ID: 1029468309

View in Genome Browser
Species Human (GRCh38)
Location 7:100739982-100740004
Sequence GGTCAGAGTAGGTCACATTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029468304_1029468309 7 Left 1029468304 7:100739952-100739974 CCTGGGCGAGTTACCGATTTTAA 0: 1
1: 0
2: 0
3: 2
4: 43
Right 1029468309 7:100739982-100740004 GGTCAGAGTAGGTCACATTCAGG No data
1029468307_1029468309 -6 Left 1029468307 7:100739965-100739987 CCGATTTTAAATAGGCTGGTCAG 0: 1
1: 0
2: 7
3: 38
4: 191
Right 1029468309 7:100739982-100740004 GGTCAGAGTAGGTCACATTCAGG No data
1029468303_1029468309 15 Left 1029468303 7:100739944-100739966 CCACTGTGCCTGGGCGAGTTACC 0: 1
1: 0
2: 2
3: 49
4: 669
Right 1029468309 7:100739982-100740004 GGTCAGAGTAGGTCACATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029468309 Original CRISPR GGTCAGAGTAGGTCACATTC AGG Intronic
No off target data available for this crispr