ID: 1029469978

View in Genome Browser
Species Human (GRCh38)
Location 7:100748214-100748236
Sequence GGGTGAGAGCAGGCCCTGAG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 411
Summary {0: 1, 1: 0, 2: 4, 3: 38, 4: 368}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029469970_1029469978 18 Left 1029469970 7:100748173-100748195 CCAGCTGTGGCAGTTGATGCAAC 0: 1
1: 0
2: 0
3: 4
4: 109
Right 1029469978 7:100748214-100748236 GGGTGAGAGCAGGCCCTGAGAGG 0: 1
1: 0
2: 4
3: 38
4: 368
1029469969_1029469978 24 Left 1029469969 7:100748167-100748189 CCAGAGCCAGCTGTGGCAGTTGA 0: 1
1: 0
2: 1
3: 27
4: 272
Right 1029469978 7:100748214-100748236 GGGTGAGAGCAGGCCCTGAGAGG 0: 1
1: 0
2: 4
3: 38
4: 368
1029469975_1029469978 -4 Left 1029469975 7:100748195-100748217 CCAGCATTGCTCCTTGTGGGGGT 0: 1
1: 0
2: 0
3: 11
4: 114
Right 1029469978 7:100748214-100748236 GGGTGAGAGCAGGCCCTGAGAGG 0: 1
1: 0
2: 4
3: 38
4: 368
1029469967_1029469978 26 Left 1029469967 7:100748165-100748187 CCCCAGAGCCAGCTGTGGCAGTT 0: 1
1: 0
2: 7
3: 51
4: 373
Right 1029469978 7:100748214-100748236 GGGTGAGAGCAGGCCCTGAGAGG 0: 1
1: 0
2: 4
3: 38
4: 368
1029469968_1029469978 25 Left 1029469968 7:100748166-100748188 CCCAGAGCCAGCTGTGGCAGTTG 0: 1
1: 0
2: 7
3: 56
4: 303
Right 1029469978 7:100748214-100748236 GGGTGAGAGCAGGCCCTGAGAGG 0: 1
1: 0
2: 4
3: 38
4: 368

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029469978 Original CRISPR GGGTGAGAGCAGGCCCTGAG AGG Exonic
900306374 1:2010864-2010886 GGGTGGGGACAGGCCCTGAAGGG - Intergenic
900325551 1:2107091-2107113 GAGGCAGAGCAGGCCCTGCGAGG - Intronic
900403741 1:2483551-2483573 GGGTGAGAGCATGACCTGCTTGG - Intronic
900746052 1:4361459-4361481 GGCTGAGAGCAGGCACTGAGGGG - Intergenic
900908170 1:5575471-5575493 GGGTGACAGCTGACACTGAGTGG - Intergenic
901056148 1:6449374-6449396 TGGTGGGAGGAGGCCCAGAGAGG - Intronic
901871359 1:12140848-12140870 AGGGGAGAGAAGGCCCAGAGGGG - Intronic
902181178 1:14689742-14689764 GGGTCTAAGCAGCCCCTGAGGGG - Intronic
902621999 1:17656122-17656144 GGGTGAGAGCAGCCTCTGCAGGG + Intronic
903011348 1:20332839-20332861 GGGTGAGACCAGGACCTCAGTGG - Exonic
903059663 1:20661176-20661198 GGGTGAGAGCGGGGTCCGAGGGG - Exonic
903068760 1:20716275-20716297 GGGTAAGAGCAGCACCTGCGGGG + Intronic
903282380 1:22257376-22257398 GGGAGGGTGCAGCCCCTGAGAGG - Intergenic
903849430 1:26297183-26297205 GGAGGAGAGGAGGCTCTGAGGGG - Intronic
904287127 1:29459944-29459966 TGGTAAGATGAGGCCCTGAGGGG - Intergenic
904388875 1:30166016-30166038 GGGTCAGAGGTGGCCCTGTGAGG + Intergenic
904391836 1:30191082-30191104 GGGTGAGAGCTGGGCCTCACAGG + Intergenic
904788366 1:32999166-32999188 GGCTGAGAGCCGGGCCAGAGGGG - Intergenic
905646057 1:39625865-39625887 GGGTGGGAGCAGGCTCTGCTGGG + Exonic
906238918 1:44229576-44229598 GGGTGCGGGCAGGACCTGAGAGG + Intronic
907605959 1:55817620-55817642 GGGTGAGGGCAGACCCTGTAGGG + Intergenic
907914897 1:58859826-58859848 AGGAGAGAGAAGGTCCTGAGAGG - Intergenic
908316282 1:62936054-62936076 GGGTGAGAGCCTGCCCTCAAGGG + Intergenic
908429717 1:64044171-64044193 GGGTTAGCTCAGGCCCTGAACGG - Intronic
909594204 1:77386833-77386855 GGGTGAGCGCAGGCAGGGAGAGG - Intronic
912459354 1:109820629-109820651 GTGTCAGAGCAGACCCTTAGTGG + Intergenic
912499940 1:110115019-110115041 GGCTGAGAGCAGGCCAGGGGAGG + Intergenic
913452407 1:119001177-119001199 GGGTGGGAGAAGGGCCTGCGAGG - Intergenic
915730997 1:158054281-158054303 GGGTGAGGGCAGGACCAAAGGGG + Intronic
915934924 1:160084879-160084901 GGGTGCGAGCAGGCCTGGGGAGG + Exonic
