ID: 1029459809

View in Genome Browser
Species Human (GRCh38)
Location 7:100688091-100688113
Sequence CAGGCTCAGGGCCCTGTCCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 353
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 326}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029459809_1029459816 6 Left 1029459809 7:100688091-100688113 CCCCGGACAGGGCCCTGAGCCTG 0: 1
1: 0
2: 2
3: 24
4: 326
Right 1029459816 7:100688120-100688142 ACACAGAGAGAAGAAGACAGAGG 0: 1
1: 0
2: 9
3: 179
4: 1436
1029459809_1029459818 12 Left 1029459809 7:100688091-100688113 CCCCGGACAGGGCCCTGAGCCTG 0: 1
1: 0
2: 2
3: 24
4: 326
Right 1029459818 7:100688126-100688148 AGAGAAGAAGACAGAGGTCAGGG 0: 1
1: 0
2: 5
3: 138
4: 1085
1029459809_1029459817 11 Left 1029459809 7:100688091-100688113 CCCCGGACAGGGCCCTGAGCCTG 0: 1
1: 0
2: 2
3: 24
4: 326
Right 1029459817 7:100688125-100688147 GAGAGAAGAAGACAGAGGTCAGG 0: 1
1: 0
2: 4
3: 99
4: 987

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029459809 Original CRISPR CAGGCTCAGGGCCCTGTCCG GGG (reversed) Exonic
900077110 1:827014-827036 CGGACTCAGGGTCCTGTCTGAGG + Intergenic
900189109 1:1345853-1345875 AAGGCTGAGGGCCCTGACCTGGG - Intronic
900189932 1:1349090-1349112 CGCGCTCAGGGCCCGGCCCGGGG + Exonic
900365779 1:2311427-2311449 CAGTCTCAGGGTCCTGCCAGCGG - Intergenic
900503529 1:3018079-3018101 CTGGCTCAGGGCCCTGCCGCTGG - Intergenic
900916563 1:5643762-5643784 GAGGCACAGGGCACTGACCGAGG + Intergenic
901008436 1:6183385-6183407 CAGGTTCAGGGCCATGGCCCAGG - Intronic
901377417 1:8849232-8849254 CAGGATGAGGGCCCTGACCAGGG + Intergenic
901746256 1:11375684-11375706 CTGGCTCAGGGCCCTGACCACGG - Intergenic
902373177 1:16017823-16017845 CATGCTCAGGGCCTTCTCCATGG + Exonic
902472295 1:16657279-16657301 CAGGCTCAGGCCTCTGTAGGGGG + Intergenic
902486508 1:16750167-16750189 CAGGCTCAGGCCTCTGTAGGGGG - Intronic
903128257 1:21262197-21262219 CAGGGTCAGGGGCCTGAACGAGG + Intronic
903375978 1:22866236-22866258 CATGGTCAGGGCCATGTCCATGG + Intronic
906323407 1:44830053-44830075 AATGCTCAAGGCCCTGGCCGTGG + Intronic
906709996 1:47922336-47922358 CAGGGTCAGGGCCTGGTCAGAGG + Intronic
908062589 1:60368061-60368083 CAGGTTCAAGGCCCCGACCGCGG - Intergenic
908791743 1:67789698-67789720 CAGGCTCAGGGCAGTGCCCTTGG - Intronic
908842259 1:68292036-68292058 CAGGTTCAAGGCTCTGTCTGGGG - Intergenic
912456528 1:109802085-109802107 CAGGATCAGGGCTCAGTCAGAGG - Intergenic
913435443 1:118842706-118842728 CAGGCCCAGGTCTCTGGCCGAGG + Intergenic
913584541 1:120261093-120261115 CACGCACAGGGGCCTGTCAGGGG + Intergenic
913623643 1:120637266-120637288 CACGCACAGGGGCCTGTCAGGGG - Intergenic
913966426 1:143381207-143381229 CAGACCCAGGGCCCAGTCCAAGG + Intergenic
914060800 1:144206814-144206836 CAGACCCAGGGCCCAGTCCAAGG + Intergenic
914118350 1:144759555-144759577 CAGACCCAGGGCCCAGTCCAAGG - Intergenic
914566538 1:148872949-148872971 CACGCACAGGGGCCTGTCAGGGG + Intronic
914606281 1:149257291-149257313 CACGCACAGGGGCCTGTCAGGGG - Intergenic
914879707 1:151538030-151538052 AAGGCTGAGGGCCCTGGCTGGGG - Exonic
920054684 1:203183508-203183530 CAGCCTCAGGGCAGTGTCCTGGG - Intronic
922821403 1:228487906-228487928 GAGGCGCAGGGCACCGTCCGGGG - Intronic
