-40880267 CTGCGGGTGTGGAGGGAGAAGGG + Intronic
1166215427 19:41331505-41331527 CGGAGGCTGAGGCGGGAGGATGG - Intronic
1166516264 19:43449295-43449317 CCAAGGCTGAGGAGGGAGGATGG + Intergenic
1166529100 19:43532131-43532153 CGGAGGCTGAGGTGGGAGGATGG - Intronic
1166698499 19:44867965-44867987 ATGAGGCAGTGGGGGGCAGAGGG + Intronic
1166760462 19:45221025-45221047 CTGAGACAGGGGCGGGGGGAGGG + Intronic
1166853042 19:45769415-45769437 CAGGCGCAGTGGAAGGAGGATGG + Intergenic
1166894750 19:46016403-46016425 CAGGGGCAGGTGAGGGAGGAAGG - Intronic
1166908975 19:46137508-46137530 CTGAGCCAGAGGATGAAGGAAGG + Intergenic
1167000202 19:46741324-46741346 ATGAGGCAGCAGAGGGATGAAGG - Intronic
1167011865 19:46813795-46813817 GAGAGGCAGTGGGAGGAGGAGGG - Intergenic
1167041478 19:47025248-47025270 CTGTGGCAGTTGAGGGAAGGAGG + Intronic
1167058741 19:47130289-47130311 GGGAGGCAGAGGCGGGAGGATGG + Intronic
1167249842 19:48393932-48393954 CTGCGGCGGCGGAGGGAGGGAGG + Intergenic
1167254536 19:48419369-48419391 CCGAGGCGGGGGATGGAGGAAGG - Intronic
1167293272 19:48635875-48635897 CTGGGGCAGTGGTGGGCGGAGGG - Exonic
1167341323 19:48918253-48918275 CTGAGGGAGCCGAGGAAGGAGGG + Intronic
1167417881 19:49386710-49386732 GGGAGGAAGGGGAGGGAGGAGGG + Intergenic
1167515012 19:49918302-49918324 GGGAGGCAGAGGTGGGAGGATGG - Intronic
1167609009 19:50497227-50497249 GAGAGGCAGAGGAGTGAGGAAGG + Intergenic
1167611923 19:50511834-50511856 GGGAGGCAGTGGTGGGAGGAGGG + Intronic
1167633476 19:50639751-50639773 CTGGGGCTGTGGCAGGAGGAGGG + Intronic
1167696904 19:51020094-51020116 CTGTGGAAGAGGAAGGAGGAAGG + Intronic
1167775472 19:51551815-51551837 GTGAGGAAGAGGAGGAAGGAAGG - Intergenic
1167824124 19:51956554-51956576 CAGAGGCTGAGGTGGGAGGATGG + Intergenic
1167951662 19:53032509-53032531 CTGAGGGAGAGAAGGCAGGATGG - Intergenic
1168043425 19:53777061-53777083 TGGAGGCCGTGGTGGGAGGATGG - Intergenic
1168073210 19:53963904-53963926 AGGAGGCAGAGGTGGGAGGATGG - Intronic
1168249432 19:55133332-55133354 GAGAGGGAGAGGAGGGAGGAAGG + Intronic
1168251592 19:55145369-55145391 AGGAGGGAGAGGAGGGAGGAGGG + Intronic
1168316842 19:55488342-55488364 CTGAGGCATGGGGGGGAGGGGGG - Intergenic
1168411272 19:56141617-56141639 CTGAGGGAGAGGACGGGGGAGGG + Intronic
1168432246 19:56290617-56290639 GGGAGGCTGTGGTGGGAGGAAGG + Intronic
1168518742 19:57031695-57031717 CGGGGGCAGCAGAGGGAGGAAGG - Intergenic
1168691882 19:58382238-58382260 CAGATGCAGTGGAGGCAGAAAGG - Intergenic
924987253 2:283400-283422 GTGGGGCAGCGGAGGGAAGAGGG + Intronic
925082165 2:1078843-1078865 CTGAGGGTCAGGAGGGAGGAAGG + Intronic
925213644 2:2073276-2073298 CTAAGGCAGTGATGGGGGGATGG - Intronic
925412320 2:3647067-3647089 CAGAGGCAATGGGGGGATGAGGG - Intergenic
925554158 2:5110895-5110917 CTGAAGTAGGGGAGAGAGGAGGG + Intergenic
926043235 2:9691498-9691520 GTGAGGCAATGGTGGGAGGGAGG - Intergenic
926515057 2:13832974-13832996 CTGGGGCAGGGGTGGGGGGAGGG + Intergenic
926622624 2:15060615-15060637 CTGGGTCAGTGCAGGGAGGATGG + Intergenic
926735640 2:16071308-16071330 TTGAGGCAGAGGAGCTAGGATGG + Intergenic
927182636 2:20457792-20457814 CTGAGGCAGTAGAGGGCAGGAGG - Intergenic
927482379 2:23464531-23464553 CTTAGGCAGGGGAGTGGGGACGG - Intronic
927582824 2:24269610-24269632 CTAAAGCAGTAGAGGAAGGAAGG - Intronic
927637569 2:24827367-24827389 CTGCAGCAGTGCAGTGAGGAGGG - Intronic
927661656 2:24998547-24998569 GGGAGGCAGAGGTGGGAGGATGG - Intergenic
927830979 2:26349866-26349888 CGGAGGCTGAGGTGGGAGGATGG + Intronic
927893981 2:26769680-26769702 CTGAGGCAGAGGTGGCTGGAGGG - Intronic
928097524 2:28413565-28413587 GAGAGGCAGGGGAGGGAGGCGGG + Exonic
928385675 2:30865867-30865889 GTGAGGCAGGGGATGGAGCAAGG + Intergenic
928465927 2:31522318-31522340 CAGAGAAAGTGGAGGAAGGAGGG - Intergenic
928512447 2:32014040-32014062 GGGAGGGAGGGGAGGGAGGAAGG + Intronic
928780808 2:34818181-34818203 CTGTGGCAGGGGAGGGAGCAAGG - Intergenic
928927757 2:36596705-36596727 GAGAGGCTGTGGTGGGAGGATGG - Intronic
928949984 2:36805903-36805925 CTGGGGCTGTGGAAGGAGCAAGG - Intronic
929437665 2:41940701-41940723 CTGGGGCAGTGGGGGGTGGGGGG - Intronic
929567707 2:43000058-43000080 GTGGGGCAGTGGAGGGGGGGTGG - Intergenic
929621949 2:43364117-43364139 GGGAGGCTGAGGAGGGAGGATGG + Intronic
929736485 2:44555441-44555463 GTGAGGATGGGGAGGGAGGATGG + Intronic
929863846 2:45701094-45701116 CTAAGACAGTAGAGGAAGGAAGG + Intronic
929881065 2:45837767-45837789 GTGAGGCTGAGGTGGGAGGAAGG + Intronic
930064510 2:47317407-47317429 ATGAGATGGTGGAGGGAGGAAGG - Intergenic
930116121 2:47719822-47719844 CTGAGGCAGGATAGGGAGGAGGG + Intronic
930639534 2:53840615-53840637 GGGAGGGAGTGGAGGGGGGAGGG + Intergenic
930692670 2:54380396-54380418 CTGAGGCAGTGCAGGGGGGTTGG - Intronic
930763282 2:55059456-55059478 CGGAGGCTGAGGTGGGAGGATGG - Intronic
930807563 2:55506631-55506653 ATGAGGCTGAGGAGGAAGGAAGG - Intergenic
930868272 2:56143500-56143522 CTGAGGCAGTGGGGTGAGGGTGG + Intergenic
930889900 2:56372603-56372625 CTAAGTCTGGGGAGGGAGGATGG + Intronic
931223141 2:60306306-60306328 GGGTGGGAGTGGAGGGAGGAAGG - Intergenic
931308860 2:61059337-61059359 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
931458435 2:62430546-62430568 CTGGGGCAGGGGAAGGAGAATGG + Intergenic
931723806 2:65089315-65089337 CGGAGGCGGAGGCGGGAGGATGG - Intronic
931799825 2:65747672-65747694 GTAGGGCAGGGGAGGGAGGAAGG + Intergenic
932035756 2:68245255-68245277 GGGAGGCTGAGGAGGGAGGATGG + Intronic
932035941 2:68247058-68247080 AGGAGGCAGAGGTGGGAGGATGG - Intronic
932216506 2:69969640-69969662 CTGGGGCAGTGGGGAGAGGATGG - Intergenic
932238516 2:70140003-70140025 CGGAGGCTGAGGTGGGAGGATGG - Intergenic
932322183 2:70830403-70830425 CTAAGGGAGTGGAAGGAGAAGGG + Exonic
932341509 2:70965218-70965240 CGGAGCCAGCGGAGGGCGGAGGG - Exonic
932503817 2:72209407-72209429 CTGAGGCTGAGGTGGGAGGATGG + Intronic
932619611 2:73257982-73258004 CTGAGGCCGTGGAGGAAGCCAGG - Exonic
932654132 2:73593745-73593767 CTGTGGCAGAGGTGGGAGGCTGG - Intronic
932856544 2:75240568-75240590 CTCAGGCACTGGCAGGAGGAGGG - Intergenic
932864105 2:75323665-75323687 CTAAGGAAGAGGAGGGAGAAGGG - Intergenic
933271872 2:80241353-80241375 TAGAGTCAGTTGAGGGAGGAAGG + Intronic
934131767 2:88955530-88955552 CTTAGGCCCTGGAGTGAGGAGGG - Intergenic
934133269 2:88970164-88970186 CTCAGGCCCTGGAGTGAGGAGGG - Intergenic
934234293 2:90216426-90216448 CTCAGGCCCTGGAGTGAGGAGGG + Intergenic
934557563 2:95295512-95295534 CTCAGGCAGTGAAAGGAGGATGG + Intergenic
934654868 2:96112263-96112285 CCCAGGGAGGGGAGGGAGGAAGG - Intergenic
934709002 2:96503174-96503196 TGGAGGCAGTCCAGGGAGGAGGG + Intronic
934856408 2:97732884-97732906 CTGAGGCCGCGGAAGGAGCAGGG + Exonic
935147859 2:100408469-100408491 CTGAGGTAGTGGTAGGAGGAGGG - Intronic
935181561 2:100695370-100695392 CTTAGGCACTGGTGTGAGGATGG + Intergenic
935332468 2:101987059-101987081 CAGAGGCTGAGGTGGGAGGATGG + Intergenic
935656660 2:105429134-105429156 TTGTGGCAGTGGAGGGAGGGTGG - Intronic
936569060 2:113600276-113600298 CTGAGGCTGAGGAGGGAGAAGGG - Intergenic
936600529 2:113890355-113890377 CTGAGGCGGAGGAAGGAAGATGG + Intronic
936943897 2:117913677-117913699 GGGAGGCAGAGGTGGGAGGATGG - Intergenic
937044645 2:118844780-118844802 CTTGGGCAGTTGGGGGAGGAGGG - Intronic
937091503 2:119209400-119209422 CTAAGCCAGAGGAGGCAGGAGGG + Intergenic
937104533 2:119297609-119297631 AGGAGGCTGAGGAGGGAGGATGG - Intergenic
937413917 2:121699324-121699346 CAGAGGCTGAGGTGGGAGGACGG + Intergenic
937514465 2:122637864-122637886 ATGGGGCAGTGGAGTGAAGAGGG + Intergenic
937662864 2:124450924-124450946 GGGAGGCTGAGGAGGGAGGATGG + Intronic
937699384 2:124846958-124846980 CTGCTGCAGTGGAGGTAGCAGGG + Intronic