918221013 1:182436716-182436738 GGGAGGGAGCAGGCCAAGAGAGG - Intergenic
919697383 1:200591724-200591746 GGGTGACACCTGGCCCTGACCGG - Intronic
920795536 1:209132928-209132950 TGGTGAGAACAGGCTCTGTGTGG + Intergenic
922962709 1:229662211-229662233 GGGTGAGAGAAGGCTCAGCGGGG + Intergenic
923052717 1:230399945-230399967 GGTTGAGAACAGACCCTAAGAGG - Intronic
1064694188 10:17949366-17949388 GGATGAGAGCTGGCACTGAGAGG + Intergenic
1066326787 10:34368380-34368402 AGGTGAGAGCAGGCCGGGCGCGG + Intronic
1066439523 10:35424969-35424991 GGGTGGGAGCAGGTTCTCAGAGG - Intronic
1066442107 10:35448990-35449012 GGATGAGTGCAGGCCTTGAAGGG + Intronic
1067072406 10:43143604-43143626 TTTTGAGAGGAGGCCCTGAGAGG + Intronic
1067216868 10:44310808-44310830 GGGTGTGCGCAGGCCCAGCGTGG + Intergenic
1067224916 10:44369364-44369386 GGGTTAGAGCAGGCCGGGAAGGG - Intergenic
1069474590 10:68721456-68721478 GGGTCGGAGCAGGCCCGGCGCGG + Intronic
1070804242 10:79261383-79261405 GGGAGAGAGCAGGCGCTGGAGGG + Intronic
1073470037 10:103716569-103716591 GGGTGAGAGCAGGAAGTGGGAGG + Intronic
1074287384 10:112110827-112110849 AGGTGAGAGCAGGGCAGGAGAGG - Intergenic
1074530086 10:114291121-114291143 GAGTAAGAGCAGGACCTGAAGGG + Intronic
1075088775 10:119431262-119431284 GGGTCAGAGCCGGCCCTGCCTGG - Intronic
1075557757 10:123445638-123445660 GGGTGAGAGCAGTGCATGTGAGG - Intergenic
1076552191 10:131288509-131288531 GGTGGAGGGCAGGCCCTGGGTGG - Intronic
1076619005 10:131775128-131775150 GGCTGGGAGCAGGCCCTGCACGG - Intergenic
1077062033 11:621740-621762 GGGTGAGGGCAGGAGGTGAGTGG - Intronic
1077196871 11:1285338-1285360 GGGAGACCGCAGCCCCTGAGAGG - Intronic
1077378450 11:2216365-2216387 GGCTGTGAGCGGGGCCTGAGAGG - Intergenic
1077413146 11:2412798-2412820 GGGTGACCTCGGGCCCTGAGGGG + Exonic
1077455424 11:2675657-2675679 GAGTCAGGGCAGGCCCTGGGCGG - Intronic
1077491786 11:2864342-2864364 AGGGAAGAGCAGCCCCTGAGGGG - Intergenic
1078369899 11:10735920-10735942 CGGAGGGAGCAGGCCCTGGGCGG - Intergenic
1078920494 11:15826162-15826184 AGGAGAGAGCAGGCCTGGAGAGG - Intergenic
1079011824 11:16834849-16834871 GGCAGAGAGCAGGCCCTGCCAGG + Intronic
1079163148 11:18012910-18012932 GGGCCGGTGCAGGCCCTGAGGGG - Intronic
1079268404 11:18958116-18958138 GTGTGAGAGGAGTCCATGAGGGG + Intergenic
1079729222 11:23920146-23920168 TGGTTATAGCAGGCCTTGAGTGG - Intergenic
1081605402 11:44524463-44524485 GGCTGGGAACAGGCCGTGAGAGG - Intergenic
1081720538 11:45285644-45285666 GGGTTAGGGAAGACCCTGAGAGG - Intronic
1083143423 11:60739954-60739976 GGGTGAGGGCAGTCCCTAAGGGG + Intronic
1083807902 11:65086124-65086146 TGATGAGTGCAGGCCCAGAGAGG + Intronic
1083877661 11:65532808-65532830 GGGTGTGGCCAGGCCCAGAGTGG + Intronic
1084307550 11:68296926-68296948 GGGTGACAGCAGGCCCAGGGAGG + Intergenic
1084592816 11:70100228-70100250 GGGTGGGAGCAGAGGCTGAGCGG + Intronic
1084857287 11:71997382-71997404 GGGTGAGAACAGGTTCTGAGAGG + Exonic
1084858453 11:72003433-72003455 AGCTGAGAGAAGGCACTGAGAGG + Exonic
1085389188 11:76173660-76173682 GAGACAGAGCAGGCCCGGAGGGG + Intergenic
1086401126 11:86461629-86461651 GGGTGAGGCCAGGCCCTGGTGGG + Intronic
1089151259 11:116366143-116366165 AGGTGAGAGCAGGGCCTGTCGGG - Intergenic
1089781261 11:120874786-120874808 GGGTGAGTGCCTGCCCGGAGAGG + Intronic
1090315894 11:125788199-125788221 GGGTGAGTCCTGGACCTGAGGGG + Exonic
1091990905 12:4955194-4955216 GGGAGTCAGCAGGCCCTGACAGG - Intergenic
1092206868 12:6620187-6620209 GGGTCGGAGCAGCCCCTGACTGG + Exonic
1092233426 12:6790906-6790928 GGCTAAGAGCAGGGCCTGATGGG + Intronic
1092522657 12:9290141-9290163 GGCTGAAAGCAGGCACTGAGGGG - Intergenic