923293290 1:232568269-232568291 CAGGTTGAGGGCCCAGTCCCAGG - Intergenic
923501412 1:234568182-234568204 GAGGCTCAGGGACTTGTCCAAGG - Intergenic
924694306 1:246382870-246382892 CAGGCTCAAGGCCCACTCCAGGG + Intronic
1067342711 10:45418266-45418288 CCGGCCCAGGGCCCTCTCCCAGG - Intronic
1067546078 10:47193488-47193510 CAGGCTCAGTGACCTGCCCGAGG - Intergenic
1067773400 10:49143977-49143999 CAGGCTGAGAGACCTGTCCAGGG - Intergenic
1067830070 10:49606416-49606438 CTGGATCAGTGCCCTGTCAGGGG - Intergenic
1068035842 10:51758856-51758878 CACACTCTGGGCCCTGTCGGGGG - Intronic
1068955860 10:62818218-62818240 CAGCCTCAGGGCCCTGACCGCGG - Intronic
1069858841 10:71457641-71457663 CAGGCACCGGCCCCAGTCCGGGG - Intronic
1069920855 10:71814907-71814929 CATGCTCAGGGCCATGCCCAAGG - Intronic
1070591212 10:77802606-77802628 CAGGCGCAAGGCACTGTCCCCGG - Intronic
1070669481 10:78368018-78368040 CAGGCTGAGGGCCCTGGATGTGG + Intergenic
1070729872 10:78819198-78819220 GAGGTTCAGGGCCTTGTCCAAGG - Intergenic
1070798096 10:79228805-79228827 CAAGCTCAGGTCCCTGTCCTAGG - Intronic
1072003950 10:91224154-91224176 CATGCTCAGGACCCTGCCTGGGG + Intronic
1072680620 10:97503572-97503594 CAGACCCAGGGCCCTGTTTGGGG + Intronic
1072821754 10:98565335-98565357 CACACTCCGGGCCCTGTCAGGGG - Intronic
1075258060 10:120940687-120940709 CAAGCTCAGGGCCCAGGCTGAGG - Intergenic
1075936971 10:126351109-126351131 CGGGCTGAGGGCACTGCCCGTGG - Intronic
1076672247 10:132129661-132129683 CAGGCTCAGGGATCTGCCTGTGG + Intronic
1076712217 10:132343846-132343868 CAGGCTCAGGGCGAAGTCCCCGG - Intronic
1076806032 10:132859235-132859257 CAGGCTCAGGCACCTGACGGAGG + Exonic
1076976676 11:177566-177588 CAGGCTAAGGGCTCAGTCCTAGG + Intronic
1077170740 11:1164810-1164832 CTGGCTGAGGCCCCTGTCCTGGG + Intronic
1077170796 11:1164972-1164994 CTGGCTGAGGCCCCTGTCCCGGG + Intronic
1077170820 11:1165037-1165059 CTGGCTGAGGCCCCTGTCCTGGG + Intronic
1077170844 11:1165101-1165123 CTGGCTGAGGCCCCTGTCCCGGG + Intronic
1077330789 11:1983031-1983053 CAGGCTCTGGGCTCTGTTCCGGG - Intronic
1078313123 11:10266341-10266363 CAGTCTCAGTGCTCTGTCCTTGG - Intronic
1078474542 11:11620186-11620208 CAGGCTCAGGGGCCAGTGCATGG - Intronic
1081269338 11:41065068-41065090 CTGGCTCAGCCCCCTTTCCGGGG - Intronic
1081814042 11:45928819-45928841 CAGCCCCAGAGCCCTGCCCGAGG + Exonic
1082025165 11:47566029-47566051 CAGGCTCAGGGCGGTGGGCGAGG - Intronic
1083679606 11:64345040-64345062 CAGGCTGCGGGCCCAGTCGGAGG + Exonic
1083775059 11:64890559-64890581 CTGGCTCAGGGCCCCATCCTGGG + Intergenic
1086028086 11:82319189-82319211 CATGCACAGGGGCCTGTCAGGGG + Intergenic
1087027283 11:93661923-93661945 CAGGCCGTGGGCCCTGCCCGCGG + Intronic
1089184501 11:116605701-116605723 CAGCCCCTGGGCCCTGTCCAAGG + Intergenic
1089873131 11:121694660-121694682 CAGGGACATGGCCCTGTCGGGGG + Intergenic
1090775322 11:129959565-129959587 CATGACCAGGGCCCTGTCTGTGG - Intronic
1091086740 11:132728170-132728192 CAGGGTGCGGGCGCTGTCCGGGG - Intronic
1202813769 11_KI270721v1_random:38210-38232 CAGGCTCTGGGCTCTGTTCCGGG - Intergenic
1092502792 12:9065010-9065032 CCGGCTCACGGCCCTGCCTGGGG - Intergenic
1095537072 12:43261861-43261883 CTGTCTCTGGGCCCTGTCTGAGG - Intergenic
1095585263 12:43842856-43842878 CAGGCCCAGGTCCCAGTCCCAGG - Intronic
