ID: 1029459607

View in Genome Browser
Species Human (GRCh38)
Location 7:100687305-100687327
Sequence AATCCAGCGCAGCCAGAGCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 124}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029459607_1029459620 28 Left 1029459607 7:100687305-100687327 CCCAGCTCTGGCTGCGCTGGATT 0: 1
1: 0
2: 0
3: 8
4: 124
Right 1029459620 7:100687356-100687378 CGCCTTCTTCGATGCTTCTTTGG 0: 1
1: 0
2: 0
3: 7
4: 67
1029459607_1029459613 -1 Left 1029459607 7:100687305-100687327 CCCAGCTCTGGCTGCGCTGGATT 0: 1
1: 0
2: 0
3: 8
4: 124
Right 1029459613 7:100687327-100687349 TTCCCGGGGGCTTCGTCCAAAGG 0: 1
1: 0
2: 0
3: 2
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029459607 Original CRISPR AATCCAGCGCAGCCAGAGCT GGG (reversed) Exonic
900300481 1:1974410-1974432 AATCCAGCCCGGCTAGAGCCTGG + Intronic
900703846 1:4063716-4063738 CATCCAGCCCAGCCCGACCTAGG - Intergenic
901056308 1:6450129-6450151 CACCCAGCACAGCCAGGGCTGGG + Intronic
901572569 1:10173662-10173684 TCTCCAGCCCAGCCAGAGGTCGG + Intronic
902478041 1:16698361-16698383 CACCCAGCACAGCCAGGGCTGGG - Intergenic
902820129 1:18938593-18938615 AAGTCAGCACAGGCAGAGCTGGG - Intronic
906810687 1:48824239-48824261 AAACCAGCACACCAAGAGCTAGG + Intronic
906933387 1:50190770-50190792 AGTTCTGCACAGCCAGAGCTAGG - Intronic
908750027 1:67413200-67413222 CATCCAGTTAAGCCAGAGCTGGG + Exonic
909823160 1:80092096-80092118 TATCCAGCTAAGCCAGAGCTGGG + Intergenic
915554625 1:156654571-156654593 AACCCAGCGCAGGCAGAGTCGGG - Intronic
921508214 1:216000422-216000444 AATCCAGGACAGTCAGAACTGGG + Exonic
1062815936 10:499991-500013 AATCCACCCGAGCAAGAGCTGGG - Intronic
1063320212 10:5045418-5045440 GATCCATTGCAGCCAGAGCAGGG + Intronic
1070889276 10:79930037-79930059 AATCCAGCCCCGACAGGGCTCGG - Intergenic
1071431507 10:85610592-85610614 CATCCAGCCCAGCCAGGGCATGG - Intronic
1076680790 10:132170235-132170257 AGGACAGCGCAGCCAGAGGTCGG + Exonic
1077062826 11:625296-625318 AAGCCAGGGCAGCCTGGGCTAGG - Intronic
1077184194 11:1229051-1229073 AGTCCACAGAAGCCAGAGCTAGG - Intronic
1084088125 11:66864087-66864109 AAACCTGACCAGCCAGAGCTGGG - Intronic
1084371652 11:68749322-68749344 AAGCCAGAGCAGCAGGAGCTTGG - Intronic
1087123521 11:94599647-94599669 AATCCAGCCCAGCCAGTGGAAGG + Intronic
1087679904 11:101209125-101209147 AATCCAACGCAGAGAGCGCTGGG - Intergenic
1090260323 11:125314655-125314677 TCTGCAGCACAGCCAGAGCTGGG - Intronic
1090584864 11:128200509-128200531 AATCCGGCGCATGCAGAGCTGGG + Intergenic
1098411956 12:70195743-70195765 AATCCAGCAGAGCCAGATCATGG - Intergenic
1103208012 12:119145502-119145524 AAACCAGCTCAGCCAGGTCTCGG + Exonic
1103231779 12:119337232-119337254 AATCCAGAGCAGCCCGCTCTGGG + Intronic
1106590542 13:31094798-31094820 AATCCAGCTCAACCAGTTCTAGG - Intergenic
1112429613 13:99339168-99339190 GATGCTGCGCAGCCCGAGCTTGG - Intronic
1113129802 13:107023351-107023373 TTTCCAGCCCAGCAAGAGCTGGG - Intergenic
1115761924 14:36583785-36583807 ATTGAAGCGCGGCCAGAGCTAGG - Intergenic
1115923558 14:38405923-38405945 AATGCAGGGCAGACAGGGCTTGG - Intergenic
1116087039 14:40253791-40253813 AATCCAGCTCAGCAACAGGTGGG - Intergenic
1119560735 14:75587537-75587559 AAACCAGTGAATCCAGAGCTGGG + Intronic
1120728937 14:87980018-87980040 GATCTATTGCAGCCAGAGCTAGG - Intronic
1121563499 14:94892014-94892036 AGTCCAGGGCACCCAGAGCCAGG + Intergenic
