ID: 1029467900

View in Genome Browser
Species Human (GRCh38)
Location 7:100737405-100737427
Sequence CACAACAAGAAGAGGATCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 1, 2: 0, 3: 12, 4: 190}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029467895_1029467900 -4 Left 1029467895 7:100737386-100737408 CCTTTTCTCTCCGTCCTTGCACA 0: 1
1: 0
2: 0
3: 35
4: 462
Right 1029467900 7:100737405-100737427 CACAACAAGAAGAGGATCCAGGG 0: 1
1: 1
2: 0
3: 12
4: 190
1029467886_1029467900 20 Left 1029467886 7:100737362-100737384 CCCTCCTCCCGCCTGCCCTCGGA 0: 1
1: 0
2: 2
3: 41
4: 436
Right 1029467900 7:100737405-100737427 CACAACAAGAAGAGGATCCAGGG 0: 1
1: 1
2: 0
3: 12
4: 190
1029467883_1029467900 26 Left 1029467883 7:100737356-100737378 CCCTGTCCCTCCTCCCGCCTGCC 0: 1
1: 1
2: 9
3: 125
4: 1195
Right 1029467900 7:100737405-100737427 CACAACAAGAAGAGGATCCAGGG 0: 1
1: 1
2: 0
3: 12
4: 190
1029467893_1029467900 4 Left 1029467893 7:100737378-100737400 CCTCGGACCCTTTTCTCTCCGTC 0: 1
1: 0
2: 0
3: 13
4: 138
Right 1029467900 7:100737405-100737427 CACAACAAGAAGAGGATCCAGGG 0: 1
1: 1
2: 0
3: 12
4: 190
1029467890_1029467900 12 Left 1029467890 7:100737370-100737392 CCGCCTGCCCTCGGACCCTTTTC 0: 1
1: 0
2: 0
3: 16
4: 244
Right 1029467900 7:100737405-100737427 CACAACAAGAAGAGGATCCAGGG 0: 1
1: 1
2: 0
3: 12
4: 190
1029467894_1029467900 -3 Left 1029467894 7:100737385-100737407 CCCTTTTCTCTCCGTCCTTGCAC 0: 1
1: 0
2: 4
3: 34
4: 684
Right 1029467900 7:100737405-100737427 CACAACAAGAAGAGGATCCAGGG 0: 1
1: 1
2: 0
3: 12
4: 190
1029467889_1029467900 13 Left 1029467889 7:100737369-100737391 CCCGCCTGCCCTCGGACCCTTTT 0: 1
1: 0
2: 0
3: 10
4: 224
Right 1029467900 7:100737405-100737427 CACAACAAGAAGAGGATCCAGGG 0: 1
1: 1
2: 0
3: 12
4: 190
1029467884_1029467900 25 Left 1029467884 7:100737357-100737379 CCTGTCCCTCCTCCCGCCTGCCC 0: 1
1: 1
2: 20
3: 212
4: 1937
Right 1029467900 7:100737405-100737427 CACAACAAGAAGAGGATCCAGGG 0: 1
1: 1
2: 0
3: 12
4: 190
1029467887_1029467900 19 Left 1029467887 7:100737363-100737385 CCTCCTCCCGCCTGCCCTCGGAC 0: 1
1: 0
2: 2
3: 32
4: 442
Right 1029467900 7:100737405-100737427 CACAACAAGAAGAGGATCCAGGG 0: 1
1: 1
2: 0
3: 12
4: 190
1029467888_1029467900 16 Left 1029467888 7:100737366-100737388 CCTCCCGCCTGCCCTCGGACCCT 0: 1
1: 0
2: 1
3: 35
4: 454
Right 1029467900 7:100737405-100737427 CACAACAAGAAGAGGATCCAGGG 0: 1
1: 1
2: 0
3: 12
4: 190
1029467892_1029467900 5 Left 1029467892 7:100737377-100737399 CCCTCGGACCCTTTTCTCTCCGT 0: 1
1: 0
2: 1
3: 3
4: 114
Right 1029467900 7:100737405-100737427 CACAACAAGAAGAGGATCCAGGG 0: 1
1: 1
2: 0
3: 12
4: 190
1029467891_1029467900 9 Left 1029467891 7:100737373-100737395 CCTGCCCTCGGACCCTTTTCTCT 0: 1
1: 0
2: 1
3: 20
4: 336
Right 1029467900 7:100737405-100737427 CACAACAAGAAGAGGATCCAGGG 0: 1
1: 1
2: 0
3: 12