1101322025 12:103680953-103680975 CTGGCTGAGGGCCCTGGCCACGG - Intronic
1102542469 12:113632243-113632265 CAGGCTCTGGCACCTGTCCCTGG + Intergenic
1103611913 12:122129281-122129303 CTGGTTCAGGGCCCTGGCCGAGG + Intronic
1103795346 12:123499439-123499461 CAGGCCCAGCTCCCTGTCCTTGG + Exonic
1104443270 12:128812658-128812680 CATGATAAGGGCCCTGTCAGTGG - Intronic
1104778251 12:131403837-131403859 CAGGCACAGGGGCATGTCCCAGG - Intergenic
1104814452 12:131637749-131637771 CAGGCTCAGGGCCCTGTGGGAGG + Intergenic
1105347893 13:19590687-19590709 CTGGCCCAGGGCCCTGCCCCTGG - Intergenic
1111487686 13:88926180-88926202 CAGGGTCAGGGCACTGTGCACGG + Intergenic
1111932285 13:94524505-94524527 CAGGCTCAGAGTCCTGTCTGAGG + Intergenic
1113378524 13:109784401-109784423 GTGGCTCAGGGGCCTGTCCATGG + Exonic
1114411941 14:22509172-22509194 CAGTGTCAGGGCACTGTCAGAGG + Intergenic
1114626937 14:24136268-24136290 CATGCTCAGGGTCCAGCCCGAGG + Exonic
1114649565 14:24275662-24275684 CTGGCCCAGGGCCCTGACCCAGG - Intergenic
1121332451 14:93058138-93058160 CAGGCCCAGGGCCCTAACAGGGG - Intronic
1122257717 14:100491215-100491237 GAGCCTCAGGGCCCTGACAGAGG - Intronic
1122519659 14:102334327-102334349 CAAGCTCTGGGCACTGTCCTGGG - Intronic
1122694227 14:103545070-103545092 CAGACTCAAGGCCCTGTGCTGGG + Intergenic
1123123351 14:105928274-105928296 CAGGCTCAAGGTCCTGCCCCAGG - Intronic
1123405993 15:20019778-20019800 CAGGCTCAAGGTCCTGCCCCAGG - Intergenic
1123515323 15:21026426-21026448 CAGGCTCAAGGTCCTGCCCCAGG - Intergenic
1124005431 15:25792318-25792340 CTGGCCCAGGGCCCTGTCTCTGG - Intronic
1125886605 15:43234369-43234391 GAGGCCCAAGGCCCTGTCCAAGG + Intronic
1128535452 15:68486845-68486867 GAGGCTCATGGCTCTGTCCCTGG - Intergenic
1128718179 15:69925498-69925520 CAGGCTCAGGGCCTTGTCTTTGG + Intergenic
1129687803 15:77696431-77696453 GAGGCTCAGGGACTTGCCCGGGG - Intronic
1129689345 15:77704635-77704657 CAGGGTCAGGGCCCAGTGTGTGG - Intronic
1129717271 15:77859719-77859741 CTGGCTCAGGCCCCTCTCAGAGG - Intergenic
1130461765 15:84164580-84164602 CTGGCTCAGGCCCCTCTCAGAGG + Intergenic
1130989599 15:88868407-88868429 CAGGCTCCAGGCCCTGGCTGGGG + Intronic
1132375477 15:101325744-101325766 CAGGCCCTGGGCTCTGTCCACGG - Intronic
1132609641 16:808923-808945 AAGGCTGGGGGCCCTGTCCAAGG + Intronic
1132675853 16:1120975-1120997 CAGGCCCGGGGTCCTGTCAGGGG + Intergenic
1132725740 16:1337619-1337641 CAGGCTCCGGGCCTTGGCAGAGG + Intronic
1132739372 16:1403824-1403846 CAAGCACAGGGCCCTGGACGCGG + Intronic
1133237582 16:4394695-4394717 CAGACACAGGGCCCTGTCCCAGG + Intronic
1133934891 16:10260789-10260811 TGGGCTCAGGGACCTGACCGTGG + Intergenic
1136579611 16:31143435-31143457 CAGGGCCAGGCCCCTGGCCGCGG + Exonic
1139951841 16:70676237-70676259 CAGGATCAGGGGCCTTTCCTTGG - Intronic
1142149089 16:88504885-88504907 CAGGCCCAGTGGCCTGTCCTGGG - Intronic
1142349789 16:89574849-89574871 GAGGCTCAGGGCCCCGCCGGCGG - Intergenic
1142381980 16:89738146-89738168 CAGGGGCAGGGCCTTGTCCTGGG - Exonic
1142443736 16:90120608-90120630 CAGGCTAAGGGCTCAGTCCTAGG - Intergenic
1142613431 17:1121678-1121700 AAGGCTCAGAGCCCTGCCTGGGG - Intronic
1143490640 17:7283556-7283578 CACCCTCTGGGCCCTCTCCGTGG + Exonic