1126797047 15:52267875-52267897 CCTTCAGCCCAGCCAGAGCTTGG + Intronic
1128611863 15:69080417-69080439 AATCCTGAGCTGCCAGAGCTTGG - Intergenic
1129607504 15:77031974-77031996 AATGCAGCACAGCCAGGCCTTGG - Intronic
1129968031 15:79754195-79754217 AGTCCAGGGCAGCCAGAAGTGGG + Intergenic
1135035835 16:19076041-19076063 CATACAGCACAGACAGAGCTGGG + Intronic
1136364221 16:29801611-29801633 AACCCAGCAGACCCAGAGCTTGG + Intronic
1138687020 16:58734456-58734478 AATGAAGCGCAGCAAGGGCTGGG - Intergenic
1139244962 16:65432738-65432760 AATACAGCTCAGCCAGAACTGGG - Intergenic
1143369516 17:6429651-6429673 AATGCAGGGCAGCCAGTGCCAGG - Intronic
1143859484 17:9878080-9878102 AACCCAGCCCACCCAGAGCAAGG + Intronic
1148229684 17:45924092-45924114 ATTCCAGGGGAGACAGAGCTTGG - Intronic
1149595069 17:57860562-57860584 AATTCTGTGCAGCCAGTGCTAGG + Intergenic
1150272103 17:63873287-63873309 AAGCCAGGGCAGGCAGAGCAGGG + Exonic
1150275651 17:63896183-63896205 AAGCCAGGGCAGGCAGAGCAGGG + Exonic
1150277783 17:63910872-63910894 AAGCCAGGGCAGGCAGAGCAGGG + Exonic
1151054299 17:71013577-71013599 CATCCAGGTAAGCCAGAGCTGGG - Intergenic
1151329387 17:73398035-73398057 CATCCAGCGCAGCCACAGGCTGG + Exonic
1151591843 17:75049955-75049977 AATCCAGGGCACCCTGATCTGGG + Intronic
1152022963 17:77790718-77790740 AATGCAGGCCAGCCAGAGCAAGG + Intergenic
1154942951 18:21132674-21132696 AATCGAGCGCAGGCACTGCTGGG + Intergenic
1161232910 19:3184033-3184055 AATTCAGCTCAGCCAAAGCAGGG - Intergenic
1161968250 19:7561026-7561048 AAGTCAGTGAAGCCAGAGCTTGG - Exonic
1162125772 19:8498828-8498850 AAGCCCCCGCAGCCCGAGCTGGG - Exonic
1162125795 19:8498936-8498958 AAGCCTCCGCAGCCTGAGCTTGG - Exonic
1162341753 19:10095429-10095451 AATAAAGTGCAGACAGAGCTGGG + Intronic
1165334349 19:35158505-35158527 AAACCAGGGCATTCAGAGCTGGG - Intronic
1166517913 19:43461199-43461221 AAACCAGCGCAGCAGAAGCTGGG + Exonic
1166575703 19:43835500-43835522 AATCCAGAAAAGCCAGAACTGGG - Exonic
1167744053 19:51340647-51340669 CAGGCAGCGCAGCCGGAGCTCGG + Exonic
1202712061 1_KI270714v1_random:24188-24210 CACCCAGCACAGCCAGGGCTGGG - Intergenic
927489220 2:23509735-23509757 AATACAGCAAAGCCTGAGCTTGG + Intronic
929900179 2:45993872-45993894 ACTCCAGCGCAGCCAGGCCATGG - Intronic
929924363 2:46196539-46196561 AATACAGGAGAGCCAGAGCTGGG + Intergenic
935373502 2:102371796-102371818 AATCAAGCGGAGGCAGAGCAGGG + Intronic
935620614 2:105126410-105126432 AATCCGTGGCAGTCAGAGCTTGG - Intergenic
936435566 2:112502339-112502361 AATCCAACCCATCCAGGGCTTGG + Intronic
936497366 2:113034197-113034219 AATCCAGTACATCCAGAGCAGGG - Intronic
944645851 2:201780695-201780717 AGTCGATCGCACCCAGAGCTGGG + Intronic
945942096 2:215960423-215960445 ACTCGAGCACAGCCAGAACTTGG - Intronic
1174189235 20:48728486-48728508 CATTCAGCTCAGCTAGAGCTGGG - Intronic
1174873450 20:54204491-54204513 ATCCCAGGGCAGCCAGAGCGAGG - Intergenic
1175224365 20:57436290-57436312 CATCCAGGCCAGCCAGAGTTGGG - Intergenic
1176135893 20:63521845-63521867 AGTCCAGCACAGCCAGCGCTGGG + Exonic
1179553246 21:42156604-42156626 GACCGAGGGCAGCCAGAGCTGGG - Intergenic
1181873188 22:25919201-25919223 ATTCCATCCCAGCCTGAGCTGGG + Intronic
1182361023 22:29746574-29746596 AATCCAGAGCAGGCAGGGCATGG - Intronic
1183040853 22:35176847-35176869 AATCCAGGGCAGCCAGGAATGGG - Intergenic
1184238336 22:43198447-43198469 AGTCCTGGGCAGGCAGAGCTGGG - Exonic