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029467900 Original CRISPR CACAACAAGAAGAGGATCCA GGG Intronic
901264189 1:7897333-7897355 CTAAACAAGAATAGGATACAGGG - Intergenic
901933923 1:12615315-12615337 AAAAACAAAAACAGGATCCATGG - Intronic
904448678 1:30597155-30597177 CTCAGCAAGAACAGGATCCCAGG + Intergenic
910123000 1:83810933-83810955 TCCAAAAAGAAGAGAATCCAAGG - Intergenic
910533550 1:88269537-88269559 GTCAGCAAGCAGAGGATCCAAGG - Intergenic
915009933 1:152676138-152676160 CACAGCAAGAAGAGACTGCAGGG - Exonic
915011091 1:152686966-152686988 CACAGCAAGAAGAGACTGCAGGG - Exonic
915406024 1:155660298-155660320 CTCAAAAAGAAGGGGAGCCAGGG - Exonic
915759602 1:158297142-158297164 CACAATAATAAGATTATCCAAGG + Intergenic
915838215 1:159195021-159195043 CTCCACAAGAAGAGGATGAAGGG - Intronic
916956641 1:169843856-169843878 CACAACAAGAGGAGGTTTAAAGG - Intronic
917450952 1:175146886-175146908 CACATCAAGAAGAGGCTCTTAGG - Intronic
917612912 1:176707416-176707438 CACAACAAGCACAGAATACATGG - Intronic
919768508 1:201142355-201142377 CTCACCAAAAAGAGGACCCAGGG - Intronic
921813712 1:219543452-219543474 GACCTCAAGCAGAGGATCCAAGG + Intergenic
922992624 1:229927772-229927794 CACAATCAGAAGAGTATACAAGG + Intergenic
1065225130 10:23535783-23535805 CAACACAAGAAGGGGATTCAAGG - Intergenic
1065616181 10:27526485-27526507 CACATAAAGAAGACTATCCATGG - Intronic
1065664830 10:28047427-28047449 CACTACAAGAAGAGCATTGAAGG - Intergenic
1067146598 10:43698744-43698766 CTCAGCAAGAAGAGGAGCCTGGG - Intergenic
1071832876 10:89389831-89389853 CAGAACAGGAAGTGGGTCCAGGG + Intronic
1074230664 10:111531786-111531808 GAGACCAAGAAGAGCATCCAGGG - Intergenic
1076174714 10:128359228-128359250 GACAACAAGGGGAAGATCCAAGG + Intergenic
1078573779 11:12481867-12481889 GACATCAAGAAAAGGATACAGGG + Intronic
1079276052 11:19038734-19038756 TACACCAAAAAGAGGATCCATGG - Intergenic
1080414308 11:32055254-32055276 CACAGCAAGAAAGAGATCCATGG + Intronic
1080931985 11:36820378-36820400 CACAACCAGAAGATGATATAGGG + Intergenic
1082618069 11:55386543-55386565 CACAGCAATAAGAAGATCTATGG - Intergenic
1084744132 11:71156841-71156863 CACAACAGGAAGAGAAGCTATGG + Intronic
1093661747 12:21765534-21765556 CACACCAAGTGGAGGATTCATGG - Exonic
1093888431 12:24490215-24490237 CAGAGCAAGAAAAGTATCCATGG + Intergenic
1096211545 12:49769961-49769983 CACACCAAGGTGAGGATCCTTGG - Intergenic
1096328698 12:50689590-50689612 TACAACAGGAAGAGTTTCCAGGG + Intronic
1096772969 12:53948128-53948150 AAAAAAAAGAAGAGGAGCCAGGG + Intergenic
1098769350 12:74534312-74534334 CACAACACAAAGAGGATTTAAGG + Intergenic
1100610347 12:96186574-96186596 CAGAACAAGTAGAAGCTCCAAGG - Intergenic
1103360781 12:120352355-120352377 CACAAGAAGAAGAGGATTCTGGG - Intronic
1104453225 12:128888441-128888463 CACAACACCAAGAGGAATCACGG - Intronic
1104574092 12:129950742-129950764 CATAATATGAAGATGATCCATGG + Intergenic
1106083975 13:26523979-26524001 CTCAACAAGCACAGCATCCAGGG + Intergenic