938452242 2:131431659-131431681 CTGTGGAAGGTGAGGGAGGAAGG + Intergenic
938544066 2:132311503-132311525 TTGAGGCAGAGAAGGGAGAATGG + Intergenic
938548942 2:132361711-132361733 CTCAGGCGCAGGAGGGAGGACGG - Intergenic
939654556 2:144807766-144807788 AGGAGGCAGAGGTGGGAGGATGG - Intergenic
939908075 2:147943309-147943331 GGGAGGCAGAGGTGGGAGGATGG + Intronic
940182090 2:150946050-150946072 CTTGGGCAGTGGAGGTAGGTGGG - Intergenic
940373026 2:152923210-152923232 GTGAGGCAGGGAAGGAAGGAAGG - Intergenic
940694372 2:156959866-156959888 CTGAGCCTGTGGAGGGAGGGAGG + Intergenic
940882122 2:158957190-158957212 CAGAGCCTCTGGAGGGAGGATGG + Intergenic
941952787 2:171174023-171174045 CTAAGGCAATGGAAGAAGGACGG - Intronic
942023839 2:171894001-171894023 CTGGGGGAGGGGAAGGAGGAGGG - Intronic
942135991 2:172925971-172925993 CAGAGGGAGGGAAGGGAGGAAGG + Intronic
942927984 2:181456821-181456843 CAGAGGAAGTGTGGGGAGGAAGG + Intergenic
943226430 2:185185026-185185048 CTGAGTCTGCGGTGGGAGGAGGG - Intergenic
943813854 2:192225938-192225960 AGGAGGCTGAGGAGGGAGGATGG + Intergenic
944155613 2:196604270-196604292 CTGGGGCAGTGGAAGGGGCATGG - Intergenic
944637210 2:201685982-201686004 GTCTGGCAGTGGAGGGAGAAGGG + Exonic
944797241 2:203199812-203199834 GGGAGGGAATGGAGGGAGGAAGG - Intronic
944806999 2:203292696-203292718 GGGAGGCAGAGGTGGGAGGATGG - Intronic
945452830 2:210013549-210013571 AGGAGGCTGAGGAGGGAGGATGG - Intronic
946095827 2:217273450-217273472 CTGGGGCAGTTGGAGGAGGATGG - Intergenic
946437426 2:219666691-219666713 CTGAGGCTGAGGTGGGAGGATGG + Intergenic
946553085 2:220823842-220823864 AAGAGGAAGGGGAGGGAGGAAGG - Intergenic
946846825 2:223866636-223866658 GGGAGGCTGGGGAGGGAGGATGG - Intronic
946881901 2:224185012-224185034 GTGAGGCAGAGGAGGGTGGATGG - Intergenic
946884780 2:224211988-224212010 GGGTGGGAGTGGAGGGAGGAGGG - Intergenic
947489172 2:230579084-230579106 CTCATGGTGTGGAGGGAGGAAGG - Intergenic
947726023 2:232401321-232401343 CTGAGGCAGAGGTGGAAGGTTGG - Intergenic
948115361 2:235491407-235491429 CGGAGGCTGTGCAGGGAGGATGG - Intergenic
948133097 2:235615297-235615319 GCGAGGCAGAGCAGGGAGGATGG - Intronic
948282738 2:236760350-236760372 GGGAGGGAGAGGAGGGAGGAAGG + Intergenic
948458681 2:238118898-238118920 CGGAGGAGGTGGATGGAGGAGGG + Intronic
948540236 2:238686082-238686104 ATGGGGCTGTGGAGGGAGAAAGG - Intergenic
948757947 2:240170032-240170054 CTGGGGCAGAGGTGGGAGAAGGG - Intergenic
948807306 2:240458628-240458650 CTGAGGATGGGGAAGGAGGAAGG - Intronic
948874920 2:240821056-240821078 CTGGGACGGTGGAGGGAGGACGG - Intergenic
948903636 2:240967879-240967901 GTGAGGCAGTGGGGGGCAGAAGG - Intronic
948924084 2:241082681-241082703 CTGAGGAAGAGAAGAGAGGAAGG - Intronic
948981133 2:241495420-241495442 CTGGGCCAGGAGAGGGAGGAGGG + Exonic
1168764098 20:370199-370221 AGGAGGCAGAGGAGGGAGGATGG - Intronic
1168856492 20:1012860-1012882 GGGAGGGAGTGGAGGGAGCAAGG + Intergenic
1169042827 20:2509634-2509656 CTGAGGCTGAGGCTGGAGGATGG + Intronic
1169087440 20:2836130-2836152 CTGGGGCAGGGGTGGGAAGAGGG + Exonic
1169139744 20:3220793-3220815 GGGAGGCCGAGGAGGGAGGATGG - Intronic
1169165759 20:3422165-3422187 CTGAGGGAGTGGAGGGACAATGG + Intergenic
1169273591 20:4218538-4218560 CAGTGGGAGTGGAGGCAGGAAGG - Intergenic
1169304617 20:4477679-4477701 CTGAGGCTGTGGAGGAAGGAGGG + Intergenic
1169307726 20:4507542-4507564 TTGAGGGGGTGGAGGGAGGGCGG + Intergenic
1169405585 20:5318389-5318411 GTGAGGCAGGGAAGGGAGAAGGG + Intergenic
1169405932 20:5321261-5321283 GAGAGGCGGTGGTGGGAGGAAGG + Intergenic
1169769769 20:9188195-9188217 ATTAGGCAGGGGAGGAAGGATGG + Intronic
1170083698 20:12505556-12505578 CTGTAGCAGTGGAAGTAGGAGGG + Intergenic
1170126610 20:12970759-12970781 CTGAGGAAGGGGAGAAAGGATGG - Intergenic
1170934852 20:20800711-20800733 GTGAGGCTGAGGTGGGAGGATGG - Intergenic
1171019459 20:21572084-21572106 TTGAGGGAGTGGAGAGAGAAGGG + Intergenic
1171415680 20:24979168-24979190 CTGAGGCATTGGATGGGGGTGGG - Intronic
1171727603 20:28639572-28639594 CTGAGGTTTTGTAGGGAGGAAGG - Intergenic
1171872930 20:30544234-30544256 TTGAGGCAGAGAAGGGAGAATGG + Intergenic
1171877767 20:30594272-30594294 CTCAGGCGCTGGAGGGAGGACGG - Intergenic
1172186913 20:33036625-33036647 CTAGGGCTGTGGAGGGAGGGAGG + Intronic
1172488188 20:35312543-35312565 CTGTGAGAGTGCAGGGAGGATGG + Intronic
1172656787 20:36542567-36542589 CTGTGGCAGTGGAGTGGGAAAGG - Intronic
1172982387 20:38953720-38953742 CTAAGTCAGGAGAGGGAGGAAGG - Intergenic
1173020009 20:39259285-39259307 CTCAGACAGCGGAGGGAGGGCGG - Intergenic
1173146039 20:40525146-40525168 CTAAGGAAGTGGAGTGGGGAGGG - Intergenic
1173155281 20:40603252-40603274 ATGAGGGAAGGGAGGGAGGAGGG + Intergenic
1173158287 20:40633455-40633477 CGGAGACGGTGGGGGGAGGAGGG - Intergenic
1173688648 20:44941879-44941901 TTGATGCAGTGGAGGGAAGGGGG - Intronic
1173766117 20:45611199-45611221 CCTAGGGAGTAGAGGGAGGACGG - Intronic
1174010697 20:47447281-47447303 GGGAGGCTGAGGAGGGAGGATGG + Intergenic
1174087493 20:48019531-48019553 CTGAGGTTGAGGAGGGAAGAGGG + Intergenic
1174145044 20:48447531-48447553 AGGAGGCAGGGGAGGGAGGAGGG + Intergenic
1174194080 20:48760631-48760653 CTGAGCCAGGAGAGGGAGGCTGG + Intronic
1174457571 20:50660588-50660610 CTGTGGCAGTGTTGGGAGGCGGG - Intronic
1174474596 20:50787499-50787521 GGGAGGCTGTGGTGGGAGGATGG + Intergenic
1174516853 20:51099138-51099160 CTGCAGAAGGGGAGGGAGGAGGG + Intergenic
1174692713 20:52524170-52524192 CTCAGGAAGTGAAGGGAGAAGGG - Intergenic
1174791915 20:53486841-53486863 CTGGGGCTGGGGAGGGAGGAAGG - Intronic
1174796556 20:53527399-53527421 CTGAGGCAGTGCAGGACGGCAGG + Intergenic
1174917501 20:54668874-54668896 CAGAGGCTGAGGAGGCAGGATGG + Intergenic
1175216891 20:57395902-57395924 CTGAGGGCATGGAGGGAGGTGGG + Intronic
1175222492 20:57425472-57425494 CTGAGGAACTGCAGGGAGGCCGG + Intergenic
1175381266 20:58566030-58566052 CTCAGGCAGTGGACAAAGGATGG + Intergenic
1175392478 20:58636000-58636022 GAGAGGGAGGGGAGGGAGGAAGG + Intergenic
1175681774 20:60994643-60994665 CTGAGGTAGAGGAGGTGGGAGGG - Intergenic
1175958463 20:62623191-62623213 CGGAGGCTGTGGAGGGAGGACGG - Intergenic
1176016437 20:62936171-62936193 CAGAGGCCGAGGCGGGAGGATGG + Intronic
1176073741 20:63239263-63239285 CTGGGGCAGGGGAGGGCTGAGGG + Intronic
1176119790 20:63449085-63449107 CTGGGGCACTGGCAGGAGGACGG + Intronic
1176243682 20:64086867-64086889 GTGAGCCTGTGGAAGGAGGAGGG + Intronic
1176264876 20:64203872-64203894 CGGAGCCTGTGAAGGGAGGAAGG - Intronic
1176299322 21:5091095-5091117 CTGAGGCAGCGGGGGCAGCAGGG + Intergenic
1177276250 21:18916571-18916593 CTGTGGCAGTAGAGGTTGGATGG - Intergenic
1177542123 21:22507815-22507837 ACTAGACAGTGGAGGGAGGAAGG - Intergenic
1178063431 21:28876974-28876996 CTAAGACAATGGAGGGAGGGAGG + Intronic
1178272987 21:31210329-31210351 CGGAGGCAGTGGTGGGAGGCAGG + Intronic
1178349905 21:31865322-31865344 GGGAGGCTGAGGAGGGAGGATGG + Intergenic
1178563822 21:33664512-33664534 CTGTGGCAGTGTAGGGAGGTGGG - Intronic
1178914604 21:36699430-36699452 CCGAGGCAGGAGAGGCAGGAGGG + Exonic
1178922960 21:36751420-36751442 CTGAAGCAGTGCGGGGAGGCTGG + Exonic
1179141925 21:38733339-38733361 AGGAGGCTGAGGAGGGAGGATGG - Intergenic
1179174883 21:39001080-39001102 CTGAGGCAGTAGAGGGTGGGTGG - Intergenic
1179178020 21:39022687-39022709 CTGGGGCATTGGAGGGATTAGGG - Intergenic
1179382838 21:40915293-40915315 GTGAGTCAGTGGACTGAGGAGGG + Intergenic
1179385457 21:40937668-40937690 CTGGGGCAGAGGAGGGTAGAGGG - Intergenic
1179409874 21:41154220-41154242 CTGTGGCAGGTGAGGGAGGATGG + Intergenic
1179623284 21:42632732-42632754 CTGTGGGACTGGTGGGAGGAAGG + Intergenic