1185037814 22:48489104-48489126 CATCCACCGCAGCCAGGGCCTGG - Intergenic
950372856 3:12545768-12545790 AATCCAGCGCTGCCACTGCAAGG - Intronic
951365673 3:21779091-21779113 AATCAACCACAGTCAGAGCTGGG + Intronic
953910808 3:46892101-46892123 CAGCCAGCTCAGCCATAGCTGGG + Intronic
954086433 3:48247620-48247642 AATCCTTGGCAGGCAGAGCTGGG - Exonic
955517687 3:59744039-59744061 AATCCAGTGCAGTGAGGGCTGGG + Intergenic
961528715 3:127526337-127526359 AATCCAGGGCAGAAAGAACTTGG - Intergenic
970495973 4:16626595-16626617 AATGAAGCTTAGCCAGAGCTGGG - Intronic
972243063 4:37214914-37214936 CATCCAGTTCAGTCAGAGCTTGG + Intergenic
976146880 4:82050864-82050886 CATCCAGGACAGCCAGAGCAGGG - Intergenic
985165668 4:187091294-187091316 AATCCAGTGAAGCAGGAGCTGGG - Intergenic
986302507 5:6489513-6489535 TATCCAGAGCAGGCAGAGTTTGG + Intronic
986784395 5:11098922-11098944 ATTCCTGCCCAGCGAGAGCTTGG + Intronic
992910708 5:81393856-81393878 AACCCTGCGCAGCCAGGGATAGG - Intronic
994636173 5:102346553-102346575 ACTCCAGAGCAGACACAGCTGGG - Intergenic
995476339 5:112552256-112552278 AAGCCAGTGTAGCCAGAGCATGG + Intergenic
997591514 5:135075996-135076018 CATTCAGCCCAGCCACAGCTTGG - Intronic
998463080 5:142323799-142323821 TAGCCAGGGCAGCTAGAGCTTGG - Intronic
1001961806 5:175884177-175884199 AATCAACCGCAGCCAGAGTTGGG + Intergenic
1003908733 6:10724787-10724809 AACTCAGCAAAGCCAGAGCTGGG - Intronic
1004376588 6:15095998-15096020 ACATCAGGGCAGCCAGAGCTGGG + Intergenic
1006434648 6:34019899-34019921 AGGCCAGTGCAGCCAGGGCTGGG - Intronic
1007178616 6:39912886-39912908 AATCCAGCACAGCCAAGGTTAGG - Exonic
1007395023 6:41572780-41572802 CATCCTGCCCAGCCAGCGCTTGG + Intronic
1010017442 6:71121687-71121709 ACTCCAATGCAGACAGAGCTGGG - Intergenic
1012935084 6:105359100-105359122 TATTCAGGGCAGCCACAGCTGGG + Intronic
1018638425 6:165885068-165885090 AAGCCGGCCCACCCAGAGCTGGG + Intronic
1019637500 7:2083901-2083923 ATTCCAGCGCAGTCAGACCCTGG + Intronic
1022100110 7:27164475-27164497 CAGCCAGGGCAGCCGGAGCTGGG - Intronic
1023801445 7:43838613-43838635 AATCCAGTTCAGCCAAAGCTAGG + Intergenic
1024275210 7:47671666-47671688 AATAAAGCGCAGCCAGAACTGGG - Intergenic
1024963788 7:55004569-55004591 AGCCCCGCGCAGCCAGAGCAGGG + Intergenic
1027430811 7:78110759-78110781 AGTTCAACACAGCCAGAGCTAGG + Intronic
1029437272 7:100570261-100570283 GCTCCAGCGCAGCCTGAGCCTGG + Intergenic
1029459607 7:100687305-100687327 AATCCAGCGCAGCCAGAGCTGGG - Exonic
1030828154 7:114186848-114186870 AACCCAGCCCAGTCACAGCTTGG - Intronic
1033545832 7:142399331-142399353 AATACACAGCAGCCTGAGCTTGG + Intergenic
1033548532 7:142424397-142424419 AACACACCGCAGCCTGAGCTTGG + Intergenic
1035372217 7:158386784-158386806 AAACCACCACAGCAAGAGCTGGG - Intronic
1037768391 8:21785404-21785426 AATCAAGCCCAGCCAGAGAAAGG + Intronic
1037975078 8:23203441-23203463 AATCCAGGGCAGCATGAGGTAGG - Intronic
1042581407 8:70283034-70283056 AATTCAGTACAGACAGAGCTTGG + Intronic
1052137985 9:24939460-24939482 AATCCATCACAGCCAGGGCCTGG - Intergenic
1056688199 9:88783978-88784000 AATACAGCACACCCAGTGCTGGG + Intergenic
1060947888 9:127580923-127580945 AATCCAGTGCAGGCTGGGCTTGG - Intergenic
1062101494 9:134730877-134730899 AATACAGCGAAGCAGGAGCTGGG + Intronic
1195918465 X:109958867-109958889 AATACAGCGCAGGCAGTGCAGGG - Intergenic
1196117297 X:112011530-112011552 AATTCAGCACAGCCAAAGCAAGG - Intronic