1108114528 13:47112284-47112306 CCCAAAGAGAACAGGATCCATGG - Intergenic
1108826804 13:54422385-54422407 CACAACGAGAACAGCACCCAAGG - Intergenic
1109047421 13:57431011-57431033 CACCACATGAAGAGAATCAAAGG + Intergenic
1109201778 13:59439633-59439655 CAGAAGAAGAAAAGGATACATGG + Intergenic
1110800054 13:79684073-79684095 CACTATAAAAAGAGGATACATGG + Intergenic
1110860441 13:80340652-80340674 CGCAGAAAGAAGAGAATCCAAGG - Intronic
1111718042 13:91905451-91905473 TACAAAAAGAAGTGGGTCCAAGG + Intronic
1112193616 13:97202960-97202982 CAAAACAAGAAGTGGAGCCAAGG - Intergenic
1112394168 13:99013415-99013437 TACAACAAGAACAAGATTCATGG - Intronic
1114079536 14:19191552-19191574 CACAACACATAGAGGATCTAAGG - Intergenic
1114522616 14:23348509-23348531 TAAAACAGGAAGAGGATGCAGGG + Exonic
1115420775 14:33192529-33192551 CATAAGAAGAAGGGGTTCCAAGG - Intronic
1118768235 14:68924427-68924449 CACAACTGGCAGAGGATCGAAGG + Intronic
1120388574 14:83876863-83876885 CAACACAAGAAGAGGATGCTAGG + Intergenic
1120650034 14:87121150-87121172 CACTACAAGAACAGGGTACAGGG + Intergenic
1120748914 14:88179364-88179386 CACAAAAAGAAGAGGAGAGACGG + Intergenic
1122460951 14:101894398-101894420 CACAGCAAGACAAGGACCCACGG - Intronic
1125115896 15:36091321-36091343 CTTGACATGAAGAGGATCCAGGG - Intergenic
1127444290 15:59044329-59044351 AACAATAAGAAGAGTTTCCATGG - Intronic
1127853040 15:62931787-62931809 CAAAACAAGAAGAGGAAATAAGG - Intergenic
1132958644 16:2610202-2610224 CACACCAAGAGCAGGAGCCAAGG - Intergenic
1134705305 16:16298579-16298601 CACAACTAGAAATGCATCCATGG - Intergenic
1134962236 16:18413535-18413557 CACAACTAGAAATGCATCCATGG + Intergenic
1134966533 16:18496134-18496156 CACAACTAGAAATGCATCCATGG + Intronic
1142049174 16:87946859-87946881 GAAAACAAGATGATGATCCAGGG - Intergenic
1142525918 17:540788-540810 CACCACAAGAAGAGACTGCAGGG + Intronic
1144409669 17:14988462-14988484 CACAACAACCAAAGGAACCAAGG + Intergenic
1148715216 17:49711094-49711116 CCCATCAAAAAGAGGACCCAGGG + Exonic
1149585744 17:57785184-57785206 CACTAAGAGAAGAGGATGCAGGG + Intergenic
1151177030 17:72297274-72297296 TACAACTCAAAGAGGATCCAGGG + Intergenic
1152044657 17:77928032-77928054 CATTCCAAGAAGAGGATCCATGG + Intergenic
1153068933 18:1082338-1082360 AAGACCAAGAAGAGGAACCAAGG - Intergenic
1153245807 18:3072024-3072046 CAAAAAAAGAAAATGATCCAGGG + Intronic
1158575216 18:58631481-58631503 CACAAACAGAACATGATCCAGGG + Intergenic
1160380945 18:78455224-78455246 CAGAAGAAGAAGAGAATGCACGG - Intergenic
1160962983 19:1732556-1732578 CACACCATGAAGAGTATCCGTGG - Intergenic
1161533948 19:4807327-4807349 CAGGACAGGAAGAGGATCCTGGG + Intergenic
1163187150 19:15646920-15646942 CATAGCAAGAAGAGGGTCAAGGG - Intronic
1165253852 19:34560717-34560739 CACCACCAGAAGACGTTCCAGGG - Intergenic
1165705945 19:37976251-37976273 TACAACAAGACGAAGACCCAAGG - Intronic