1145078431 17:19874470-19874492 CAGCCTCACCGCCCTGTCAGGGG - Intergenic
1145910192 17:28537865-28537887 AAAGCTCAGGGCCCTGTGCCAGG + Exonic
1145912825 17:28552402-28552424 CAGGCCCAGGGCCCAGGCCGGGG - Exonic
1145978173 17:28996330-28996352 CAGGCTCAGGGCCCACACCCTGG - Intronic
1146385381 17:32367769-32367791 CAGGCTCAGGCAGCTGTCCAAGG + Exonic
1146691530 17:34879563-34879585 CAGCCTCAGGTCCCTCTCCCAGG - Intergenic
1146909192 17:36637397-36637419 CTGCCTCAGGGCCCTGTTCTTGG + Intergenic
1147558126 17:41492496-41492518 CCGGCTCAGGGCCCTTCCCTTGG - Intronic
1147647158 17:42040666-42040688 GAGGCCCAGGGCACTGGCCGAGG + Intronic
1147936111 17:44012269-44012291 CAGGCTCAGAAGCCTGTCTGGGG + Intronic
1148189681 17:45669775-45669797 CAGGCTCAGCGCCCTGACCTGGG - Intergenic
1148440540 17:47709480-47709502 CAATCTCAAGGCCCGGTCCGGGG - Intronic
1148582429 17:48752941-48752963 CAGGCTCGGGGGCCTGCCTGCGG + Intergenic
1151205370 17:72502531-72502553 CAGGCTCAGCTCCCTGTGCTGGG - Intergenic
1151508451 17:74544048-74544070 CAGCCTCACAGCCCTGTCCTGGG - Intronic
1151923177 17:77173296-77173318 CAGCCTCAGGGCCCTCCCCCAGG - Intronic
1151960980 17:77405518-77405540 CCTGCACAGGTCCCTGTCCGTGG - Intronic
1152123890 17:78434981-78435003 CAAGAGCAGGGCCCTGTCCTGGG + Intronic
1152395636 17:80031151-80031173 CAGGATCAGGACCCAGTCCCCGG + Intronic
1152553501 17:81041293-81041315 GAGGCTCTGGGGCCTGTCCCAGG + Intronic
1152747862 17:82049524-82049546 CAGGCCAAGGGGCCTGTCCAGGG + Intronic
1156481705 18:37440430-37440452 CAGGCTCAGCCCGCTGTCCCAGG + Intronic
1156820194 18:41363061-41363083 CAGACACTGGGGCCTGTCCGAGG - Intergenic
1158389685 18:57034945-57034967 CAGGGTCAGAGCCCTGACAGAGG + Exonic
1158538360 18:58328986-58329008 CATGCTCAGGGACGTGTCCTCGG + Exonic
1160340536 18:78085381-78085403 CAAGCTCAGGGACCTGTTAGAGG - Intergenic
1160387134 18:78503532-78503554 CTGGCTCAGGGCACTGTGCAGGG + Intergenic
1160806317 19:993722-993744 CTGGCCCAGGCCCCTGTCTGTGG + Intronic
1160861757 19:1240161-1240183 CAGGCTCAAGGCCCTTTCCAGGG + Intergenic
1160932869 19:1578807-1578829 GAGGCTCAGGGCCAAGTCTGGGG - Intronic
1161077122 19:2291203-2291225 CAACCTCACGGCTCTGTCCGGGG - Exonic
1161085776 19:2334222-2334244 CCTGCTCAGGGCTCTGCCCGTGG + Intronic
1161091663 19:2363301-2363323 CAGGCTGGGGACTCTGTCCGCGG + Intergenic
1161283861 19:3459066-3459088 CAAGCTCAGGGCCCTTTGAGCGG - Intronic
1161950463 19:7464922-7464944 CAGGCTCAGGGCACTCACCATGG + Intronic
1162395653 19:10416951-10416973 GAGTCGCAGTGCCCTGTCCGTGG + Intronic
1162801004 19:13110387-13110409 CAGGCTCAGGGCCAGCTCCCTGG + Intronic
1162966254 19:14157529-14157551 CTTGCCCAGGGCCCTGTCTGTGG - Intronic
1163595421 19:18218516-18218538 CTGGCTCAGGGCCTTGGCCTTGG + Intronic
1163654596 19:18538397-18538419 CAGGCACAGGGCCGCGTGCGGGG + Exonic
1164711807 19:30362197-30362219 CACTCTCAAGGCCCTGTCCAAGG + Intronic
1165152112 19:33766952-33766974 CAGTCCCAGGTCCCTGTCTGTGG - Intronic
1165324917 19:35108967-35108989 CTGGCTCAGAGCCCTGTCCTCGG - Intergenic
1167377715 19:49120357-49120379 CAGGCTCGTGGCCCCGTCCTCGG + Intronic
1167502607 19:49856288-49856310 CCCGCTCAGGGCCCTGTCCCTGG - Intronic
1167562291 19:50233055-50233077 AAGGCTCAGGACGCTGTCCCAGG + Intronic
1167593052 19:50414781-50414803 CAGGCTCAGGGTCTTGGCCATGG + Intronic