1092529503 12:9332716-9332738 GGGTGAGAGCAGGCACAGAGGGG + Intergenic
1092544628 12:9441756-9441778 GGCTGAAAGCAGGCACTGAGGGG + Intergenic
1093117910 12:15234195-15234217 GGGTGAGAGTAGGCACCGAGTGG - Intronic
1094026409 12:25964011-25964033 TGTTGAGAGCAAGCCCTGAGAGG + Intronic
1094508321 12:31080314-31080336 GGCTGAAAGCAGGCACTGAGGGG - Intronic
1095752864 12:45729927-45729949 GGGTGAGAGCAGAACCGGGGGGG + Exonic
1096109533 12:49020712-49020734 GGGTGAGGGCTATCCCTGAGTGG - Exonic
1096311646 12:50526275-50526297 TGGTGAGAGCTGCCCCTCAGGGG + Intronic
1096396395 12:51269861-51269883 CGGCGAAAGCAGGCCCGGAGGGG - Intronic
1098123765 12:67269390-67269412 GGGAGCGAGACGGCCCTGAGTGG + Exonic
1098863869 12:75740138-75740160 CGGGAAGAGCAGGACCTGAGAGG + Intergenic
1100695779 12:97091179-97091201 GGGTGAGGGGACACCCTGAGGGG + Intergenic
1101469577 12:104984094-104984116 TGGTGAGAGCAGGCTGTGTGTGG + Intergenic
1101711154 12:107267977-107267999 GGTGGAGAGCAGGCCCCAAGTGG + Intergenic
1101794903 12:107964018-107964040 GTGTGGGTTCAGGCCCTGAGTGG + Intergenic
1102496102 12:113320560-113320582 TGGTGAGAGCAGCCCCAGTGAGG - Exonic
1104289339 12:127454552-127454574 GGGTGGGAGCAGGACCTGCCTGG + Intergenic
1104857758 12:131909879-131909901 TGGTGTGAGCAGGGCCTGCGGGG - Intronic
1105502989 13:20988730-20988752 GGGAGTGAGCAGGCTCTGCGGGG + Exonic
1106558656 13:30830881-30830903 GGGAGAGAGCAGGTGCTGAGTGG + Intergenic
1110262695 13:73503049-73503071 GGCTGAGAAGATGCCCTGAGAGG + Intergenic
1112578177 13:100655816-100655838 GGGTGTAACCATGCCCTGAGTGG + Intronic
1113670168 13:112170800-112170822 GGGTGAGAGGAGGCCTTGGGAGG + Intergenic
1113769037 13:112896989-112897011 GGCTGAGAGCCCACCCTGAGAGG + Intronic
1113832256 13:113305274-113305296 GTGTGAGATCAGCCCCTGGGTGG + Intronic
1115277469 14:31623858-31623880 GAGTGAGAGCAGGGCCAGAAAGG + Intronic
1116045184 14:39734362-39734384 AGGTGAAAGCTGGCACTGAGAGG + Intergenic
1117377361 14:55129052-55129074 GGGAGAGCGCGGGCACTGAGGGG - Exonic
1119415831 14:74468576-74468598 GGGGAAGAGCTGGGCCTGAGAGG - Intergenic
1121111196 14:91314227-91314249 GGGAGAGAGAAGGCCTTGAACGG + Intronic
1121454653 14:94030446-94030468 GGGAGAGGTCAGGCCCGGAGAGG + Intronic
1121569822 14:94939390-94939412 GGGAGAGACCAAGCCCAGAGAGG + Intergenic
1122269624 14:100562728-100562750 GGCTCAGGGAAGGCCCTGAGCGG - Intronic
1122353075 14:101108723-101108745 AGGTGGGAACAGGCCCTGGGTGG - Intergenic
1122452811 14:101824795-101824817 AGGAGGGAGCAGGCCCTGTGGGG + Intronic
1122938137 14:104969338-104969360 GGGCTAGAGCAGGCACGGAGAGG - Intronic
1123141309 14:106081847-106081869 GGGTCTCCGCAGGCCCTGAGTGG + Intergenic
1123166476 14:106330068-106330090 GGGTCTCCGCAGGCCCTGAGTGG + Intergenic
1123169157 14:106355104-106355126 GGGTCTCCGCAGGCCCTGAGTGG + Intergenic
1123457756 15:20441368-20441390 GAGGGAGAGCAGGTCCTGTGGGG - Intergenic
1123660314 15:22559049-22559071 GAGGGAGAGCAGGTCCTGTGGGG + Intergenic
1124263902 15:28216522-28216544 GAGGGAGAGCAGGTCCTGTGGGG - Intronic
1124314172 15:28653538-28653560 GAGGGAGAGCAGGTCCTGTGGGG + Intergenic
1125663482 15:41412725-41412747 GGGTAAGAGCAGATTCTGAGGGG - Intronic
1125724553 15:41861674-41861696 GGGTCAGCGCAGGCCCTGTTCGG + Intronic
1127722441 15:61716383-61716405 GGGTTAGGGATGGCCCTGAGCGG - Intergenic
1127853478 15:62935524-62935546 GGCCGAGAGCAGGCCTAGAGGGG - Intergenic
1128214831 15:65927279-65927301 TGGAGAGTTCAGGCCCTGAGAGG + Intronic
1128321305 15:66696617-66696639 GGGTGGGAGCAGGACCTGGTAGG - Intergenic