1167115778 19:47488310-47488332 CGCATCAAGAAGACCATCCAGGG - Exonic
1167736342 19:51296683-51296705 ATCTACAAGGAGAGGATCCAAGG + Intergenic
925019802 2:559339-559361 CAAAACCAGGAGAGGCTCCATGG + Intergenic
925501438 2:4509346-4509368 CACAACAGGGAGAGCATCCAGGG - Intergenic
926534779 2:14098242-14098264 CACACAAAGAAAAGGATACATGG - Intergenic
927228372 2:20794044-20794066 CACACAAAGAAGAGGTTTCATGG + Intronic
928409283 2:31041959-31041981 CACAGGAAGAAGAGGATTTAGGG + Intronic
929307217 2:40377169-40377191 CCCATTAAGAAGAGGGTCCAGGG + Intronic
929994115 2:46814471-46814493 CACAAAAAGAAGTTGAACCAAGG + Intergenic
931620942 2:64208688-64208710 CAGAACATGAGGAGGATGCAGGG - Intergenic
934068752 2:88364479-88364501 TTAAAAAAGAAGAGGATCCAAGG + Intergenic
934860330 2:97759336-97759358 GACAGCAAGAAGAGGACCCCTGG + Intronic
937076229 2:119108993-119109015 CAGAACAAGAACTGGATCCCAGG + Intergenic
937487543 2:122331390-122331412 GACAACAAGATGAGCATCCGTGG + Intergenic
937872516 2:126796314-126796336 CCCACCCAGGAGAGGATCCAGGG - Intergenic
939535128 2:143418169-143418191 AACAACAGGAAGAGGATAAAGGG + Intronic
942617939 2:177813955-177813977 CACAAGGAGAAGAGGAACCTGGG + Intronic
942706831 2:178783330-178783352 CACAACAGAAGGAGAATCCATGG - Intronic
945137949 2:206649904-206649926 CACAACAAGAAAAGGAAGCTTGG + Intergenic
947473789 2:230423263-230423285 CCCAATAAGAAGAGAATCTAGGG - Intronic
1168893058 20:1306881-1306903 CAGCACAAGAAGAGGAGGCAGGG + Exonic
1169621993 20:7517615-7517637 AACCACAAGAAAAGGATCCTAGG + Intergenic
1170001525 20:11620073-11620095 CAAAACAAGAAATGGATCAAGGG + Intergenic
1170427006 20:16245176-16245198 CAGCACAAGAATAGGAACCAAGG + Intergenic
1170792250 20:19517770-19517792 CCCTACAAGAAGAGGAGCCAGGG - Intronic
1172547666 20:35774001-35774023 AAGAACAAAAAGAGTATCCAAGG - Intronic
1173176237 20:40766910-40766932 GAAAACAAGAAGAGGAACCCTGG + Intergenic
1174541551 20:51293495-51293517 GACACCAGGAAGAGGGTCCAGGG + Intergenic
1177901012 21:26915030-26915052 CCCAAGAAGTAGAGGAGCCATGG - Intergenic
1178022904 21:28430325-28430347 CCCAACAAGAAAAGAATCCAGGG + Intergenic
1178110563 21:29365738-29365760 AACAACAAGAAGAGGATCCATGG - Intronic
1178159456 21:29894799-29894821 CTCAAACAGAAGTGGATCCAGGG - Intronic
1178808378 21:35858709-35858731 TACAACAACAAGAGGAACCCAGG + Intronic
1179155146 21:38843536-38843558 CATCACAAGAAGAGCATCAAAGG + Intergenic
1180102237 21:45593953-45593975 AACACCAAGCAGAGGAACCACGG - Intergenic
1180501230 22:15931146-15931168 CACAACACATAGAGGATCTAAGG + Intergenic
1184581444 22:45420585-45420607 CAGATGCAGAAGAGGATCCAGGG - Intronic
949509172 3:4753512-4753534 CACAGCAAGATGGGGATGCAGGG + Intronic
950291982 3:11792055-11792077 CACAGCTAGAGGAGGATGCATGG + Intronic
950731146 3:14959048-14959070 CACTAGAATAAGAGGCTCCAAGG - Intronic
950745481 3:15084691-15084713 CAAAAGAAGATGAGGGTCCAGGG + Intronic
952511147 3:34057404-34057426 CAAACCAAGGAGAGGATGCACGG - Intergenic