1179857704 21:44170852-44170874 CTGAGGCAGCGGGGGCAGCAGGG - Intergenic
1179881887 21:44296477-44296499 CTGAGGCAGGGGAGGGGGAGTGG - Intronic
1180049308 21:45324120-45324142 CTGAGGGTTGGGAGGGAGGAGGG - Intergenic
1180107371 21:45629033-45629055 CTGAGGCAAGAAAGGGAGGAAGG + Intergenic
1180149256 21:45939362-45939384 TTGAAGCAGCTGAGGGAGGAGGG - Intronic
1180745771 22:18087977-18087999 TAGAGGAAGTGCAGGGAGGAAGG - Exonic
1180848147 22:18995519-18995541 CTGAACCAGTGGAGGGAGACTGG + Intergenic
1181033115 22:20157641-20157663 GTGAGGCCGTGGACGGAGGGTGG + Intergenic
1181167903 22:20993129-20993151 CAGAGTCAGTGGAGGGAGCCGGG + Intronic
1181510194 22:23385596-23385618 GTGAGGCCGTGGATGGAGGGTGG - Intergenic
1181517487 22:23423521-23423543 CTTTGGCAGTGGAGGCAGGGAGG + Intergenic
1181782704 22:25204740-25204762 GTGAAGCAGGGGAGGGAGAAGGG - Intronic
1181789557 22:25253773-25253795 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1181830091 22:25553617-25553639 GGGAGGCTGAGGAGGGAGGATGG + Intergenic
1181958393 22:26604966-26604988 CAGAGGGAGTGGAGGAAAGAGGG - Intronic
1181975564 22:26726903-26726925 CTGAGGGAGTAGAGGGACAAAGG + Intergenic
1181980257 22:26761081-26761103 AGGAGGAAGTGGAGGAAGGAGGG + Intergenic
1182073588 22:27479810-27479832 CTGGGGGTGTGGTGGGAGGATGG - Intergenic
1182090895 22:27594137-27594159 GGGAGGGACTGGAGGGAGGAAGG + Intergenic
1182188161 22:28429325-28429347 TTGAGGCCCTGGAGGGAGAAAGG - Intronic
1182294426 22:29304844-29304866 CTGAGGCAGGAGAAGGAGAATGG - Intergenic
1182481817 22:30614212-30614234 CTGAGGCAATGAAGGAATGAAGG + Intronic
1182643486 22:31788376-31788398 AGGAGGCTGAGGAGGGAGGATGG - Intronic
1182668002 22:31973043-31973065 CTGATGCAGGGGAGGAAGAATGG + Intergenic
1182700146 22:32230215-32230237 CTGACACACAGGAGGGAGGAAGG - Intronic
1182737005 22:32537923-32537945 GTGAGGCACTGGACGGAGGGCGG + Intronic
1183017550 22:35001647-35001669 AGGAGGCTGAGGAGGGAGGATGG + Intergenic
1183029791 22:35094869-35094891 CTAAGGCTGGGGAGGCAGGAGGG + Intergenic
1183099866 22:35577194-35577216 CTCAGGCAGTGGTGGTCGGAGGG + Intergenic
1183180065 22:36253895-36253917 CTGAGACAGGGGAGTGAGAAGGG + Exonic
1183194500 22:36344147-36344169 CTGAGGCTCAGGTGGGAGGAAGG + Intronic
1183222213 22:36522715-36522737 CTGCGGCAGTGTCGGGAGGTAGG + Intronic
1183327495 22:37202388-37202410 CTGAGGCCTTGGAGGGATGGTGG + Intergenic
1183379792 22:37485234-37485256 CTGAGGCAGTGGTGGGCCGGAGG - Intronic
1183430317 22:37761875-37761897 CTGAGGCAGAGAAGGGAGCTGGG + Intronic
1183442323 22:37830239-37830261 CTGAGGTAGGTAAGGGAGGATGG - Intergenic
1183530129 22:38348840-38348862 AGGAGGCAGAGGAGGGAGCAGGG + Intronic
1183597934 22:38823320-38823342 CTGAGGCAGTGGGGTGGGGCTGG + Intronic
1183647649 22:39135669-39135691 CTGCTGCAGTGATGGGAGGAGGG + Intronic
1183950091 22:41347932-41347954 CTGGGTCAGAGGAGTGAGGAAGG - Intronic
1184153435 22:42651425-42651447 GGGAGGCTGTGGTGGGAGGATGG - Intergenic
1184384739 22:44167603-44167625 TGGAGGCAGGGGAGGGAGAATGG - Intronic
1184652600 22:45925968-45925990 CAGGGACAGGGGAGGGAGGAGGG - Intronic
1184742773 22:46438681-46438703 CAGAGGCTGGGGAGGGAGCAGGG + Intronic
1184765313 22:46569204-46569226 CAGAGGCTGGGGAGGGAGGATGG + Intergenic
1184809097 22:46816590-46816612 TTTAGGCAGTGGAGTGAGGTGGG + Intronic
1184959315 22:47917723-47917745 GGGAGGCAGTAAAGGGAGGAAGG - Intergenic
1185057470 22:48588432-48588454 CTGAGGCATTGGGGGAAGGAAGG + Intronic
1185074591 22:48676405-48676427 AGGAGGCATTGGAGGGAGGCGGG + Intronic
1185148000 22:49149741-49149763 GAGAAGCAGGGGAGGGAGGAAGG + Intergenic
1185269638 22:49923112-49923134 CTGGGGAAGGGCAGGGAGGAGGG - Intronic
949475305 3:4439419-4439441 GAGAGGCAGAGGTGGGAGGATGG + Intronic
949877855 3:8638251-8638273 CCCAAGCAGTGGAGGAAGGAGGG + Intronic
949930833 3:9077230-9077252 CTGAAGCAAAGGAGGGAGGAGGG - Intronic
949985437 3:9537179-9537201 CAGAGGAAATGGAGGGAGGCTGG - Intronic
950077975 3:10200655-10200677 GTGAGGCTGAGGCGGGAGGATGG + Intronic
950098925 3:10345643-10345665 CTGAGGAAGTGGAGGGAGTGAGG - Intronic
950199159 3:11030642-11030664 CTGAGGCATTTGAGGGACGAGGG + Intronic
950205455 3:11076804-11076826 CTGAAGCAGATCAGGGAGGAAGG - Intergenic
950398164 3:12750003-12750025 CCGGGGTAGTGGAGGGAGGAGGG + Intronic
950465778 3:13153018-13153040 GGGAGGCATGGGAGGGAGGATGG - Intergenic
950523084 3:13507876-13507898 CTGAGGCAGCAGAGTGGGGATGG - Intergenic
950546042 3:13638642-13638664 GGAAGGCAGAGGAGGGAGGAGGG - Intergenic
950663485 3:14481369-14481391 TTGAGGCAGATGAGGGAGGAAGG + Intronic
950833173 3:15895210-15895232 CTGAGGTAGTGAAGGGACCAGGG + Intergenic
951213997 3:20006564-20006586 TGGAGGCAGAGGTGGGAGGATGG - Intronic
951290941 3:20871738-20871760 TTGAGTCAGTGGACTGAGGAAGG + Intergenic
951401785 3:22241462-22241484 CTGAGTCAGTGGATGAAGCAAGG - Intronic
951568198 3:24034264-24034286 ATTAGGGAGTGGAGGGAGGGAGG + Intergenic
951681033 3:25294808-25294830 AAGAGGGAGTGGAGGGGGGAAGG + Intronic
952306628 3:32152659-32152681 CTGTGGCAGTGTTGGGAGGTGGG - Intronic
952330159 3:32357339-32357361 TAGAAGCAGTGGAGAGAGGAGGG - Intronic
952400005 3:32954587-32954609 CTGAGCCAGTGTCAGGAGGAAGG + Exonic
952408580 3:33026749-33026771 CTGAGAGGATGGAGGGAGGATGG + Intronic
952474432 3:33692062-33692084 GGGAGGCTGTGGTGGGAGGATGG + Intronic
952488427 3:33840326-33840348 CTGAGGAAGAGGCGGAAGGAGGG + Intronic
952901174 3:38112540-38112562 CTGAGGCATTTCAGGCAGGAGGG + Intronic
952948362 3:38496545-38496567 CTGGGCCAGCGAAGGGAGGACGG - Intronic
953168673 3:40488006-40488028 GGGAGGCAGAGGAGAGAGGATGG - Exonic
953556886 3:43953034-43953056 CTGAGGCAGTGGGGTGAGATCGG + Intergenic
953814578 3:46144046-46144068 CCAAAGCAGTGGAGGGAGGTAGG - Intergenic
953906304 3:46870007-46870029 CTGAGACAGAGATGGGAGGATGG + Intronic
954066023 3:48106890-48106912 AGGAGGCAGAGGTGGGAGGATGG - Intergenic
954318813 3:49817002-49817024 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
954345832 3:49998441-49998463 CTGAGGCAGTGGAGGAAGCATGG + Intronic
954411559 3:50373475-50373497 GAGAGGCAGGGGAGGAAGGAGGG + Intronic
954571460 3:51644338-51644360 GGGAGGCAGAGGCGGGAGGATGG + Intronic
954702877 3:52460639-52460661 GAGAGGCAGAGGTGGGAGGATGG - Intronic
954740487 3:52745825-52745847 ATGAGGCCGAGGTGGGAGGATGG - Intronic
954802324 3:53194369-53194391 CAGAGGCAGTGGAGGGTGGTGGG + Intergenic
955286230 3:57644408-57644430 ATGAGGCTGAGGTGGGAGGATGG - Intronic
955508221 3:59653303-59653325 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
955720799 3:61878741-61878763 GGGAGGCAGAGGAGGTAGGATGG - Intronic
956210337 3:66795738-66795760 GTGATGCAGTGCAGGGAGGGAGG - Intergenic
956359157 3:68428175-68428197 CAGAGGGAGAGGAGGAAGGAAGG + Intronic
957322715 3:78653227-78653249 TTGAGGAACTGGAGGGAGGCAGG - Intronic
957785564 3:84877800-84877822 CTGAGGCTGAGGCAGGAGGATGG + Intergenic
958147605 3:89646664-89646686 TTGGGGCAGGGGATGGAGGATGG - Intergenic
959498588 3:107079168-107079190 CTGGGGCAGAGGAAGGAGGCAGG + Intergenic
959613922 3:108326016-108326038 CTGAGGCAGTGGCAAGAAGAGGG - Intronic
959662411 3:108883510-108883532 TTGAGGAGGTGGAGGCAGGAAGG + Intergenic
959950355 3:112174483-112174505 CTGTGGCAGTGGAGGGAGCGGGG + Intronic
960391108 3:117078602-117078624 GGGAGGCTGTGGTGGGAGGATGG - Intronic
960548231 3:118942861-118942883 GTGGGGCAGAGGAGGTAGGAGGG + Intronic
960586740 3:119327033-119327055 CGGAGGCTGAGGTGGGAGGATGG + Intronic
961169231 3:124784558-124784580 TTAAGGCAGTGGAGGGAAGATGG + Intronic
961213530 3:125142907-125142929 CAGAGTCAGGGAAGGGAGGAGGG - Intronic
961518058 3:127450778-127450800 CTGTGGGAGTTGGGGGAGGATGG + Intergenic