1128509806 15:68306477-68306499 GGGTGAGCACAGGCCCGGAGGGG - Intronic
1128860566 15:71067844-71067866 GTGGGAGAGCAAGCACTGAGGGG - Intergenic
1129880723 15:79004503-79004525 AGGCGGGAGCAGGCCCTGTGTGG - Intronic
1130133333 15:81161442-81161464 GGCTGAGAGAAAGCCCTAAGGGG + Intronic
1130142115 15:81236341-81236363 TGCTGAGAGCAGCCACTGAGAGG + Intronic
1132569771 16:638950-638972 GGGTGAGGGGAGGCCCTTGGTGG - Intronic
1132925118 16:2425274-2425296 AGAGGAGAGCAGGCCCAGAGAGG + Intergenic
1133108978 16:3534296-3534318 GTGTTTGAGCAGGGCCTGAGTGG + Intronic
1133327293 16:4949460-4949482 GGAAGAGAGCAGACTCTGAGGGG - Intronic
1136336624 16:29614204-29614226 GGATGAGAGGATGACCTGAGGGG + Intergenic
1136363892 16:29799601-29799623 GGGTGAGACCAGGCAGTGGGTGG - Intronic
1136636044 16:31523968-31523990 AGGTGAGAGCAGGCCCTGCAGGG - Intergenic
1136666336 16:31816339-31816361 AGGTGAGAGCAGGCCCTGCAGGG - Intergenic
1136702222 16:32154733-32154755 AGGCGAGAGCAGGTCCTGTGGGG - Intergenic
1136765447 16:32772752-32772774 AGGCGAGAGCAGGTCCTGTGGGG + Intergenic
1136802652 16:33097627-33097649 AGGCGAGAGCAGGTCCTGTGGGG - Intergenic
1137792204 16:51184814-51184836 AGGAGAGAGAAGCCCCTGAGTGG + Intergenic
1139744236 16:69061461-69061483 GGCTGAAAGCAGGACCTGGGAGG + Intronic
1139891824 16:70258061-70258083 GGGAGCCAGCAGGCCCAGAGGGG + Exonic
1140453176 16:75087919-75087941 CTCTGAGAGCAGGCTCTGAGCGG - Intronic
1141436773 16:84004132-84004154 GTGAGAAAACAGGCCCTGAGAGG - Intergenic
1141484184 16:84328047-84328069 GGGTCAGGGAAGGCCCTGTGGGG + Intronic
1141733988 16:85840242-85840264 GAGGGAGTGAAGGCCCTGAGAGG - Intergenic
1142037348 16:87869988-87870010 GGATGAGAGGATGACCTGAGGGG + Intergenic
1142414003 16:89931530-89931552 GGGTGAGAGCAAGCCCTTCAGGG - Intronic
1203067833 16_KI270728v1_random:1034974-1034996 AGGCGAGAGCAGGTCCTGTGGGG + Intergenic
1142474833 17:182519-182541 GAGTGAGGGCAGGGCCTGGGCGG + Intergenic
1142821821 17:2475026-2475048 AGATGAGAGCAGGCCTAGAGTGG - Intronic
1142850243 17:2701271-2701293 GGGAGAGGGCGGGCACTGAGCGG + Intronic
1142850376 17:2701771-2701793 GGGAGACAGCTGGCCCTGGGTGG - Intronic
1143287385 17:5800463-5800485 GGGAGAGAGAAGGCATTGAGTGG - Intronic
1143628453 17:8123846-8123868 GGGTCAGAGCCAGACCTGAGTGG - Intronic
1143663412 17:8341341-8341363 GTGTGGGATCAGGGCCTGAGAGG - Intronic
1144758420 17:17694037-17694059 GGATGAGAGCAGACACTGACTGG - Intronic
1144809584 17:17990165-17990187 GGGTCAGTGTAGACCCTGAGGGG - Intronic
1144848326 17:18231467-18231489 GGTGGACAGCAGGGCCTGAGGGG - Intronic
1145061456 17:19736989-19737011 GGGTGGGAGCAGGAGCAGAGAGG - Intergenic
1146053915 17:29571988-29572010 CGGAGGGAGCAGGCCCTGAAAGG - Exonic
1146827207 17:36033113-36033135 GGGTCAGAGCAAGACCTGAGTGG + Intergenic
1147927192 17:43953275-43953297 CGGTGAGCGCAGGCGCGGAGCGG - Exonic
1147947190 17:44086786-44086808 GGGTGAGGGCAGGCCCTGTCAGG + Intronic
1148000635 17:44385228-44385250 GGGTGAGAGGGGGCCCTGTTTGG + Intronic
1148340016 17:46867776-46867798 GTGTGAGATGAAGCCCTGAGGGG + Intronic
1148957622 17:51366583-51366605 TGGTGGGAGCAGGCTCTGTGTGG - Intergenic
1149095023 17:52829205-52829227 GGGAGAGAGAAGGCATTGAGGGG + Intergenic
1149268333 17:54951816-54951838 GGGTGGTAACAGGACCTGAGGGG - Intronic
1150003369 17:61455477-61455499 GGATGAGAGCACAGCCTGAGAGG - Intronic
1151460113 17:74249406-74249428 GGGTGAGGGCAGGCCTCGGGGGG - Intronic
1151476006 17:74344688-74344710 GGCAGAGAGGAGCCCCTGAGGGG - Intronic
1151556042 17:74847244-74847266 GGGTGGGGACAGGCCGTGAGTGG - Intronic
1151755362 17:76072546-76072568 GGGTGAGAGCTGGACCTGCCTGG + Exonic