952633447 3:35498178-35498200 CAAAACAAGAACAATATCCAAGG - Intergenic
954873655 3:53786468-53786490 CAAAACAAAAAGAGGCTTCACGG - Intronic
954941327 3:54375759-54375781 CAGAAAAAGAATGGGATCCAGGG + Intronic
956527320 3:70179264-70179286 CTCAAAAAGAAGGGGAACCAAGG - Intergenic
956898192 3:73685199-73685221 CAAAACAATAGGAGGATTCAGGG + Intergenic
957129241 3:76201978-76202000 CCAAACAAGAACATGATCCAAGG + Intronic
958086889 3:88821102-88821124 CACAACAATAAGAAAATCCATGG - Intergenic
959323854 3:104911049-104911071 CAAAATAAGAAGAGGAGGCAAGG + Intergenic
960711446 3:120534166-120534188 CAAATCAAGAACATGATCCAAGG + Intergenic
963502209 3:146141848-146141870 AACAACACGAAGAGGATGAAAGG + Intronic
967275411 3:187769372-187769394 CAGAACAAGAAGAGGTTCAATGG + Intergenic
967575523 3:191086480-191086502 CAGAAGAAGTAGAGGAGCCAAGG + Intergenic
970323545 4:14899438-14899460 CTTAACAAGAAGAGAATACAAGG + Intergenic
971121097 4:23705913-23705935 CAAAACAAAAAGAGGCTGCACGG + Intergenic
971646027 4:29204421-29204443 CCCAAAAAGTAGAGGTTCCAAGG + Intergenic
973330168 4:48904947-48904969 CACAACATGAAAAGTATGCATGG + Intronic
973833394 4:54784673-54784695 GGCAACAAGAAAAGGAACCAGGG + Intergenic
978562979 4:110053220-110053242 CAGAAGAAGAAGAAGAACCAGGG - Intronic
979936478 4:126703788-126703810 CACAACAAGAATGGGATGAAAGG + Intergenic
982808381 4:159794779-159794801 CACAAAAAGTAGAGGATGGAGGG + Intergenic
983615302 4:169697566-169697588 CACAAAGAGAAGAGGATTCCAGG - Exonic
986301143 5:6479236-6479258 CTGAACAGGAAGAGAATCCAGGG - Intronic
987988283 5:25178295-25178317 CACAATAAAAAGATGATCAAGGG - Intergenic
989506250 5:42230289-42230311 CACAAATATAAAAGGATCCATGG - Intergenic
990000378 5:50885122-50885144 CACCACAGGAAGAGGAATCAGGG - Intergenic
993928846 5:93911035-93911057 AACAACAATGAGAGGATTCAGGG - Intronic
996646077 5:125818570-125818592 CACATCAAGAAGATGATTCAGGG - Intergenic
996668238 5:126085894-126085916 CAGAACACCAAGAGGATACATGG + Intergenic
996937725 5:128967195-128967217 CAAAAAAAGAAAAGGATGCATGG - Intronic
997466580 5:134092081-134092103 CAAAACCAGATGAGGAACCAAGG + Intergenic
997783405 5:136683042-136683064 CACAAGATGGTGAGGATCCATGG - Intergenic
1004643154 6:17535000-17535022 CACAACAAAACCAGCATCCAGGG + Intronic
1006114436 6:31767722-31767744 CACCACAACAGGAGGGTCCAGGG + Exonic
1011716361 6:90109301-90109323 CACAAGAAGAAGTGGTTTCATGG - Intronic
1013403233 6:109819007-109819029 TACAGCAAGAAGAGTATACACGG - Intronic
1016686914 6:146892095-146892117 CACTATTAGAAGAGGATTCATGG + Intergenic
1020162616 7:5783728-5783750 CAGAACAGGACGAGGATCTAGGG + Intergenic
1020457899 7:8395032-8395054 CACAACAAAAAGAAGGGCCAGGG - Intergenic
1021078088 7:16329706-16329728 CACAAAAAGCTGAGGATTCATGG + Intronic
1024503875 7:50144509-50144531 TACAACAAGAAAAGTATTCAGGG - Intronic
1024606573 7:51027083-51027105 CAGACCCAGAAGAGAATCCATGG + Intronic