961621821 3:128230392-128230414 GGGAGGCTGAGGAGGGAGGATGG - Intronic
961635778 3:128331447-128331469 CTGAGGAAGGGGAGGGAAGAGGG - Intronic
961640309 3:128360728-128360750 GGGTGGGAGTGGAGGGAGGAGGG + Intronic
961649634 3:128410926-128410948 CAGAGGCACAGAAGGGAGGAGGG + Intergenic
962720743 3:138172488-138172510 GGGAGGCTGTGGTGGGAGGATGG + Intronic
963065789 3:141263236-141263258 CTGTGGAAGTGGAGGTAGTAAGG + Intronic
963754221 3:149216707-149216729 CTGCGCCAGTGGAGGAAGGCTGG - Intronic
963940595 3:151092624-151092646 CTGGGGAAGTGGAGTGAGGGAGG + Intronic
964430027 3:156595610-156595632 GAGAGGCAGTGGAAGGAGGGAGG - Intergenic
964435196 3:156643919-156643941 CAGAGGCAGGGGAATGAGGAAGG - Intergenic
964735782 3:159915566-159915588 CTCAGGAGGTGGAGGTAGGATGG - Intergenic
965205035 3:165711996-165712018 ATGAGGCAGTGGGGGCAGGGAGG - Intergenic
965256364 3:166418616-166418638 CTGGGGCAGGGCTGGGAGGAGGG - Intergenic
965378878 3:167962719-167962741 GGGAGGCTGAGGAGGGAGGATGG + Intergenic
965601558 3:170459379-170459401 ATGAGGCAGTGTAGTGAGCAGGG + Intronic
965621344 3:170644950-170644972 GTGAAGCTGTAGAGGGAGGAGGG - Intronic
965680188 3:171242310-171242332 ATGAGGAAGAGGAGGAAGGAAGG - Intronic
965825899 3:172729505-172729527 CGGAAGCATTGGAGGGAAGAAGG + Intergenic
965960421 3:174422723-174422745 TTGGGGCTGAGGAGGGAGGAAGG + Intergenic
966085124 3:176061648-176061670 CTGAGTCAGTGAAGGGAGATAGG - Intergenic
966128076 3:176603655-176603677 GCGAGGGATTGGAGGGAGGATGG - Intergenic
966646605 3:182252512-182252534 CTGGAGAGGTGGAGGGAGGAAGG + Intergenic
966965603 3:184989502-184989524 GGGAGGCAGAGGCGGGAGGATGG - Intronic
966972464 3:185057599-185057621 GGGAGGCAGAGGTGGGAGGATGG + Intergenic
967129614 3:186458454-186458476 CTGAGGCGGTGGGCGGGGGAGGG + Intergenic
967138020 3:186528917-186528939 GAGAGGCAGAGGATGGAGGATGG + Intergenic
967193824 3:187009525-187009547 GGGAGGCTGAGGAGGGAGGATGG + Intronic
967328295 3:188264566-188264588 ATGAGGTAGGGGAGGGAGGTGGG + Intronic
967481446 3:189977847-189977869 GGGAGGCTGAGGAGGGAGGATGG - Intronic
968083931 3:195865996-195866018 AGGAGGCACTGGCGGGAGGAGGG - Intronic
968205329 3:196794643-196794665 CAGAGGCAGAGGAGGGAGGCGGG + Intronic
968264262 3:197350497-197350519 CAGGGGCTGGGGAGGGAGGAAGG - Intergenic
968426309 4:525838-525860 GTGAGGAAGCGGAGGGGGGACGG + Intronic
968468854 4:767467-767489 CCCAAGGAGTGGAGGGAGGAGGG - Exonic
968531455 4:1094134-1094156 CTGAGGCAGGAGACTGAGGATGG - Intronic
968546229 4:1200392-1200414 GGGAGCAAGTGGAGGGAGGAAGG + Intronic
968582421 4:1401305-1401327 CTCTGCCAGCGGAGGGAGGAGGG + Intergenic
968646526 4:1743923-1743945 CTGCGACAGAGGAGTGAGGATGG + Intronic
968658299 4:1787954-1787976 CGGAGGCCGCGGAGGGAGGAGGG + Intergenic
968720050 4:2195720-2195742 CTCAGGCTGAGGTGGGAGGATGG - Intronic
968815887 4:2821456-2821478 CTGGGGCAGTGGAGCTAGGGTGG + Intronic
968862815 4:3185955-3185977 GGGAGGAAGGGGAGGGAGGAAGG + Intronic
968874401 4:3257698-3257720 CGGCGGCAGTGGTGGGAGGAGGG + Intronic
968962240 4:3751537-3751559 GTGAGGAAGAGGAGCGAGGATGG - Intergenic
969059251 4:4422059-4422081 CTGACACATTGTAGGGAGGAAGG + Intronic
969073897 4:4561819-4561841 GGGAGGCAGAGGTGGGAGGATGG - Intergenic
969432335 4:7162709-7162731 CTTAGGGAGTGGAGGAAGAAGGG + Intergenic
969526974 4:7708813-7708835 CTGAGGGAGTGGTGGGAGGATGG + Intronic
969545085 4:7820746-7820768 GTGAGGATGTGGAGGGAAGAGGG + Intronic
969639322 4:8387612-8387634 CGGGGGCTGTGGTGGGAGGAAGG + Intronic
970619084 4:17798489-17798511 ATGAGGCTGAGGTGGGAGGATGG + Intergenic
970914994 4:21322027-21322049 CAGAGGCAGGGGAGGAAGGAAGG + Intronic
971249199 4:24958340-24958362 CTGAGGCACTGCAGGCAGAAAGG - Intronic
971400160 4:26268751-26268773 CTGCAGCAGAGGCGGGAGGAAGG + Intronic
972529125 4:39945960-39945982 GGGAGGCCGTGGAGGGAGGGGGG + Intronic
972531402 4:39964462-39964484 CGGAGGCTGAGGTGGGAGGATGG + Intronic
972604095 4:40598349-40598371 AGGAGGCTGTGGTGGGAGGATGG - Intronic
972976607 4:44643668-44643690 CTGAGGCTATGAAGGGAAGAGGG - Intronic
973121491 4:46524957-46524979 TTGAGTCAGTGGAGTGAGAAAGG - Intergenic
973620171 4:52718245-52718267 GGGAGGCTGAGGAGGGAGGATGG + Intergenic
974887106 4:67833302-67833324 CTGAGGCTGAGGAGGGAAGCTGG - Exonic
975034955 4:69668759-69668781 CTGCTGCTGTGGAGTGAGGAGGG - Intergenic
975035681 4:69677320-69677342 GTGAGGGGCTGGAGGGAGGAAGG + Intergenic
975145418 4:70962117-70962139 CAGAGGCTGAGGTGGGAGGATGG + Intronic
975801868 4:78068455-78068477 TTGAGGCAGTGCATGGAGGATGG + Intronic
975907013 4:79225512-79225534 ATCAGGCAGTGGAGAGAGCATGG + Intergenic
976098863 4:81539122-81539144 CTGAGGCCTTGGAGGCAAGAAGG - Intronic
976561894 4:86511459-86511481 AGGAGGCAGAGGTGGGAGGATGG + Intronic
977575667 4:98671382-98671404 CAAAGGCAGTGGAGAGAGGGAGG + Intergenic
977609874 4:99020613-99020635 CTGAAGCAAGGGATGGAGGAGGG - Intronic
977634837 4:99285485-99285507 CTGTTACAGTGGAGGGAGCATGG + Intronic
978206898 4:106090321-106090343 CTGAGGCTGTGCAGGGAAGTGGG + Intronic
978507163 4:109471245-109471267 GTGAGGCTGAGGTGGGAGGATGG - Intronic
978740695 4:112134809-112134831 TGGAGGCTGTGGCGGGAGGATGG + Intergenic
979458311 4:120951386-120951408 CTCAGACAGTGGAGGGAGTTAGG + Intergenic
979530849 4:121767703-121767725 CTGATACAGTGTGGGGAGGAGGG + Intergenic
980576315 4:134687520-134687542 CTGATGCACTGGAGGGTCGAAGG + Intergenic
980894566 4:138849887-138849909 TGGAGGCTGTGGAGGCAGGAGGG - Intergenic
981043286 4:140242893-140242915 AGGAAGGAGTGGAGGGAGGAAGG + Intergenic
981522388 4:145676722-145676744 CTGGGGCAATGGTGGGAGGCAGG - Intergenic
981730021 4:147887329-147887351 CTGGAGCAGTGGAGAGAAGATGG - Intronic
982718801 4:158838323-158838345 GTGAGGCTGAGGTGGGAGGATGG - Intronic
983228319 4:165105953-165105975 CTCACGCAGTGGAAGGTGGAAGG - Intronic
983363096 4:166752121-166752143 CTGAGGCAGGAGAAGGAGGTTGG - Intronic
984188871 4:176580671-176580693 CTGAGCCAGTAGAGTGAGGGAGG + Intergenic
984624873 4:181995968-181995990 CTGGGGCTCTTGAGGGAGGAAGG - Intergenic
984822553 4:183895058-183895080 CGGAGGCAATGGAGTGAGGCAGG + Intronic
984991769 4:185387882-185387904 CTGAGGCAGGGGTGGAATGAAGG + Intronic
985110291 4:186541062-186541084 CTGAGGGAATGGAGGCAGGGTGG - Intronic
985376656 4:189347547-189347569 CTGAGTCAGAGAAGGGAGTAAGG + Intergenic
985427369 4:189843902-189843924 CAGATGCAGTGGAGGGAAGAAGG - Intergenic
985586452 5:740122-740144 CAGGGGGAGTGGTGGGAGGAGGG + Intronic
985601040 5:832299-832321 CAGGGGGAGTGGTGGGAGGAGGG + Intronic
985711480 5:1432057-1432079 CAGAGGAAGGGTAGGGAGGAAGG + Intronic
985808871 5:2068672-2068694 GTGAGTCAGTGGAGGGTGGGAGG + Intergenic
985815596 5:2125646-2125668 GTGAGGGAGTGTTGGGAGGAGGG + Intergenic
985905939 5:2836693-2836715 GGGAGGCAGAGGAGGGAGAATGG - Intergenic
986078005 5:4357868-4357890 CTGAGGCAATGTGGGAAGGAGGG - Intergenic
986306933 5:6523030-6523052 CTGAGGCAGGGATGGGAGGTCGG + Intergenic
986710239 5:10483376-10483398 CTGGGGCAGTGGGGTGAGGTTGG + Intergenic
986725742 5:10595098-10595120 CTGTGACTGTGGAGGGTGGAGGG + Intronic
987468158 5:18296725-18296747 CTGAGGGAGAGAAGGTAGGATGG + Intergenic
987764129 5:22203248-22203270 CAGAGGCTGTGGCGGGGGGAGGG - Intronic
987901355 5:24015855-24015877 ATGAGGCTGAGGTGGGAGGATGG + Intronic
988845504 5:35123582-35123604 GAGAGACAGTGGAGGGAGCAAGG + Intronic
988983499 5:36595109-36595131 ATAAAGCAGTGGAGGAAGGAGGG + Intergenic
988986227 5:36621455-36621477 AGGAGTCAGTGGAGGGAGTAGGG + Intronic
989045762 5:37271866-37271888 TTGAGTCAGTGGACTGAGGAAGG - Intergenic
989209968 5:38848551-38848573 CTGAGTGGGAGGAGGGAGGATGG - Intronic
989685658 5:44083762-44083784 CTAAGGAAGTGGAGGCAAGATGG - Intergenic