1151832022 17:76558472-76558494 GGGTGCAGGCAGGGCCTGAGTGG + Intergenic
1151961590 17:77408650-77408672 GGGTCAGAGCTGAGCCTGAGTGG + Intronic
1152066924 17:78117239-78117261 GGCTGAGAGCAGCCCAGGAGGGG + Intronic
1157542514 18:48521799-48521821 GGAGCAGAGCAGGCCCTGTGCGG - Intergenic
1157975202 18:52319317-52319339 GGGTGAGCAGAGGCCCTAAGGGG + Intergenic
1160127526 18:76189922-76189944 TGGTAGGAGCAGGCCCTGTGTGG - Intergenic
1160526899 18:79543641-79543663 GAGGGACAGGAGGCCCTGAGAGG + Intergenic
1160917975 19:1506766-1506788 GGGTGACAGCAGGGGCTGCGGGG + Exonic
1161044794 19:2129069-2129091 AGGTGAGTGCAGGCCATGCGCGG - Exonic
1161399543 19:4061273-4061295 AGGGGAGATCAGGCCCAGAGAGG + Intronic
1161527727 19:4767582-4767604 GGGAAAGAACAGGCCCTGGGGGG - Intergenic
1162831147 19:13285495-13285517 GGTTGAGAGCAGGCTCTCGGGGG - Intronic
1163726928 19:18928297-18928319 GGCTCAGACCAGGCCCTGGGAGG - Exonic
1163889833 19:20000930-20000952 TGGTGAGAGCAGGCACCTAGAGG + Intronic
1164673311 19:30085509-30085531 GAGTGACAGCCGGGCCTGAGAGG + Intergenic
1165718724 19:38063730-38063752 GGGTCATAGCAGCCCCTGTGGGG + Intronic
1165927004 19:39333036-39333058 GGGTTGGATCAGGCCATGAGGGG - Intronic
1166343420 19:42151510-42151532 GGGTGAGAGCAGGGCCAGAGGGG - Intronic
1166345295 19:42161816-42161838 GGGGGGAAGCAGCCCCTGAGCGG - Intronic
1166892527 19:46002232-46002254 GGGTCAGAGCAGGCCAGGTGCGG - Intronic
1167158689 19:47754519-47754541 CGCTGAGAGCAGGGTCTGAGGGG - Exonic
1167480470 19:49727569-49727591 TGGTGGGAGCAGGCTCTGTGCGG - Intergenic
1167503983 19:49861921-49861943 GGGGGAGAGAAGACCCCGAGCGG + Intronic
1168156646 19:54476995-54477017 GGGTGAGAGCAGACCCAAATGGG + Intergenic
1168242816 19:55095846-55095868 TGGTGAGTGGATGCCCTGAGAGG - Exonic
1168315801 19:55484303-55484325 GATGGAGGGCAGGCCCTGAGGGG - Exonic
925117779 2:1394925-1394947 GGGTCAGAAGAGGCCCTGCGCGG - Intronic
925298731 2:2795185-2795207 GGGTGAGACCAGGTACTGTGGGG - Intergenic
925301181 2:2813781-2813803 GGGTGAGACCAGGCCATGCAGGG + Intergenic
925455642 2:4014432-4014454 GGTTGAGATGAGGCCATGAGGGG - Intergenic
926159485 2:10477603-10477625 GGAAGAGAGCAGGCTCAGAGGGG - Intergenic
927203670 2:20593694-20593716 GGGTGAGAGCGGGCGCAGTGGGG - Intronic
927458287 2:23276193-23276215 GGGTGAGCGCAGACCCTCACAGG + Intergenic
927720154 2:25377294-25377316 AGATGAGACCATGCCCTGAGGGG + Exonic
927843333 2:26458626-26458648 GGGTCTGAGCAGCCCCTGTGGGG + Intronic
927912583 2:26911961-26911983 GGGTGTGTTCAGCCCCTGAGGGG + Intronic
928444336 2:31319534-31319556 GGATGTCAGCAGGCCCTCAGTGG - Intergenic
929086855 2:38176527-38176549 TGGCCAGAGCAGGCTCTGAGAGG + Intergenic
929595172 2:43171037-43171059 GGGAGTGCGCTGGCCCTGAGTGG - Intergenic
930066545 2:47332274-47332296 GGGTGAGTGCAGACCCTCACAGG + Intergenic
931709137 2:64972687-64972709 TGATGGCAGCAGGCCCTGAGAGG + Intergenic
932720815 2:74138035-74138057 GGGAGTGCGCAGGGCCTGAGTGG - Intronic
933250588 2:80024632-80024654 TGGTGGGAGCAGGCTCTGTGTGG + Intronic
933426993 2:82126239-82126261 TGGTGGGAGCAGGCTCTGTGCGG + Intergenic
933633507 2:84682314-84682336 GAGTGACAGCAGGCAGTGAGGGG - Intronic
933966361 2:87432572-87432594 AGGTGAGGGCAGGCACTGAGTGG + Intergenic
934122928 2:88857394-88857416 GGGCGAGCTCAGGCCCTGATGGG + Intergenic
935692102 2:105741307-105741329 GGGTTAGAGAAGGCCTTGAATGG + Intergenic
936327434 2:111517913-111517935 AGGTGAGGGCAGGCACTGAGTGG - Intergenic
937587259 2:123567625-123567647 GAGATAGAGCAGGTCCTGAGAGG - Intergenic
937960733 2:127456022-127456044 TGCTGTGAGCAGGCACTGAGTGG + Intronic