1026654668 7:72246667-72246689 CAAAACAAGAAGATGGTCAAAGG - Intronic
1029294883 7:99532478-99532500 CTAGACAAGAAGAGAATCCATGG + Exonic
1029467900 7:100737405-100737427 CACAACAAGAAGAGGATCCAGGG + Intronic
1029974021 7:104815755-104815777 CAGATCCAGAAGAGAATCCAGGG - Intronic
1030742245 7:113123903-113123925 CACAGACAGTAGAGGATCCAGGG + Intergenic
1031656092 7:124357659-124357681 CAGAACAAGAAGAAGATGAAGGG - Intergenic
1032840875 7:135712581-135712603 CACAACAGGAAGAGTCACCAGGG - Intronic
1034336271 7:150325400-150325422 CACAACAAGACAAGATTCCAAGG - Intronic
1036423491 8:8620058-8620080 CTCAACAAGAGCAGGATACATGG + Intergenic
1036596583 8:10218443-10218465 CACCAAAAGAAAAGGAACCAGGG - Intronic
1036828196 8:11996231-11996253 CACAACAAGGAGAGGCTTCATGG + Exonic
1040129884 8:43783025-43783047 CACATCACAAAGAGGATTCACGG - Intergenic
1040801384 8:51345083-51345105 GACAACAAAAATAGGATACATGG + Intronic
1040897332 8:52382604-52382626 GACAAAAAGAAGAGGATGAACGG + Intronic
1043350673 8:79357144-79357166 CCGAAAAAGAAGAGCATCCAAGG + Intergenic
1049107655 8:140623797-140623819 CACAAGAAAAAGAGGCCCCAGGG + Intronic
1051239196 9:15034327-15034349 CACAAAGAGAAGAGGATTCCAGG + Intergenic
1052728051 9:32253495-32253517 GACAACAAAAAGGGGATTCAGGG + Intergenic
1052834450 9:33240240-33240262 CACAACAAGGAGGGCAGCCAAGG - Exonic
1052857738 9:33417543-33417565 ATCAACAAGAAGGGGTTCCATGG - Intergenic
1053284551 9:36841832-36841854 CAGAGCAGGAAGGGGATCCAAGG + Intronic
1055324281 9:75112292-75112314 CTCGACAAGAACAGTATCCAGGG + Intronic
1056726148 9:89119977-89119999 TACATTAAGAAGAGAATCCATGG + Intronic
1057152372 9:92807597-92807619 AACAACAGGAAGAGGATCAGGGG + Intergenic
1057310735 9:93941326-93941348 CACAACTAGATGTGGCTCCAAGG + Intergenic
1058111793 9:101038673-101038695 CACATCAAGAAGAGGGAACAAGG + Intronic
1060533617 9:124365000-124365022 CAGAACCAGAAGGAGATCCAAGG + Intronic
1061383169 9:130271552-130271574 CACAACAAGAGGGGTGTCCAAGG - Intergenic
1061757764 9:132827253-132827275 CAATACAAGAACAGGACCCAGGG + Intronic
1061799987 9:133108594-133108616 CACACGAAGAGGAGGCTCCAGGG - Intronic
1186358414 X:8811862-8811884 CAAAACAAGGAAAGGACCCATGG - Intergenic
1188206559 X:27366489-27366511 CACAAAAAGAAAAAAATCCAAGG + Intergenic
1188362633 X:29274623-29274645 CACAATATGAAAAGGATACATGG + Intronic
1189058626 X:37727881-37727903 CTGCACCAGAAGAGGATCCAGGG - Exonic
1190876466 X:54463746-54463768 CACAGCAAGTATAGGGTCCAAGG - Intronic
1191904154 X:66070946-66070968 TACAACAAGAAGAGGAACTTTGG + Intergenic
1192730263 X:73795951-73795973 CACAACCAGAAGAGGAGGCATGG + Intergenic
1195712652 X:107786415-107786437 AAAAACAAGAAGACAATCCAAGG + Intronic
1195903697 X:109824112-109824134 CAGAGCAAGGAGAGGGTCCAGGG - Intergenic
1198692484 X:139299464-139299486 GACAACAACAAGAAGAGCCAAGG - Intergenic
1201147799 Y:11074533-11074555 CACAACAGGAAGAGAAGCTATGG + Intergenic