989995050 5:50819386-50819408 CTGAGACCTTGTAGGGAGGAGGG - Intronic
990047889 5:51457168-51457190 GAGGGGCAGTGGAGGGAGGGAGG - Intergenic
990332229 5:54739518-54739540 ATGAGGCAGTGGAGAGAGATGGG - Intergenic
990569238 5:57061131-57061153 CGGAGCCTTTGGAGGGAGGATGG - Intergenic
990625282 5:57603871-57603893 CTGAGGCAGTGAAGGATAGAGGG + Intergenic
990731271 5:58811789-58811811 GTGGTGCAGTGGAGGGAGGGTGG - Intronic
991292743 5:65048541-65048563 CTGAGTCAGTGGTGGGGGCATGG - Intergenic
991898859 5:71436332-71436354 CAGAGGCTGTGGCGGGGGGAGGG - Intergenic
992150981 5:73902901-73902923 CAGAAGCAGTGGAGTGTGGATGG + Intronic
992325091 5:75652544-75652566 CTGAGACTGAGGTGGGAGGATGG - Intronic
992465886 5:77003981-77004003 GGGAGGCTGAGGAGGGAGGATGG - Intergenic
992528034 5:77630388-77630410 CTGGGGCCGGGGAGGGAGGCGGG + Exonic
992648402 5:78833549-78833571 GGGAGGCAGTGGAGGGAGGAAGG + Intronic
992877218 5:81068827-81068849 CTGAGGCCTGGGAGGGAGGGAGG - Intronic
993188989 5:84656930-84656952 CTGGGGGTGGGGAGGGAGGATGG + Intergenic
993472138 5:88319054-88319076 GGGAGGCTGAGGAGGGAGGATGG - Intergenic
994029796 5:95128661-95128683 CTGGGGAAGGGGAGGAAGGATGG + Intronic
994094792 5:95839069-95839091 CTTAGGCATTAGAGGGAGCATGG - Intergenic
994132516 5:96246565-96246587 CTGTGCCAGTGGAGTGAGAAAGG - Intergenic
994296002 5:98089332-98089354 CTCAGCCTCTGGAGGGAGGAGGG - Intergenic
994758112 5:103819333-103819355 CTGAGGCAGGAGAGGGAGACAGG + Intergenic
995039016 5:107567554-107567576 CTGGGGCAGGGGTGGGTGGATGG - Intronic
995125355 5:108573258-108573280 CTAAGGGAGAAGAGGGAGGAAGG + Intergenic
995284696 5:110374525-110374547 ATTAGACAGTGGAGGGTGGAAGG - Intronic
995402340 5:111757275-111757297 TGGAGGAAGAGGAGGGAGGAGGG + Intronic
995712015 5:115045387-115045409 AGGAGGCTGAGGAGGGAGGATGG - Intergenic
995751072 5:115453799-115453821 CTGAGGCTGGGCAGGGTGGAAGG - Intergenic
995815002 5:116158153-116158175 CGGAGGGAGAGGAGGGAGGGAGG - Intronic
996681502 5:126232312-126232334 TTGAGGTAGAGGTGGGAGGATGG + Intergenic
996924803 5:128811883-128811905 GGGAGGGAGGGGAGGGAGGAAGG - Intronic
997656355 5:135557653-135557675 CTGCTGCAGTGGAGAGAGGATGG + Intergenic
997836227 5:137195537-137195559 CTGGGGCAGTGGATGAAGGATGG + Intronic
998028018 5:138837507-138837529 GAGAGGGAGGGGAGGGAGGAGGG - Intronic
998146691 5:139733329-139733351 CTGAGGCAGCGGAGGGAAGGGGG - Intergenic
998234165 5:140383504-140383526 AGGAGGAAGTGGAGGGTGGAGGG + Intergenic
998316303 5:141185640-141185662 GGGAGGCTGAGGAGGGAGGATGG - Exonic
998494462 5:142575498-142575520 CAGAGGAAGAGGAGAGAGGAGGG - Intergenic
998989085 5:147795252-147795274 CTGAAGGTGTGGATGGAGGAGGG - Intergenic
999182671 5:149681109-149681131 GTGGAGCAGGGGAGGGAGGAGGG - Intergenic
999186040 5:149709699-149709721 CTGTGGCAGTGGAGGTAAGTGGG + Intergenic
999187018 5:149718936-149718958 AGGAGGCTGTGGTGGGAGGATGG - Intergenic
999302736 5:150501245-150501267 AGGAGGCAGAGGAGGGAGGCTGG - Intronic
999367352 5:151031764-151031786 CAGAGGCCGTGGTGGGAGGAGGG - Intronic
999443062 5:151617369-151617391 CTGGGCCTGTGGAGGAAGGAAGG + Intergenic
999823522 5:155252222-155252244 CAGAGGCCATGGATGGAGGAAGG + Intergenic
1000009882 5:157220961-157220983 CGGAGGCTGAGGAGGGAGGATGG - Intronic
1000136113 5:158352656-158352678 ATGAGGCTGAGGTGGGAGGATGG - Intergenic
1000145948 5:158453473-158453495 CTGAGGCTTAGGAGGGTGGAGGG + Intergenic
1001003777 5:168031698-168031720 GGGAGGGAGGGGAGGGAGGAAGG + Intronic
1001132278 5:169074096-169074118 CTGGGGCAGTGGTGGATGGAGGG + Intronic
1001681253 5:173558542-173558564 CTGAGTCAGGGGTGGGAGGAAGG + Intergenic
1001996498 5:176164587-176164609 CTGAAGCCGTGAAGGGAGGCAGG - Intergenic
1002076690 5:176712639-176712661 CTGGGGCAGGAGAGGGAGGTGGG + Intergenic
1002080091 5:176732623-176732645 CTGAGGAAGTGGAGGGGTGCAGG - Intergenic
1002133577 5:177095507-177095529 CAGAGGGAGTGGAGGGAGCGTGG - Intronic
1002532012 5:179852889-179852911 CTCAGGAAGTGGAGGCAGGCAGG - Intronic
1003053475 6:2799617-2799639 CAGAGGCTGTGGAGAGAGCATGG + Intergenic
1003098873 6:3162497-3162519 GGGAGGGAGTGGGGGGAGGACGG - Intergenic
1003129824 6:3386257-3386279 CCAAGGCAGGGGAGGTAGGAAGG + Intronic
1003550934 6:7101461-7101483 CTGGAGCAGCAGAGGGAGGAGGG - Intergenic
1003579284 6:7325080-7325102 CTGTGGGAGTGGAGAGAGAAGGG - Intronic
1003876997 6:10446777-10446799 CAGAGGCGGAGGTGGGAGGATGG - Intergenic
1003968689 6:11278076-11278098 CTGAGGCTGTGGAGAGAAGCAGG - Intronic
1004125143 6:12865949-12865971 CTTAGGGTGGGGAGGGAGGAGGG - Intronic
1004225542 6:13781225-13781247 CAGAGGCTGAGGTGGGAGGATGG + Intergenic
1004447058 6:15710145-15710167 GTGAGGGAGGGGAGGGAGGGAGG - Intergenic
1004468758 6:15909508-15909530 CTGAGCACCTGGAGGGAGGAAGG + Intergenic
1004513520 6:16302530-16302552 CTGGGGCAGAGGGGGGAGGGAGG - Exonic
1004577266 6:16909257-16909279 GGGAGGCAGAGGTGGGAGGATGG + Intergenic
1004704955 6:18116209-18116231 GGGAGGCTGAGGAGGGAGGATGG + Intergenic
1004905710 6:20235332-20235354 CAGAGGCAGTGGGGGGTGGGGGG + Intergenic
1005402652 6:25450763-25450785 GGGAGGGAGGGGAGGGAGGAAGG - Intronic
1005460951 6:26070026-26070048 CTTAGGCAGTGGAGAGAAGGAGG + Intergenic
1005473466 6:26184643-26184665 GTGAGGCGGTAGAGGGAAGAGGG - Intergenic
1005500073 6:26421792-26421814 AGGAGGAAGTGAAGGGAGGAGGG + Intergenic
1005504549 6:26458310-26458332 AGGAGGAAGTGAAGGGAGGAGGG + Intronic
1005870763 6:29972781-29972803 CGAAGGCAGTGGTGGAAGGAAGG + Intergenic
1005971247 6:30763651-30763673 CAGAGGCAGTGGAGGGCTGGGGG - Intergenic
1006181294 6:32154821-32154843 CTGTGGCAGGGGAGGGAGAGCGG + Intronic
1006322890 6:33330865-33330887 CTGAGGGAGGGGAGGGGGAACGG + Intergenic
1006323268 6:33333589-33333611 CTGGGGGAGTGGGGGAAGGAAGG + Intergenic
1006373587 6:33659672-33659694 CTGTGGAGGTGGAGGGAGGCTGG - Intronic
1006447044 6:34085425-34085447 GTGAGTCAGTAGAGAGAGGAAGG + Intronic
1006461009 6:34158073-34158095 CTGAGGAAGTGGAAGGGAGAGGG + Intergenic
1006569164 6:34986379-34986401 GCGTGGCAGTGGAGGAAGGAGGG - Intronic
1006578241 6:35061400-35061422 CTGAGGCAGCGGAGCAAGGCGGG - Intronic
1006639738 6:35483773-35483795 CTGATGTGGTGGAGGGAGGGTGG - Intronic
1006648861 6:35534778-35534800 CAGTGGCAGGGGAGGGAGGGAGG - Intergenic
1006699754 6:35962484-35962506 CTGAGGAAGGGGAGGGCAGAGGG - Intronic
1006775868 6:36592120-36592142 GGGAGGCAGAGGAGGGTGGATGG + Intergenic
1006781348 6:36634565-36634587 GGGAGGCAGAGGTGGGAGGATGG - Intergenic
1006796386 6:36734984-36735006 CTCAGGCTGTGGAGTGAGAAGGG + Intergenic
1006797553 6:36741345-36741367 ATTAGGCAGTGGGGGGAGGCAGG + Exonic
1006977533 6:38117291-38117313 GTGAGGCAGAGGCAGGAGGATGG - Intronic
1007256427 6:40532570-40532592 CAGAGGCAGCGGAGGTGGGATGG - Intronic
1007325042 6:41053301-41053323 CTGAGGGAGAGGAGAGAGGCAGG - Exonic
1007397641 6:41586713-41586735 CTGAAGCAGCGGAAGGAGGGAGG + Intronic
1007455142 6:41971368-41971390 CAGAGGCTGAGGCGGGAGGATGG - Intronic
1007460111 6:42011746-42011768 CTGAGGCAGTGGAGGGAGAGGGG + Intronic
1007551953 6:42736567-42736589 CAGAGGCTGAGGTGGGAGGATGG + Intergenic
1007727739 6:43926869-43926891 CTCAGGCGGCAGAGGGAGGAGGG - Intergenic
1007825413 6:44596191-44596213 CTAAGGATATGGAGGGAGGAAGG - Intergenic
1008288397 6:49682761-49682783 ATGAGGGAAGGGAGGGAGGAAGG - Intergenic
1008958824 6:57245081-57245103 CAGAAACAGTGGAGAGAGGAAGG - Intergenic
1009750114 6:67871337-67871359 CTGGGGCAGTCTGGGGAGGAGGG - Intergenic
1009750399 6:67873024-67873046 CTGGGGCAGTCTGGGGAGGAGGG + Intergenic
1010489588 6:76459481-76459503 CTGAGGGAGTGAAAGAAGGAAGG - Intergenic
1010977588 6:82333241-82333263 GTGTGGCAGTGGAGGGGTGAGGG - Intergenic
1011681910 6:89791730-89791752 GGGAGGCTGAGGAGGGAGGATGG + Intronic