938290926 2:130150100-130150122 TGGTGAGAGCTGGCCTTTAGGGG + Intergenic
938465619 2:131522854-131522876 TGGTGAGAGCTGGCCTTTAGGGG - Intergenic
944104749 2:196068377-196068399 GGGTGAGAGGCGGCTCTGCGAGG - Intronic
947094470 2:226550608-226550630 GCCTGAGAGCAGACCCTGTGAGG + Intergenic
947445287 2:230158193-230158215 GGGTGAGAGCACCCCCTCTGAGG - Intergenic
948278673 2:236729507-236729529 GGAGCAGAGCAGGCCTTGAGTGG - Intergenic
1169265011 20:4162171-4162193 GGGCTGGGGCAGGCCCTGAGCGG + Intronic
1169268760 20:4183294-4183316 GGGTCACAGGAGGCGCTGAGTGG + Intronic
1169350045 20:4861208-4861230 GGGTGGGAGCAGGCGGTGATGGG + Intronic
1170775451 20:19371316-19371338 TGGAGAGGGCAGGCCCTGGGAGG + Intronic
1171343606 20:24449049-24449071 GGGTGAGTGCAGGAGCTGGGGGG - Intergenic
1172078059 20:32314903-32314925 AGGCAAGAGCAGGCTCTGAGTGG - Intronic
1172626477 20:36350331-36350353 GGGTGAGAGCAGTCCCTCCTGGG + Intronic
1172778983 20:37424622-37424644 GGGTGAGAAAGTGCCCTGAGGGG + Intergenic
1173145242 20:40519297-40519319 AGGTGAGAGCTGGGGCTGAGTGG - Intergenic
1173648177 20:44646545-44646567 TGGTAACAGCAGGCCCTCAGGGG - Intronic
1173943215 20:46929668-46929690 GTGTGAGAGCTGGCACAGAGCGG - Intronic
1174407529 20:50311872-50311894 GGATGGGAGCAGGCGCTGCGAGG - Intergenic
1174535746 20:51249890-51249912 GGGAAAGAGCAGGCCTTGAGGGG - Intergenic
1175223903 20:57433773-57433795 GGGTGAGGTCAGGCCCTGCAGGG + Intergenic
1175822744 20:61919280-61919302 TGGAAAGATCAGGCCCTGAGAGG + Intronic
1176025826 20:62985144-62985166 GGGAGAGAGAAGGCCCTGGAAGG + Intergenic
1176428382 21:6562322-6562344 AGGTGAGCCCAGGCACTGAGAGG + Intergenic
1178347035 21:31838593-31838615 GGATGAGAACAGGCCCTCAGAGG - Intergenic
1179478129 21:41660831-41660853 GGGTGAGAGAGAGCACTGAGTGG - Intergenic
1179703872 21:43170638-43170660 AGGTGAGCCCAGGCACTGAGAGG + Exonic
1179800520 21:43809654-43809676 GGGTGAGGGGAGGGGCTGAGAGG + Intergenic
1179906092 21:44424096-44424118 TGGTGGGAGCAGACCCTGAGAGG - Intronic
1179907996 21:44434116-44434138 TGGGGAGAGGAGGCCATGAGGGG + Intronic
1179996345 21:44976144-44976166 GGTTTAGAGCAGGAGCTGAGTGG + Intronic
1180051290 21:45332087-45332109 GGCTGAGAGCAGGCAGTGGGAGG + Intergenic
1180158559 21:45989260-45989282 GGGTGGGAGCAGACCTGGAGGGG + Intronic
1180169959 21:46052978-46053000 GGGTGACGGCAGGGACTGAGAGG - Intergenic
1180169988 21:46053109-46053131 GGGTGACGGCAGGGACTGAGAGG - Intergenic
1180170003 21:46053174-46053196 GGGTGACGGCAGGGACTGAGAGG - Intergenic
1180176610 21:46093570-46093592 GGCACAGAGCAGGCCCTGACTGG - Intergenic
1180568442 22:16695130-16695152 GAGTGAGAGGAGGCCCTAAACGG + Intergenic
1181050361 22:20235435-20235457 GGGTGAGAGAGGGCCCTGCCTGG - Intergenic
1181470215 22:23134173-23134195 AAGTGAGACCATGCCCTGAGAGG + Intronic
1181669560 22:24419827-24419849 ATGTGAAAGCAGGCCCTGAGGGG - Intronic
1181980560 22:26763014-26763036 GAGTAAGAGATGGCCCTGAGGGG + Intergenic
1182356732 22:29725578-29725600 GGGCAAGAGCAGGGCCTGTGGGG + Intronic
1182421849 22:30252449-30252471 TGTTGAAAGCAGGCCCAGAGGGG + Intergenic
1183353192 22:37344810-37344832 GGGTGAGAGCAGGCGTGGACGGG - Intergenic
1183358434 22:37371464-37371486 GGGTGGGAGCTGGCCCAGCGGGG - Exonic
1183638771 22:39080896-39080918 GGGTCAGGGCAAGCTCTGAGAGG - Intronic
1183660243 22:39215834-39215856 AGGTGGCAGGAGGCCCTGAGGGG + Intergenic
1183965055 22:41436581-41436603 GGGTGAGAGCTGGGACTGAGGGG + Exonic
1184391946 22:44207747-44207769 GGGTGTGAGAAGGCCTTGAGGGG + Exonic
1184537925 22:45100076-45100098 GGGTGAGATGAGAGCCTGAGTGG + Intergenic