1167746579 19:51354416-51354438 AAGGGGCAGGGCCTTGTCCGGGG + Exonic
1168403633 19:56099795-56099817 CAGGCTGGGGGCCGTGTCAGGGG + Intronic
1202700208 1_KI270712v1_random:158702-158724 CAGACCCAGGGCCCAGTCCAAGG + Intergenic
1202704692 1_KI270713v1_random:14073-14095 CAGGCTCAGGCCTCTGTAGGGGG + Intergenic
926073786 2:9923751-9923773 CAGGGTCAGCGCCATGTCTGAGG + Intronic
926437642 2:12854200-12854222 CAGGTCCAGAGCCCTGCCCGAGG + Intergenic
926931622 2:18046886-18046908 CAGGATAAGGGCCCAGTCCAGGG - Intronic
927267047 2:21162769-21162791 AAGGCTCACGGCCCTGCCCAGGG + Intergenic
927845238 2:26468228-26468250 CAGGCTAAGGCCCTTGTCCAGGG - Intronic
928391084 2:30911571-30911593 CGTGCTCAGTGCCCTCTCCGGGG - Intronic
931905940 2:66844167-66844189 CATGCTCAGAACCCTGTCAGAGG + Intergenic
932446726 2:71786163-71786185 GAGGGACAGGGACCTGTCCGTGG + Intergenic
932773262 2:74513390-74513412 AAGGCTCAGGGGCCCGCCCGCGG + Intergenic
934171140 2:89542177-89542199 CAGACCCAGGGCCCAGTCCAAGG + Intergenic
934281446 2:91616495-91616517 CAGACCCAGGGCCCAGTCCAAGG + Intergenic
934574599 2:95392045-95392067 AAGGCTCAGGGCCCTGTGCCTGG - Intergenic
935132572 2:100271631-100271653 CTGGCTCAGGCCCCAGTCAGTGG + Intergenic
935611988 2:105035472-105035494 CAGGCCCAGGGCCCAGTGCTGGG + Intergenic
936339468 2:111618380-111618402 CACGCTCAGATCCCTGTCTGGGG - Intergenic
936492886 2:112989126-112989148 CAGGCACTGGGGCCTGTCAGGGG + Intergenic
937854680 2:126663716-126663738 CAGGGTCAGGGCCTTGCCCAGGG - Intronic
938131364 2:128718317-128718339 CTGGTTCAGTGCCCTGTCCCTGG + Intergenic
943095466 2:183423023-183423045 CAGGTTCAGGGTCCTTTCTGGGG + Intergenic
944842195 2:203635122-203635144 CAGGCTCAGGCAGCTGTCCAAGG - Intergenic
945865371 2:215168582-215168604 CAGGCACCGGGGCCTGTCGGAGG + Intergenic
948334021 2:237193839-237193861 CAGTCTCAGGACCCTGCCCTGGG + Intergenic
948404850 2:237709637-237709659 CAGGGTCAGGGCCCTGCCACAGG + Intronic
948976132 2:241464862-241464884 CTGGCTCAGGGCAATGTCCAGGG + Intronic
1171427661 20:25058507-25058529 CAGGCTCAGGGCCTGGGGCGAGG + Intronic
1172032612 20:31992479-31992501 CAGGCTGAGGTCCCTGTCCTGGG + Intronic
1173503200 20:43568079-43568101 CAGGCCCATGGACCTGTCAGAGG - Intronic
1174383524 20:50172513-50172535 GAGGCACAGGGGCCTGTCCCGGG - Intergenic
1174806537 20:53608537-53608559 CAGTCTCCGGGCCCTGTGGGAGG - Intronic
1175036258 20:56004141-56004163 CGGGCGCCGGGCGCTGTCCGCGG - Exonic
1175389822 20:58620043-58620065 GAGGCTCAGGGACTTGCCCGAGG + Intergenic
1175488862 20:59365243-59365265 CAGAGTCAGGCCCCTGTCAGAGG - Intergenic
1175506899 20:59492441-59492463 CAGGCTCAGAGCCCAGTGTGAGG - Intergenic
1176044844 20:63087207-63087229 CAGGTTCATGACCCTGTCTGTGG + Intergenic
1176078563 20:63260364-63260386 CAGGCTCGGGGCCCAGCCAGGGG - Intronic
1176130096 20:63493165-63493187 CAGGCGCAGGGGCTTGTCCGTGG + Exonic
1179893536 21:44349709-44349731 CAGGCTCAGGGCCTGCTCCCTGG - Intergenic
1180067910 21:45421805-45421827 GAGGCTCAGGGCCCTGTGACAGG + Intronic
1180723404 22:17926445-17926467 GATGCTCAGGGCTCTGTCCTTGG + Intronic
1181434075 22:22900227-22900249 CTGGCTCAGGGCTCAGTCCCTGG - Intergenic
1181435013 22:22905593-22905615 CTGGCTCAGGGCTCAGTCCCTGG - Intergenic