1011723512 6:90184467-90184489 GTGAAGGGGTGGAGGGAGGAAGG - Intronic
1011736352 6:90314283-90314305 ATGCGGCAGTGAGGGGAGGAGGG - Intergenic
1012632048 6:101482724-101482746 TTGAGGTAGTGGAAGTAGGAAGG + Intronic
1013718694 6:112995738-112995760 GTCAGGGACTGGAGGGAGGAAGG - Intergenic
1013743604 6:113318769-113318791 CTGGGGCTGGGGAGGAAGGAAGG - Intergenic
1014290469 6:119552177-119552199 CTGAGGAACTTGGGGGAGGAAGG + Intergenic
1014303976 6:119717090-119717112 CTGGGTCAGTGGAGAGTGGAGGG + Intergenic
1014474933 6:121860388-121860410 CTGGGGCAGAGGAGAGAGGCAGG + Intergenic
1014639996 6:123897801-123897823 CAGAGGCAGTGAAGGGAAGAGGG - Intronic
1015163966 6:130182625-130182647 AGGAGGGAGGGGAGGGAGGAAGG + Intronic
1015211191 6:130701140-130701162 CTGAAAGAGGGGAGGGAGGAAGG + Intergenic
1015428932 6:133107088-133107110 CAGAGCCAGTGGAGGGAGCAGGG - Intergenic
1015784382 6:136905978-136906000 CTAAGGCAGTGGAGGTAGAAAGG - Intronic
1015822666 6:137280647-137280669 TGGAGGCTGTGGTGGGAGGATGG - Intergenic
1015899920 6:138053720-138053742 CTGCAGCAGTGGAGGTAGCAGGG - Intergenic
1016292157 6:142537961-142537983 CTGAGGCTTTGAAGGGAGAAGGG - Intergenic
1016390161 6:143566396-143566418 GTGAGGCTGAGGTGGGAGGATGG - Intronic
1016982453 6:149864894-149864916 CTGAGGCTGAGTTGGGAGGATGG + Intergenic
1017054833 6:150427406-150427428 CTGAGGGAGGGGAATGAGGAAGG + Intergenic
1017163913 6:151390767-151390789 TTGGGGGAGGGGAGGGAGGAGGG - Intronic
1017300794 6:152855482-152855504 GTGAGGGAGAGGAGTGAGGATGG + Intergenic
1017841170 6:158224188-158224210 CTGAGGCAGGGGAGGGCTGGAGG - Intergenic
1018287298 6:162254671-162254693 CTCTGGCAGTGGATGAAGGATGG - Intronic
1018612749 6:165661107-165661129 CTGAGGCAGAGGTGGCAGAAAGG - Intronic
1018890132 6:167977067-167977089 CTGAGTGGGGGGAGGGAGGAGGG + Intergenic
1018969271 6:168514860-168514882 CTTAGACAAAGGAGGGAGGATGG + Intronic
1019142899 6:169959503-169959525 CAGGGGGAGAGGAGGGAGGAGGG - Intergenic
1019314257 7:377246-377268 CTGGGGCAGTGGATGGAAGGGGG + Intergenic
1019324172 7:429945-429967 CGGAGGCGATGGAGGGAGGCAGG - Intergenic
1019358436 7:592929-592951 GGGAGGCTGAGGAGGGAGGATGG + Intronic
1019407973 7:893824-893846 TTGGGGCTGGGGAGGGAGGAGGG + Intronic
1019547785 7:1586773-1586795 CTGAGGCAGTCTTGGGAGGCTGG + Intergenic
1019571827 7:1716434-1716456 CTAAGGCTCTGGAGGGAGGATGG - Intronic
1019576282 7:1739197-1739219 CTCTGGCTGTGGAGGGAGAATGG + Intronic
1019712040 7:2522193-2522215 CTGGGGGAAGGGAGGGAGGAGGG + Intronic
1019747974 7:2711149-2711171 CTGAGGCTGTGGAGGGAAGAGGG + Intronic
1020115322 7:5473000-5473022 CTGCAGCAGGGGAGAGAGGATGG - Intronic
1020604550 7:10320031-10320053 ATGAGGAAATGGAGGGAGGGAGG - Intergenic
1020669516 7:11089449-11089471 GGGAGGCAGAGGTGGGAGGATGG + Intronic
1021021915 7:15610575-15610597 TTGAGGCAGGGGAGGAAGGCTGG + Intergenic
1021355600 7:19650691-19650713 CTGAGGCTCTGGAGTGAGCATGG + Intergenic
1021447004 7:20744483-20744505 CTGAGGCAGTGGGGAGGGTATGG - Intronic
1021610591 7:22454237-22454259 CTGAGGCAGGGGTTGGAGGTGGG - Intronic
1021730260 7:23588655-23588677 AGGAGGCTGAGGAGGGAGGATGG + Intergenic
1022012295 7:26319069-26319091 CTGTGTCAGTGGAGGAAGGGAGG + Intronic
1022309838 7:29186465-29186487 GGGAGGCTGAGGAGGGAGGATGG + Exonic
1022324388 7:29317877-29317899 CGGAGGCTGAGGAGGGAGGATGG + Intronic
1022490518 7:30813906-30813928 ATGGGGCAGTGTAGGGTGGAAGG + Intronic
1022507091 7:30914075-30914097 CCGAGGCAGAGGCGGGAGGGTGG + Intronic
1023179135 7:37463668-37463690 GTGAGGAAGTGGGGAGAGGAAGG + Intergenic
1023275862 7:38517993-38518015 GTGAGCCTGTGGAGGGTGGAGGG - Intronic
1023485307 7:40680131-40680153 CTCAGGCAGAATAGGGAGGAAGG + Intronic
1023630351 7:42157458-42157480 CTGGGGCTGTGGTGTGAGGAAGG - Intronic
1023873523 7:44275134-44275156 CTGAGCCAGGGAAGGGAGGGAGG - Intronic
1023883490 7:44334905-44334927 CAAAGCCAGTGGATGGAGGAGGG + Intergenic
1023920926 7:44629323-44629345 CTGAGGGAGTGGAAGGAGCTGGG + Intronic
1023974852 7:45021150-45021172 ATGAGGCTGAGGTGGGAGGATGG + Intronic
1024023513 7:45391735-45391757 CTGAGGCAGGCCAGGGATGAGGG + Intergenic
1024578483 7:50782998-50783020 AGGAGGCAGTGGAGGGAACAAGG - Intronic
1024817797 7:53291879-53291901 CAGAGGCAGTGCAGAGATGATGG + Intergenic
1025056599 7:55770405-55770427 GGGAGGCTGAGGAGGGAGGATGG - Intergenic
1025996236 7:66529251-66529273 CTGTGGGAGAGGAAGGAGGATGG + Intergenic
1026309040 7:69167816-69167838 CGGAGGCTGAGGTGGGAGGATGG + Intergenic
1026557563 7:71421536-71421558 CTGAGGAACTGGAGGGATGTTGG + Intronic
1026571704 7:71537015-71537037 CTCAGGCAGTAGAAGGATGATGG - Intronic
1026826583 7:73586084-73586106 GGGAGGCAGAGGTGGGAGGATGG + Intergenic
1026850428 7:73719893-73719915 CTGGGGCAGAGGAGGCAGCAGGG - Intergenic
1026883372 7:73921305-73921327 GGGAGGCAGAGGTGGGAGGATGG + Intergenic
1026949887 7:74339987-74340009 AGGAGGCTGTGGTGGGAGGATGG + Intronic
1026988200 7:74568157-74568179 CTGTGGGAGAGGAAGGAGGATGG + Intronic
1026999246 7:74640573-74640595 GGGAGGCAGAGGTGGGAGGATGG - Intergenic
1027248125 7:76380733-76380755 GGGAGGCCGAGGAGGGAGGATGG - Intergenic
1027601140 7:80242786-80242808 GTGAGGCAGGAAAGGGAGGAAGG + Intergenic
1028350213 7:89837684-89837706 ATGAGTCATTGGAGGGAGGAAGG - Intergenic
1028600903 7:92599467-92599489 CTGAGACTGAGGTGGGAGGATGG - Intergenic
1028610394 7:92703946-92703968 CTGAGGCAGAGTAAGTAGGAAGG - Intronic
1028846326 7:95484225-95484247 CAGAGGCTGAGGTGGGAGGATGG + Intronic
1029045312 7:97621594-97621616 CTCAGGCAGTGGAGCCAGCATGG - Intergenic
1029098367 7:98107080-98107102 CTGAGGCAGCGGAGGGAGGCAGG + Exonic
1029234188 7:99099595-99099617 CTGTGGCAGCGGTGGGAGGTGGG + Intronic
1029245127 7:99193915-99193937 AGGAGGCAGAGGTGGGAGGATGG - Intronic
1029248788 7:99221555-99221577 AGGAGGCTGAGGAGGGAGGATGG - Intergenic
1029438752 7:100576145-100576167 CAGAGGATGTGGAGGGAGGCTGG + Intronic
1029443373 7:100600322-100600344 GTGCGGCAGAGGAGGGAGGTGGG - Intronic
1029459557 7:100687133-100687155 CTGAGGCAGTGGAGGGAGGAAGG + Intronic
1029473591 7:100769647-100769669 AGGAGGCTGTGGTGGGAGGATGG - Intronic
1029492325 7:100878205-100878227 CGGAGGCTGAGGCGGGAGGATGG + Intronic
1029547564 7:101218376-101218398 CGGAGGCTGAGGTGGGAGGATGG - Intronic
1029549742 7:101231457-101231479 CTGAGGCGGGGGAGGGGGGGTGG - Intergenic
1029639218 7:101808191-101808213 GGGAGGCCGAGGAGGGAGGATGG + Intergenic
1030162238 7:106520747-106520769 AAGAGGCAGGGGCGGGAGGATGG + Intergenic
1030288065 7:107847140-107847162 GTGGGGCAGGGGTGGGAGGATGG + Intergenic
1030881519 7:114886211-114886233 ATGATGCAGGGGAGGGAAGAAGG + Intergenic
1031493668 7:122420905-122420927 CTGGGGAAGGGGAGGGAGGATGG + Intronic
1031736466 7:125368390-125368412 CTGAGGCACTGGTGGGAGTAGGG + Intergenic
1032027462 7:128455040-128455062 GGGAGGCAGAGGTGGGAGGATGG + Intergenic
1032158647 7:129492363-129492385 CAGAGGGAGTTGAGGGAGAAGGG - Intergenic
1032400169 7:131619270-131619292 CTGAGGGAGGTGAAGGAGGATGG - Intergenic
1032447733 7:131999136-131999158 CCGAGGCTATGGAGGAAGGAGGG - Intergenic
1032474982 7:132205439-132205461 CTGCCCCAGTGGAGGGAGAAGGG + Intronic
1032689005 7:134263941-134263963 CTGAGGGATTGGAGGGAGGGTGG - Exonic
1033150509 7:138910794-138910816 CTGAGGCAGAGGAGGTTGGGAGG - Intronic
1033174783 7:139113964-139113986 CTGAGGCTCTGCAGGGAGGAAGG + Intergenic
1033339219 7:140479083-140479105 CTGCGGCGCGGGAGGGAGGAGGG - Intronic
1033457722 7:141517687-141517709 CTGAGGAAGTGGCTGGATGAGGG + Intergenic
1033475560 7:141688787-141688809 CTGTGGCAGGGCAGGGAAGATGG - Intronic
1034299005 7:149998890-149998912 CTGAGGGAGTGGTGGGAGGGAGG - Intergenic
1034470518 7:151252044-151252066 GGGAGGCGGCGGAGGGAGGAGGG + Intronic
