ID: 1029464931

View in Genome Browser
Species Human (GRCh38)
Location 7:100719586-100719608
Sequence ATGAGGACATTGAGGGCTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029464924_1029464931 21 Left 1029464924 7:100719542-100719564 CCTGAATGGGATAGGCTGGTAGT No data
Right 1029464931 7:100719586-100719608 ATGAGGACATTGAGGGCTCAAGG No data
1029464925_1029464931 -6 Left 1029464925 7:100719569-100719591 CCACACCCATTTGACAGATGAGG No data
Right 1029464931 7:100719586-100719608 ATGAGGACATTGAGGGCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029464931 Original CRISPR ATGAGGACATTGAGGGCTCA AGG Intergenic
No off target data available for this crispr