1181538788 22:23562018-23562040 CAGGCTGAGGGCCCTGGCACAGG - Intergenic
1181566543 22:23742258-23742280 CAGGCTGTGGGCCCTGTGCTGGG - Exonic
1182279340 22:29208956-29208978 GAGGGTCAGGGCCTTGTCCAAGG + Intronic
1182359805 22:29739844-29739866 CAGGCTCCGTGCCCTGCCCTGGG - Intronic
1182711369 22:32325343-32325365 CAGTCTTGGGGCCCTGGCCGGGG + Intergenic
1183032213 22:35114778-35114800 CAGGCTCAGAGCCTTCCCCGTGG - Intergenic
1183077608 22:35436732-35436754 CTGGGTCAGGACCCTGTCCTAGG + Intergenic
1184728969 22:46362874-46362896 CAGCCTCTGGGCCCAGTCTGGGG + Exonic
1184808328 22:46811187-46811209 CAGGCTTTGGTGCCTGTCCGTGG + Intronic
1184981182 22:48097001-48097023 CAGGCTCTGGGTCCTGCCTGAGG + Intergenic
1185139931 22:49094379-49094401 CAGGCTCAGTGCCCCCTCCCCGG - Intergenic
950124376 3:10502544-10502566 CAGGCACAGGGACTTGTCCAAGG - Intronic
950438267 3:12993403-12993425 CAGGCTCGGGACCCTGGACGCGG + Intronic
950690489 3:14652106-14652128 CAGGTTCAGATCCGTGTCCGAGG - Intronic
953257035 3:41301008-41301030 CAGGCTCAGGGACTTGTCCAAGG + Intronic
953785359 3:45907155-45907177 CAGGCTTAGGCCCCAGTCCCTGG + Intronic
954294878 3:49668705-49668727 AAGGCCCAGAGCCCTGTGCGGGG + Exonic
954374317 3:50186081-50186103 CAGTCCCAGGGCCCTATCCTAGG + Intronic
954686431 3:52372619-52372641 CAGACCCAGGGCCCTGTCCAAGG - Intronic
959085770 3:101849535-101849557 CTGGCTCAGGGAGCTGTCGGCGG - Exonic
959197210 3:103199816-103199838 CAGGCTCAGGTACATGTGCGTGG - Intergenic
960141308 3:114154295-114154317 CAATCTCAGAGCCCTGTCCCAGG + Intronic
960333699 3:116391992-116392014 CAGGCTCATGGCCCTGCCCATGG - Intronic
961322085 3:126083548-126083570 CAGGCTCAGCCCACTGTCCTGGG - Intronic
961376407 3:126468924-126468946 CAGCCCCAGGGCTCTGTCCTAGG + Intronic
961617959 3:128198567-128198589 CAAGCTCATGGCCCTGTCACTGG - Intronic
964814635 3:160703748-160703770 CAGAATCAGGGCCCTGATCGGGG + Intergenic
965558491 3:170040005-170040027 CAGGCACGGGGGCCTGTCGGAGG + Intronic
968039175 3:195574043-195574065 CAGACGCAGAGCCCTGTCCTGGG + Intronic
968364031 3:198171656-198171678 CAGGCTAAGGGCTCAGTCCTAGG - Intergenic
968461842 4:730105-730127 CAGGCTCAGTGCCCACGCCGGGG + Intronic
968483606 4:848378-848400 GAGGCTCAGGCCCCTGACGGAGG + Intergenic
968673870 4:1866578-1866600 CAGGCTGAGCGCCATGTGCGAGG + Intergenic
968742000 4:2335782-2335804 GAAGTCCAGGGCCCTGTCCGGGG + Exonic
969028624 4:4193711-4193733 CAGACCCAGGGCCCAGTCCAAGG - Intronic
969278084 4:6150451-6150473 CGTCCCCAGGGCCCTGTCCGGGG + Intronic
969457066 4:7306249-7306271 CTGGCTCAGGGCACTGTGCTGGG + Intronic
969533127 4:7740463-7740485 TAGGGGCAGGGCCATGTCCGGGG - Exonic
971154951 4:24071787-24071809 CAGGGTCTGGGACCTGTCCAAGG - Intergenic
971312336 4:25536189-25536211 CAGGCTCAGGGCAGTGTCAAGGG - Intergenic
972631504 4:40846066-40846088 GAGGCTAAGGGCCCTGACCAAGG - Intronic
972954952 4:44377445-44377467 CAGGCTCAAGGCCATTTCTGGGG + Intronic
972960779 4:44448989-44449011 GAGGCTCGGGTCCCAGTCCGGGG - Intergenic
979448368 4:120840307-120840329 TTGGCTCAGGGCCCTGCCTGGGG + Intronic
986330180 5:6712270-6712292 CAGCTTCAGGGCCCTGGCCCGGG + Intergenic
987334138 5:16883957-16883979 CAGGCACAGTGCCCTGTTCCGGG - Intronic
989406094 5:41062699-41062721 CATGCTCAGGGTCCTTTCCAGGG - Intronic