1185072500 22:48664596-48664618 GGGTGAGATCGGGCCAGGAGGGG - Intronic
1185399976 22:50610659-50610681 GGTTGAGGACCGGCCCTGAGTGG + Intronic
950105543 3:10386144-10386166 TGGGGAGAGCAGGGCCTGAGGGG + Intronic
950510315 3:13421547-13421569 GGGTGAGGGTCGGCCCTGTGTGG + Intergenic
950674700 3:14547698-14547720 CAGTCAGAGCAGCCCCTGAGGGG - Intergenic
952852383 3:37739984-37740006 GGGTGACATCAGTCCCTCAGGGG - Intronic
953912374 3:46899512-46899534 GGGAGAGGGCAGCCCCTGGGGGG + Intronic
954213522 3:49111603-49111625 GGGTGTGGGCAGCCCCTGACCGG - Exonic
954465511 3:50652255-50652277 GGGGGAGGGCAGGCCGTGTGTGG + Intergenic
954684130 3:52361418-52361440 AGGTGAGGGCAGTGCCTGAGAGG + Intronic
957776376 3:84760614-84760636 GGGTGAGTGCAGCCCCACAGGGG + Intergenic
960035894 3:113102846-113102868 GCCTGAGAGCAGGTCGTGAGAGG - Intergenic
960288725 3:115858930-115858952 AGGTGAGAGCATGTCCTTAGGGG - Intronic
961091175 3:124114007-124114029 GGTAGAGAGTAGGCCCTGGGTGG + Intronic
961383539 3:126510917-126510939 GGGTGAGAACAGTCTCTGGGTGG - Intronic
961603493 3:128077347-128077369 TGGGGAGAGCAGGCCATAAGAGG - Intronic
962745957 3:138397285-138397307 AGGTGAGGACAGCCCCTGAGTGG + Intronic
964794645 3:160483721-160483743 GGGTGAGTGCAGGCCCTGGTAGG - Intronic
966862963 3:184240949-184240971 AGGTGAGAGCTGCACCTGAGAGG - Intronic
966883622 3:184362778-184362800 GGAAGAGAGCAGGGCCTGGGGGG + Intronic
967684905 3:192408286-192408308 GGGCGAGGGCAGGACCTGGGCGG + Exonic
968426429 4:526484-526506 GGGTGACAGCAGACCCTGTGAGG + Intronic
968461288 4:726362-726384 TGCTGGGAGCAGGCCCTGCGGGG + Intronic
968492462 4:897476-897498 GGGTGAGAGCAGGCTACGTGTGG + Intronic
968610311 4:1554068-1554090 GGGTGGGAGCTGGCTCTGAGGGG - Intergenic
969402144 4:6962697-6962719 GGGAGAGAGCAGGCAAGGAGTGG - Intronic
969626382 4:8307776-8307798 GAGTGAGAGCAGGGCCTGGAAGG - Intergenic
973613237 4:52657263-52657285 GGGTGTGGGGAGGACCTGAGAGG - Intronic
975627245 4:76362214-76362236 TGGTGAATGCAGGCTCTGAGCGG - Exonic
977262316 4:94812680-94812702 GGGTGAGGGCAGTCCCTGGGAGG + Intronic
977810217 4:101348104-101348126 GGGTGAGAGGCAGCCCTGAGAGG + Intronic
979629556 4:122884806-122884828 GGGTGAGAGGAGGTGCTGGGGGG + Intronic
980750124 4:137077194-137077216 AGATCAGAGCAGGCCCTGGGAGG + Intergenic
982181442 4:152751742-152751764 AGGGGAGAGGAGACCCTGAGTGG - Intronic
983164042 4:164452445-164452467 TGGTGAGAGCAGGCCCTTGGTGG - Intergenic
985653592 5:1118686-1118708 GGGTGAGACCAGGCTCTCTGAGG - Intergenic
985897357 5:2756549-2756571 GGGTGAGAGCCGCCCACGAGCGG - Intergenic
993378923 5:87183321-87183343 GGGGAAGAGCAGTCCCTGAAAGG + Intergenic
993628089 5:90250220-90250242 GGGTAAGAATAGGCCTTGAGAGG - Intergenic
994970541 5:106731165-106731187 GGGGGAGAGGAGGCCCTGCTGGG - Intergenic
997242220 5:132315734-132315756 GGCTGATAGCAAGCCCTGAGAGG - Intronic
997524164 5:134541793-134541815 GGGAAAGGGCAGCCCCTGAGAGG - Intronic
998455149 5:142266332-142266354 GGATGAGAGCAGGCACAGAGTGG - Intergenic
999247666 5:150163827-150163849 GGGGCAGAGCAGGCCCTGGTGGG - Intergenic
999324743 5:150636853-150636875 GAGTGAGACCAGACCCAGAGAGG + Intronic
1001127978 5:169037727-169037749 GGGACAGAGTAGGCCCTGACGGG + Intronic
1001191552 5:169637213-169637235 AGGAGAGGGCGGGCCCTGAGAGG + Intergenic
1001752852 5:174144881-174144903 GGGTCAGAGAGGGGCCTGAGTGG + Intronic
1002096191 5:176832537-176832559 GGATCAGAGAAGGCCCTGTGTGG + Intronic
1002549253 5:179974819-179974841 GGGAGAGAGCAGGCACGCAGCGG + Intronic
1005471440 6:26165735-26165757 GGATGAGACCAGGCCCTAGGAGG - Intronic
