ID: 1029464924

View in Genome Browser
Species Human (GRCh38)
Location 7:100719542-100719564
Sequence ACTACCAGCCTATCCCATTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029464924_1029464932 27 Left 1029464924 7:100719542-100719564 CCTGAATGGGATAGGCTGGTAGT No data
Right 1029464932 7:100719592-100719614 ACATTGAGGGCTCAAGGACGAGG No data
1029464924_1029464931 21 Left 1029464924 7:100719542-100719564 CCTGAATGGGATAGGCTGGTAGT No data
Right 1029464931 7:100719586-100719608 ATGAGGACATTGAGGGCTCAAGG No data
1029464924_1029464929 13 Left 1029464924 7:100719542-100719564 CCTGAATGGGATAGGCTGGTAGT No data
Right 1029464929 7:100719578-100719600 TTTGACAGATGAGGACATTGAGG No data
1029464924_1029464926 4 Left 1029464924 7:100719542-100719564 CCTGAATGGGATAGGCTGGTAGT No data
Right 1029464926 7:100719569-100719591 CCACACCCATTTGACAGATGAGG No data
1029464924_1029464930 14 Left 1029464924 7:100719542-100719564 CCTGAATGGGATAGGCTGGTAGT No data
Right 1029464930 7:100719579-100719601 TTGACAGATGAGGACATTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029464924 Original CRISPR ACTACCAGCCTATCCCATTC AGG (reversed) Intergenic
No off target data available for this crispr