993737882 5:91499375-91499397 GAGGCTTAGGGACCTGTCCCCGG + Intergenic
999194250 5:149771318-149771340 CAGGCTCAGGGCCATTTAGGTGG + Intronic
1000447750 5:161345025-161345047 CACACACAGGGCCCTGTCTGGGG + Intronic
1002193753 5:177491641-177491663 CAGGCACAGGGCCCCTCCCGAGG - Intronic
1002381225 5:178831453-178831475 GGGGCTCAGGGCCCTGTGGGTGG - Intergenic
1002702387 5:181133817-181133839 CAGCCTCTGGGCCCTGTGCCAGG - Intergenic
1004204097 6:13575055-13575077 AAGGCTCAGGGCCTAGTCCCTGG + Intronic
1004864230 6:19837675-19837697 CAAGCTCCGGGCCCCGTCCGCGG - Exonic
1006059797 6:31411577-31411599 CAGGCTCAGGATTCTGTCGGAGG - Intronic
1006072288 6:31506648-31506670 CAGGCTCAGGCTTCTGTCAGAGG - Intronic
1006119087 6:31793085-31793107 GGGGCTCAGGGCCCTGCCCAGGG + Exonic
1006423683 6:33950813-33950835 CAGCCTCAGGGCCCTGAGAGGGG + Intergenic
1006806623 6:36793332-36793354 CAGGCACTGTCCCCTGTCCGTGG - Intronic
1007282819 6:40724892-40724914 CCAGCTCAGGCCCCTGTCTGAGG - Intergenic
1007701349 6:43768285-43768307 CTGGCTCAGGGCCCCCTCCCAGG - Intergenic
1007701921 6:43770793-43770815 CGGGCTCCGGCCCCTGCCCGCGG - Exonic
1011113061 6:83859751-83859773 CCGGCCCCGGGCCCTGCCCGGGG - Exonic
1011696903 6:89921264-89921286 CAGGCGAAGGGCCCTGTTCAGGG + Intergenic
1013421531 6:109971364-109971386 CAGTCTCAGTGCCCTGTGCCAGG + Intergenic
1016840552 6:148520240-148520262 CTTGCTCAGGGTCCTGTCTGAGG - Intronic
1017043661 6:150327518-150327540 CAGGCTGAGGGCGCTGCCAGAGG + Intergenic
1018828471 6:167424260-167424282 CAGGCCCAGGGCCAGGGCCGGGG - Intergenic
1018900769 6:168050685-168050707 CAGGCCCAGGGCCTTGGCCACGG - Intergenic
1019251786 7:18007-18029 CAGGCTAAGGGCTCAGTCCTAGG + Intergenic
1019549022 7:1593116-1593138 GAGGCTCAGAGCCCTTTCCCAGG + Intergenic
1019877549 7:3827684-3827706 CAGGTGCAGGGCCATGTCAGTGG + Intronic
1019928571 7:4208830-4208852 CAGGCGCTGCGCCCTGTGCGTGG - Intronic
1022286081 7:28957020-28957042 CGCGCTCAGCGCCCTATCCGGGG - Exonic
1022310428 7:29191841-29191863 TAGGCTCAGGGACCTGTTTGTGG - Intronic
1023873501 7:44275047-44275069 CAGGGTCAGGGGCTTGTCAGTGG - Intronic
1023995784 7:45158097-45158119 GAGGCACAGGGCCCCCTCCGGGG + Intronic
1024537442 7:50450019-50450041 CAGGCTCGGGGCCAGGTCTGCGG - Intronic
1026877462 7:73887682-73887704 CAGGGTCAGGGCTCAGTCTGGGG + Intergenic
1028064851 7:86370640-86370662 CACACACAGGGGCCTGTCCGAGG + Intergenic
1029269594 7:99369183-99369205 CAGGGGCAGGGCCCTGTCACTGG + Intronic
1029459809 7:100688091-100688113 CAGGCTCAGGGCCCTGTCCGGGG - Exonic
1029471850 7:100759646-100759668 CAGGCTCAGGGCACTGCTCGCGG + Intronic
1029610379 7:101623367-101623389 CAGGCTCTGGGCCATGGCCATGG + Intronic
1032471076 7:132179853-132179875 CAGGCTGAGCGGGCTGTCCGGGG + Exonic
1032844948 7:135744526-135744548 CAGGGTCTCGGCCCTGTGCGTGG + Intronic
1033147348 7:138882876-138882898 CAGGCTCAGGGGTCTGTCATGGG - Intronic
1033546754 7:142407960-142407982 GAAGCTCCGGGCCCTGTCCCAGG - Intergenic
1033656937 7:143381159-143381181 CAGGATCAGGGCCCCTTCCTGGG + Exonic
1035516061 8:232863-232885 CGGACTCAGGGTCCTGTCTGAGG - Intronic
1035564938 8:635192-635214 GAGGCTGAGGGGCCTGTCCTCGG - Intronic
1035687228 8:1533812-1533834 CAGGCTCAGGCCGCTGTGCCAGG - Intronic