1034623532 7:152474847-152474869 ATGAGGAAGTAGATGGAGGAGGG + Intergenic
1034661326 7:152772418-152772440 GGGAGGCAGAGGTGGGAGGATGG + Intronic
1034807011 7:154097883-154097905 CTGAGGGAGTGGTGGGAGGGAGG + Intronic
1034823675 7:154240485-154240507 CTGAGGCATGGGATGGAAGATGG - Intronic
1035096671 7:156361539-156361561 CTGAGGCAGTAGGGGAAGTAGGG - Intergenic
1035121628 7:156573163-156573185 CTGCGGCAATGGAGGGCAGAGGG + Intergenic
1035127018 7:156616307-156616329 CTGAGACTGTGGAGGGGTGACGG - Intergenic
1035286899 7:157812386-157812408 ATGAGGGAGGTGAGGGAGGAGGG + Intronic
1035414848 7:158674389-158674411 GAGAGGCAGAGGTGGGAGGATGG - Intronic
1035421211 7:158730145-158730167 CTGAGGCAGTGGGAGGTGGCTGG + Intergenic
1035453114 7:158991875-158991897 CTGAGGGAGGGGAGGGAGGGAGG + Intergenic
1035524042 8:298439-298461 CTCACGCAGTGGATGGAAGATGG + Intergenic
1036032849 8:4992221-4992243 CTGAGGCGGAGGCGGGAGGGAGG - Intronic
1036751359 8:11445451-11445473 CTGCAGCTGTGGAGGGAAGAAGG + Intronic
1036756825 8:11476714-11476736 CAGAGGCTTTGGAGGGAGGTGGG - Intergenic
1036968715 8:13330070-13330092 CTGAGGAAGTTGAGGTGGGAGGG - Intronic
1037505259 8:19523367-19523389 CAGAGGCCGAGGTGGGAGGATGG - Intronic
1037523562 8:19703060-19703082 CTGAGGCAGGGGAAGAAGGGAGG + Intronic
1037557858 8:20042968-20042990 AGGAGGCAAGGGAGGGAGGAGGG - Intergenic
1037654202 8:20868889-20868911 GGGAGGGAGTGGAGGGAGGTGGG - Intergenic
1037815905 8:22111752-22111774 GGGAGGCAGCTGAGGGAGGACGG + Intergenic
1037883782 8:22585823-22585845 CTGAGTCAGAGGAGGAAGGGAGG - Intronic
1037915386 8:22769859-22769881 CTGCAGCAATGGCGGGAGGAAGG - Intronic
1038067074 8:23974369-23974391 GTGGGGGAGGGGAGGGAGGAGGG + Intergenic
1038068405 8:23986900-23986922 CTGATGCACAGGAGAGAGGAGGG + Intergenic
1038174407 8:25167033-25167055 CTGAGGCTGAGGTGGAAGGATGG - Intergenic
1038239191 8:25792509-25792531 CTGATGGAGTGAAGAGAGGAAGG + Intergenic
1038647035 8:29370524-29370546 TTCATGCAGTGGAGGGAGGTGGG + Intergenic
1038716121 8:29992706-29992728 GGGAGGCAGGGGAGGGATGAAGG + Intergenic
1038721196 8:30037078-30037100 TGGAGTCAGGGGAGGGAGGATGG - Intergenic
1038773748 8:30509259-30509281 CTGAGAGAGGGAAGGGAGGAGGG - Intronic
1039223099 8:35357147-35357169 CAGATGCAGTGCAGAGAGGAGGG - Intronic
1039352950 8:36782297-36782319 ATGAGGGAAGGGAGGGAGGAAGG - Intergenic
1039855474 8:41408590-41408612 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1040661180 8:49577643-49577665 CTGAGGAATGGGAGGGAAGAAGG - Intergenic
1040991552 8:53356662-53356684 ATGAGGTAGTGGAGTGAGGGGGG + Intergenic
1041149527 8:54916968-54916990 CTGAGACAGTGGAGGCTGGCCGG + Intergenic
1041230738 8:55748556-55748578 GGGAGGGAGGGGAGGGAGGAAGG + Intronic
1041309930 8:56506266-56506288 CTGAGCCAGTGGAGGGAAAAGGG - Intergenic
1041368103 8:57130661-57130683 CTGAGGGAGGGGAAGGAGCAGGG - Intergenic
1041561627 8:59225595-59225617 CTGAGCCAGTCGGGGGTGGAAGG + Intergenic
1041629546 8:60070913-60070935 CTGAGGTAGTGGAAGCAGGTAGG - Intergenic
1041682192 8:60605072-60605094 CTGAGGCTGTGCAGGGTGGTGGG - Intronic
1041747694 8:61226735-61226757 CTGAGGCTGGGGAGGGAAGAGGG + Intronic
1042081151 8:65052927-65052949 CTTAGGGAGGGGAGGGAAGATGG - Intergenic
1042139721 8:65665729-65665751 CTCAGGAAGCTGAGGGAGGAGGG - Intronic
1042604404 8:70531169-70531191 CGGAGGCTGAGGTGGGAGGATGG + Intergenic
1042715060 8:71763596-71763618 CTGATACAGTGGAGATAGGAAGG + Intergenic
1042820052 8:72920536-72920558 CTGAGGCTGAGGTGGGAGGATGG + Intronic
1043153363 8:76746298-76746320 GGGAGGCTGTGGTGGGAGGATGG + Intronic
1043539146 8:81239762-81239784 CAGAGGCTGAGGCGGGAGGATGG - Intergenic
1043952646 8:86326428-86326450 GGGAGGCAGAGGTGGGAGGATGG - Intergenic
1043969452 8:86514091-86514113 GGGAGGCAGAGGTGGGAGGATGG - Intronic
1044192504 8:89335697-89335719 CTGGGTCAGGGGAGGGAGGTGGG - Intergenic
1044392562 8:91669143-91669165 CTGGGCGTGTGGAGGGAGGAAGG - Intergenic
1044483256 8:92718082-92718104 CTGTGGCAGTGGAGAGATAATGG - Intergenic
1044510934 8:93077681-93077703 CAGAGGCTGTGAAGGGAAGAGGG + Intergenic
1044659582 8:94582117-94582139 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1044667711 8:94647900-94647922 GGGAGGCTGAGGAGGGAGGATGG + Intronic
1044679617 8:94763911-94763933 GGGAGGCAGAGGCGGGAGGATGG - Intronic
1044708328 8:95030472-95030494 GGGAGGCAGAGCAGGGAGGATGG - Intronic
1044734037 8:95259347-95259369 GTGAGAAAGTGGAGGCAGGAAGG + Intronic
1044874645 8:96653034-96653056 AGGAGGCTGAGGAGGGAGGATGG - Intronic
1044930682 8:97248851-97248873 CTGAGGCAGGCCAGGGAGGGAGG - Intergenic
1045048114 8:98298333-98298355 ATGAGGCTGAGGTGGGAGGATGG - Intergenic
1045274616 8:100691832-100691854 CAGAGGCTGAGGTGGGAGGATGG + Intronic
1045844301 8:106615501-106615523 CGGAGGCTGAGGTGGGAGGATGG + Intronic
1046103283 8:109639040-109639062 GGGAGGCAGTGGAGTGCGGAGGG + Intronic
1046742072 8:117840244-117840266 CTGGGGCAGTGCAGTCAGGAAGG + Intronic
1046958172 8:120083036-120083058 CTTAGGAAAGGGAGGGAGGAAGG + Intronic
1047003227 8:120593911-120593933 ATCAGGCAGGGGAGAGAGGAGGG + Intronic
1047292618 8:123542769-123542791 CTGGGGCCGAGGTGGGAGGATGG - Intergenic
1047411896 8:124630684-124630706 ATGAGACAGTGGAGGCAGGTTGG - Intronic
1047764920 8:127982568-127982590 GGGAGGCAGGGGAGGGAGGATGG + Intergenic
1048148303 8:131867491-131867513 CTGTGGGCTTGGAGGGAGGAAGG - Intergenic
1048200132 8:132365924-132365946 AGGAGGCTGAGGAGGGAGGATGG + Intronic
1048572941 8:135669949-135669971 GTGAGGCAGAAGAGGGAGGGAGG - Intergenic
1048831544 8:138482249-138482271 GTGAGGAAGTGTAGGGAAGAGGG + Intronic
1048986017 8:139735443-139735465 CAGAGGTAGAGGAGGGAGAAGGG - Intronic
1049276609 8:141723253-141723275 AAGAGGAAGAGGAGGGAGGAAGG - Intergenic
1049597702 8:143492338-143492360 CTGAGGCCCTGGTGGGAGGAGGG - Intronic
1049722153 8:144123376-144123398 CTGAGGCTGGGAAGGGAGGTGGG + Intergenic
1049807108 8:144546074-144546096 CTGAGGGTGAGGCGGGAGGAAGG + Intronic
1049832060 8:144707250-144707272 GAGAGCCAGTGGATGGAGGATGG + Intergenic
1049883470 9:13254-13276 CTGAGGCTGAGGAAGGAGAAGGG + Intergenic
1050412629 9:5382571-5382593 CTGAGGTAATGGAGGAAGGAGGG + Intronic
1050428732 9:5539618-5539640 CTGAGGAAGGGGCGGGAGCATGG + Intronic
1050774798 9:9246486-9246508 CTGTGGGAGTGGAGGCAGGAAGG - Intronic
1050783141 9:9364645-9364667 TGGAGGCAATGGAGGGAGAAAGG + Intronic
1051011016 9:12414456-12414478 TTGAGGTAGAGAAGGGAGGATGG - Intergenic
1051220842 9:14846904-14846926 ATGAGGCAGTGGTGGCAGGAGGG - Intronic
1051325164 9:15958980-15959002 CTGAGGCAGTGGAGAGAGACAGG - Intronic
1051459372 9:17294867-17294889 CGGAGGGAGTGGGGGGAGGGGGG + Intronic
1052443502 9:28529156-28529178 CTGAGGTACTGGAAGGAGAATGG - Intronic
1052475722 9:28956706-28956728 AGGAGGCAGGGGAGGGAGGAGGG - Intergenic
1052899052 9:33774511-33774533 ATGAGGCAGGGCAGGGAGGAGGG + Intronic
1053054264 9:34984906-34984928 CAGAGTCAGAGGAGGGAGGCAGG + Intergenic
1053084993 9:35211854-35211876 CGGAGGCTGAGGCGGGAGGATGG + Intronic
1053184985 9:36008493-36008515 CAGAGGCTGAGGAGGGAGGATGG - Intergenic
1053722141 9:40957526-40957548 CTGAGGTTTTGTAGGGAGGAAGG + Intergenic
1053751956 9:41266199-41266221 CTCAGGCGCAGGAGGGAGGACGG + Intergenic
1054257479 9:62830529-62830551 CTCAGGCGCAGGAGGGAGGACGG + Intergenic
1054343832 9:63894468-63894490 CTGAGGTTTTGTAGGGAGGAAGG - Intergenic
1054750338 9:68898700-68898722 AAGAGGGAGAGGAGGGAGGAAGG - Intronic
1054754792 9:68946741-68946763 CTGAGGTGGTGGGGGTAGGAAGG - Intronic
1054896600 9:70320393-70320415 TTTAGGCAGGGCAGGGAGGAGGG + Intronic
1054909088 9:70437689-70437711 CGGAGGCTGAGGTGGGAGGACGG - Intergenic
