ID: 1029464925

View in Genome Browser
Species Human (GRCh38)
Location 7:100719569-100719591
Sequence CCTCATCTGTCAAATGGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029464925_1029464933 13 Left 1029464925 7:100719569-100719591 CCACACCCATTTGACAGATGAGG No data
Right 1029464933 7:100719605-100719627 AAGGACGAGGCCACTTTCTAAGG No data
1029464925_1029464932 0 Left 1029464925 7:100719569-100719591 CCACACCCATTTGACAGATGAGG No data
Right 1029464932 7:100719592-100719614 ACATTGAGGGCTCAAGGACGAGG No data
1029464925_1029464931 -6 Left 1029464925 7:100719569-100719591 CCACACCCATTTGACAGATGAGG No data
Right 1029464931 7:100719586-100719608 ATGAGGACATTGAGGGCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029464925 Original CRISPR CCTCATCTGTCAAATGGGTG TGG (reversed) Intergenic
No off target data available for this crispr