1036645803 8:10611025-10611047 CTGGCTCTGGGTCCTGGCCGGGG + Exonic
1039476554 8:37841935-37841957 CCGGCTCAAGGCCCTGCGCGGGG + Exonic
1041252233 8:55945828-55945850 CATGGTCAGGGCTCTGTCCCTGG - Intronic
1044074314 8:87799207-87799229 CACACACAGGGCCCTGTCGGGGG + Intergenic
1045337895 8:101224614-101224636 CAGGCTCAGTGGCCCATCCGCGG + Intergenic
1045477346 8:102564553-102564575 CTGGCTGTGGGCCCTGTCTGAGG + Intergenic
1048335154 8:133497056-133497078 TAGGCTCAGGCCCCTGTGTGCGG - Intronic
1048584764 8:135764686-135764708 CAGGCACAGGGCTCTGTGCTGGG + Intergenic
1049230199 8:141477912-141477934 CAGGGTCAGGGCCCAGGGCGCGG + Intergenic
1049249230 8:141579305-141579327 CAGAATCAGGGCTCTGTCAGTGG - Intergenic
1049381147 8:142316615-142316637 AAGGCGCAGGGCCCTTTCTGGGG - Intronic
1049383764 8:142330694-142330716 CAGGCTGAGGGCCCAGTCTCAGG + Intronic
1049531639 8:143158297-143158319 CAGCCCCTGGGCCCTGGCCGGGG - Exonic
1049545448 8:143228659-143228681 CAGGCACAGGCCCCAGTCCTTGG + Intergenic
1049659327 8:143812681-143812703 CAGGCTCTGGGAGCTGTCCCTGG - Intronic
1053886220 9:42646491-42646513 GAGGCTCAGGGTCCTGTGGGTGG + Intergenic
1054225240 9:62453940-62453962 GAGGCTCAGGGTCCTGTGGGTGG + Intergenic
1057220218 9:93253476-93253498 CAGGCCCAGGGCACTGTCAGTGG - Intronic
1057482493 9:95456332-95456354 CAAGCTCAGTGCCGTGCCCGTGG - Exonic
1057665037 9:97038660-97038682 CAGGGCCAGGGCCCGGACCGAGG + Intronic
1058235673 9:102487108-102487130 CAGGTCCAGAGCCCTGCCCGGGG + Intergenic
1059567452 9:115397230-115397252 AAGTCTCAGGGCCTTGTCCTGGG + Intronic
1060722043 9:125986027-125986049 CAGGCTCGGGGACCTGCCGGTGG - Intergenic
1060977154 9:127771435-127771457 CAGGCGGAGGGCCGTGTTCGAGG - Intronic
1061179188 9:129013944-129013966 CTTGCTCAGGGCCGTGTCCGAGG - Intronic
1061243375 9:129387257-129387279 CAGGCTGAGGGCCCTGGCACAGG + Intergenic
1061450816 9:130666134-130666156 CAGGCTCTGGGCACTGGCAGAGG - Intronic
1061569862 9:131470586-131470608 CAAGCTCAGGTCCCTGTCCAAGG - Intronic
1061801556 9:133115789-133115811 AAGGCTCAGGGACCTAGCCGAGG + Intronic
1062216789 9:135393575-135393597 CAGGCACAGGGCCCGGCCCACGG + Intergenic
1062407165 9:136402348-136402370 AAGGCACAGGTCCCTGCCCGGGG + Exonic
1062582153 9:137233494-137233516 GAGGGTCTGGGCCCTGTCCTGGG + Intronic
1062733803 9:138123384-138123406 CATGCTCAGGACACTGTCCAAGG + Exonic
1062748726 9:138235602-138235624 CAGGCTAAGGGCTCAGTCCTAGG - Intergenic
1203793686 EBV:164819-164841 CATGTTCAGGGCCATGTACGCGG - Intergenic
1185482696 X:459634-459656 CAGGCTCTGGGAGCTCTCCGAGG - Intergenic
1186747364 X:12583634-12583656 CAGACTCAGGGTCCTGGCCAGGG - Intronic
1187388861 X:18872822-18872844 CAGGCTCCGGGGCCTGTGTGTGG + Intergenic
1189239367 X:39513943-39513965 CTGGCTCAGGGCCCTGCCTCAGG - Intergenic
1192190098 X:68985765-68985787 CAGGGTCAGGGCCCAGGCCCAGG + Intergenic
1192252710 X:69426101-69426123 TAGGCTCAGGCTACTGTCCGTGG - Intergenic
1198127245 X:133657648-133657670 CAGGCTCAGGCCCCTTTCCTGGG - Intronic
1199138250 X:144278824-144278846 CTGCCTCAGGGCCCAGTCCTTGG - Intergenic
1199716834 X:150512635-150512657 CAGGCACCGGGCCCTGTACCGGG - Exonic
1202377502 Y:24250570-24250592 CTGGCTCAGGCCCCTCTCAGAGG - Intergenic
1202493279 Y:25419552-25419574 CTGGCTCAGGCCCCTCTCAGAGG + Intergenic