1054946886 9:70805180-70805202 GAGAGGCAGAGGAAGGAGGAGGG + Intronic
1055086450 9:72318868-72318890 CGAAGGCAGTGAAGGAAGGAAGG + Intergenic
1055130559 9:72769561-72769583 GTGAGGCAGTGGAGGGTGGCTGG + Intronic
1056021248 9:82440640-82440662 CTGAGGCTGTGCAGGGAAGCTGG - Intergenic
1056198659 9:84253279-84253301 ATGAGGCTGTGTAGGGAAGAGGG - Intergenic
1056803740 9:89712444-89712466 CTCTGGCCGCGGAGGGAGGAGGG - Intergenic
1057171974 9:92968472-92968494 CTGTGGGAGTGGATGGAGGAGGG - Intronic
1057191485 9:93090477-93090499 GCCAGGCACTGGAGGGAGGAGGG - Intergenic
1057519362 9:95749083-95749105 GGGAGGCTGTGGTGGGAGGATGG - Intergenic
1057519798 9:95751821-95751843 CTGAGCCACAGGAGGGAGGATGG + Intergenic
1057548956 9:96038221-96038243 ATCAGGCAGGGGAGGCAGGAAGG + Intergenic
1058412147 9:104745979-104746001 CTGAGGCTGAGGAGGGAAGAAGG - Intergenic
1058418298 9:104810930-104810952 CCCAGGCAGTGGAGGGGGCAGGG + Intronic
1058843375 9:108932840-108932862 TTGAATCAGTGGAGGCAGGAAGG - Intronic
1058989892 9:110245512-110245534 GGGAGGCTGAGGAGGGAGGATGG - Intronic
1059060957 9:111035324-111035346 GGGAGGCGGAGGAGGGAGGATGG - Intronic
1059108410 9:111531784-111531806 ATGAGGCTGAGGAGGGAGGATGG - Intronic
1059179877 9:112201599-112201621 TTGAGGCAATGGAATGAGGAAGG - Intergenic
1059390664 9:113997861-113997883 CTGATGCAGTGGTGCAAGGAGGG - Intronic
1059652492 9:116327822-116327844 CTGGGGAACTGGAGGGAGGCTGG - Intronic
1059788184 9:117609965-117609987 CTGAGGCAGTGAAACCAGGAGGG + Intergenic
1060040925 9:120300282-120300304 ATGAGTCAGTGGATGGATGATGG + Intergenic
1060124850 9:121033877-121033899 AAGAGGGAGGGGAGGGAGGAAGG - Intronic
1060295385 9:122339581-122339603 CTGGGGGAGGGGAGGCAGGAAGG - Intergenic
1060297800 9:122355102-122355124 CTCAGGCACTGGAGGGAGCTGGG - Intergenic
1060414483 9:123420851-123420873 CAGAGGCGGGGGAGGGAGGAGGG + Intronic
1060813148 9:126621221-126621243 CTCAGCCAGGGGAGGGAGGAAGG + Intronic
1060820986 9:126661588-126661610 CTGGGGCAGTTGGGGCAGGAGGG - Intronic
1060864401 9:126983687-126983709 ATGAGGGAGGAGAGGGAGGATGG - Intronic
1060877860 9:127096141-127096163 CTGAGGGAGTGGTGGGGGAAAGG - Intronic
1061022667 9:128026365-128026387 CTGGGGCAGACGAGAGAGGAAGG + Intergenic
1061062086 9:128255503-128255525 CTCAGGCAGGCGAGGGAGGCAGG + Intergenic
1061292411 9:129658694-129658716 CGGAGGCTGAGGTGGGAGGATGG + Intergenic
1061313614 9:129779958-129779980 GGAAGGCAGGGGAGGGAGGAAGG + Intergenic
1061328758 9:129879509-129879531 CTGCTGCTGTGGAGGGTGGAGGG + Intronic
1061516756 9:131094625-131094647 CTGAGAAACTGGAGGGAGGCGGG - Intergenic
1061539919 9:131272619-131272641 CTGGGGCAGGGGAGACAGGAAGG + Intronic
1061603914 9:131694053-131694075 CTGAGGCAGAGGTGGGAGAGGGG - Intronic
1061642650 9:131971387-131971409 ATGAGGCAGCGGAGCCAGGAGGG + Intronic
1061912969 9:133734697-133734719 GTGAGGCCGGGCAGGGAGGATGG + Intronic
1062123619 9:134847862-134847884 CAGAGGGAGTGGGGAGAGGAAGG + Intergenic
1062169972 9:135129385-135129407 CTGGGGCAGTGGGGTGGGGATGG + Intergenic
1062210351 9:135360270-135360292 CTGAGGCCGTGGGGTGTGGATGG - Intergenic
1062390080 9:136330375-136330397 CGGGGACAGGGGAGGGAGGAAGG - Intronic
1062446370 9:136597043-136597065 TTGAGGAAGTGGAGGCAGGCAGG + Intergenic
1062446825 9:136598699-136598721 CTGGGGCAGTGTGGGCAGGAGGG + Intergenic
1062446839 9:136598748-136598770 CTGGGGCAGTGTGGGCAGGAGGG + Intergenic
1062448365 9:136605096-136605118 CTGGGGCAGGGGAGGGCGGCAGG + Intergenic
1062601687 9:137321187-137321209 CTGAGGCTGTGGGGGCAGAAGGG + Intronic
1062720457 9:138040041-138040063 CAGAGGCTGAGGTGGGAGGATGG - Intronic
1203618246 Un_KI270749v1:89704-89726 TTGAGTCAGAGGAGGGGGGAGGG + Intergenic
1185483948 X:468266-468288 CTGGGGCAGGGCAGGAAGGAGGG - Intergenic
1185485831 X:481466-481488 CGGAGGAAGGAGAGGGAGGAAGG + Intergenic
1185485896 X:481690-481712 CGGAGGAAGGAGAGGGAGGAAGG + Intergenic
1185485972 X:481949-481971 CGGAGGAAGGAGAGGGAGGAAGG + Intergenic
1185613713 X:1407642-1407664 GGGAGGCAGAGGTGGGAGGATGG + Intronic
1185854225 X:3519396-3519418 CGGAGGCTGAGGCGGGAGGATGG - Intergenic
1186303421 X:8227137-8227159 ATGAAGGAGAGGAGGGAGGAAGG - Intergenic
1186776083 X:12865869-12865891 CTAAGGTGGTGGGGGGAGGATGG - Intergenic
1186782677 X:12929083-12929105 CTGAGGCAGTAGAGGGTTGAGGG + Intergenic
1187254630 X:17630783-17630805 CTTAGGCAGAGTTGGGAGGAGGG + Intronic
1188562944 X:31490449-31490471 CTGAGGCAGGAGAAGGAGAATGG + Intronic
1188801830 X:34541720-34541742 CTGAGAGAGTGGAGGGAAGTTGG - Intergenic
1188966450 X:36559331-36559353 CTGAGGGTGTGGGGAGAGGAGGG - Intergenic
1189054127 X:37680692-37680714 CTGAGGAAGAAGAGGGAGAAGGG + Intronic
1189247117 X:39571810-39571832 GGGAGGCTGAGGAGGGAGGATGG + Intergenic
1189338596 X:40186951-40186973 TTGAGACAGGGCAGGGAGGAAGG + Intergenic
1189437567 X:41006478-41006500 GTGAGGCAGAGGCAGGAGGATGG - Intergenic
1189943016 X:46146534-46146556 CAGAGGCAGAGCGGGGAGGATGG - Intergenic
1190030085 X:46963674-46963696 CTGGGGCAGTGGTAGGAGGTAGG + Intronic
1190286670 X:48966122-48966144 CTGAGGCAGTGGAGTTGGCAAGG + Exonic
1190552957 X:51603622-51603644 CTGAGGAAATGGATGGGGGAGGG - Intergenic
1190562023 X:51695540-51695562 CCGAGGCAGTGGGTGGAGGTTGG + Intergenic
1190575032 X:51827156-51827178 CAGAGGCTGAGGTGGGAGGATGG + Intronic
1190912849 X:54788447-54788469 CTGGGGAAGAGGAGAGAGGATGG - Intronic
1190918105 X:54824923-54824945 CTGGGGAAGAGGAGAGAGGATGG + Intergenic
1191054984 X:56232309-56232331 CTGAGAAGGAGGAGGGAGGAAGG - Intergenic
1191796279 X:65025251-65025273 GGGAGGCTGTGGTGGGAGGATGG - Intronic
1191842830 X:65525153-65525175 CTGAAGCAGCATAGGGAGGAGGG + Intronic
1192424999 X:71067800-71067822 CTGAAGGAAGGGAGGGAGGATGG - Intronic
1193424821 X:81328817-81328839 GTGTGGCAGTGTTGGGAGGAGGG + Intergenic
1193484727 X:82072541-82072563 GTGAAGCATTGGAGGGTGGAGGG - Intergenic
1193516985 X:82478261-82478283 CTGAGGATCTGGAGGGAGGCAGG - Intergenic
1193601661 X:83513928-83513950 CAGAGGTTGTGGAGGGAGGTAGG + Intergenic
1193824452 X:86205663-86205685 GGGAGGCTGAGGAGGGAGGATGG - Intronic
1194655589 X:96569656-96569678 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1195923547 X:110003955-110003977 CTGAGGCAGACGAAGGAGGACGG + Exonic
1196778102 X:119359620-119359642 CTCAGGGAGTGGAGGGTGGCAGG + Intergenic
1196923397 X:120607787-120607809 TTGGGGAAGTGGGGGGAGGAAGG - Intronic
1197646144 X:129019079-129019101 CAGAGGCAGAGGAGAGAGGATGG - Intergenic
1197720624 X:129742363-129742385 GGGAGGGAGTGGAGGGGGGAGGG - Intronic
1197739973 X:129883347-129883369 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1197894636 X:131298781-131298803 ATGAGGCTGAGGTGGGAGGATGG + Intronic
1198069133 X:133130518-133130540 CTGGGGCAGGAGAGGGAGGAGGG + Intergenic
1198533500 X:137566496-137566518 CAGAGGGATAGGAGGGAGGAGGG - Exonic
1198937610 X:141915171-141915193 GTGAGGCAGAGCAGGGAGGGGGG + Intergenic
1198961444 X:142187693-142187715 GTGAGGCAGAGCAGGGAGGGTGG - Intergenic
1199112294 X:143949164-143949186 CTCAGGCACTGGAGAGAGGAAGG + Intergenic
1199207148 X:145161996-145162018 GTGAGGCTGAGGTGGGAGGATGG + Intergenic
1199617744 X:149671374-149671396 TTGGGGAAGTGGATGGAGGAGGG + Intergenic
1199624898 X:149731875-149731897 TTGGGGAAGTGGATGGAGGAGGG - Intergenic
1199791625 X:151160863-151160885 CTGTCCCAGTGGAGGGAGGCAGG - Intergenic
1199871718 X:151904388-151904410 CTGATGGTGGGGAGGGAGGAAGG - Intergenic
1200148866 X:153941828-153941850 AGGAGGCAGAGGAGCGAGGATGG - Intronic
1200402346 X:156026895-156026917 CTGAGGCTGAGGAAGGAGAAGGG - Intergenic
1200431505 Y:3088330-3088352 CTGAGACGGTGGAAGGGGGAGGG - Intergenic
1200925835 Y:8653897-8653919 CTGAGGCCCTGGATGAAGGAAGG + Intergenic