1005713581 6:28525735-28525757 GGGTGATAGCAAGCCCTCTGAGG - Intronic
1005905843 6:30260904-30260926 GGGAGAGAACAAGGCCTGAGAGG - Intergenic
1006812728 6:36830474-36830496 GGGTGAGAACAGGATCTGAAAGG - Intronic
1007325242 6:41054446-41054468 GGGGGAAAGGAAGCCCTGAGTGG + Intronic
1007848444 6:44780383-44780405 GGATGAGAACAGCACCTGAGAGG + Intergenic
1009176592 6:60467484-60467506 GGGGGAAAACAGGCCCAGAGAGG - Intergenic
1015054334 6:128882275-128882297 GGGTGTGAGCTGTCCCTCAGTGG - Intergenic
1016339642 6:143049342-143049364 AGCAGAGAGGAGGCCCTGAGAGG + Intergenic
1016805445 6:148207550-148207572 GTGTGAAAGAAGGCCCTGGGAGG + Intergenic
1017395322 6:153992021-153992043 TGGAGAGAACAGGCCTTGAGAGG - Intergenic
1017765885 6:157606706-157606728 GGGTGAGACTATGCCCTGGGAGG - Intronic
1017823343 6:158064385-158064407 GGGTGAGAGGAGGGCTTGGGTGG + Intronic
1017888446 6:158620201-158620223 TGGTGAGAGGAGGCCCGGGGGGG + Intronic
1017992688 6:159504932-159504954 TGGTGACAACAGGCCCTGTGGGG - Intergenic
1018367629 6:163137856-163137878 AGCTTGGAGCAGGCCCTGAGTGG + Intronic
1018628949 6:165805635-165805657 GGGAGAGAACGGGCCCTCAGTGG + Intronic
1018707127 6:166471153-166471175 GAGTGAGAGCTGGACATGAGGGG - Intronic
1018838495 6:167502543-167502565 GGGTCAGGGCAGGCCCAGGGTGG - Intergenic
1018944960 6:168341189-168341211 GAGGGAGACGAGGCCCTGAGTGG - Intergenic
1019019296 6:168904105-168904127 GGGTGGGGGCAGGCACAGAGAGG + Intergenic
1019021767 6:168924565-168924587 GGGTGAGAGCAGGAGCAGAGTGG - Intergenic
1019530062 7:1498917-1498939 GGGTGGGGGCAGGCTCTGTGTGG - Intronic
1019613093 7:1946811-1946833 GGGAGAGACAAGGCCCAGAGAGG + Intronic
1019619914 7:1986954-1986976 GGGTGAGAGCTGGCCTGGCGGGG - Intronic
1020025176 7:4894747-4894769 TGGTGGGAGCAGGCTCTGTGAGG + Intergenic
1021653809 7:22855086-22855108 GGGTGTGAGGAGGCCCTTCGTGG + Intergenic
1023258029 7:38331076-38331098 GGCTGAGAGCAGGCCCTCTAAGG + Intergenic
1023951198 7:44847764-44847786 GGGTGAGAGCTGGGCCTGGCCGG - Intronic
1026929907 7:74218043-74218065 GGGGGTGGGCAGGGCCTGAGGGG - Intronic
1029094026 7:98071019-98071041 GGTTGAGAGCAGGCCCGAATTGG - Intergenic
1029123029 7:98281294-98281316 GGGGGAGGGCGGGGCCTGAGAGG - Intronic
1029469978 7:100748214-100748236 GGGTGAGAGCAGGCCCTGAGAGG + Exonic
1032276566 7:130461540-130461562 GGGTGAGAACAGGCATTCAGAGG - Intergenic
1032403907 7:131642280-131642302 GTGTGAGAGCAGCCTCTGAAAGG + Intergenic
1033404342 7:141057405-141057427 TGCTGAGTGCAGGCCCTGGGAGG + Intergenic
1035609220 8:948991-949013 GGGTGGGAGCAGGACCTGTCGGG + Intergenic
1035736066 8:1888436-1888458 GGCTGTGAGGAGGCACTGAGTGG + Intronic
1036048269 8:5167618-5167640 TGGTGGGAGCAGGCTCTGTGTGG - Intergenic
1036075488 8:5494528-5494550 GGGGGAGAGCTGGAACTGAGAGG + Intergenic
1036577231 8:10039579-10039601 GGGTGAGTGGAGGCCCAGAGAGG - Intergenic
1036792672 8:11732369-11732391 GGCTGAGAGCAGGGTCTGTGGGG + Intronic
1037427428 8:18771166-18771188 GGGGCAGAGCAGGCCATGGGTGG + Intronic
1037489918 8:19388410-19388432 GGGTGAGAGCAGGGGCTCTGAGG + Intronic
1038177827 8:25197308-25197330 GAGTGAGCCCAGGCTCTGAGAGG - Intronic
1040533312 8:48283408-48283430 GGCTCATAGCAGCCCCTGAGTGG - Intergenic
1041310545 8:56511722-56511744 GGGTGAGAGCAGGCCAGAAATGG + Intergenic
1043402928 8:79901577-79901599 GGGTCAGAGAAGGCCATGAAGGG - Intergenic
1044133772 8:88559211-88559233 AGGTCTGAGCAGGCCCTGAAGGG + Intergenic
1046127123 8:109923559-109923581 GGATTAGAGAAGGCCCAGAGAGG - Intergenic
1046771004 8:118116451-118116473 GGGTGAGAGGATGCGGTGAGGGG - Intergenic
1047181619 8:122594092-122594114 TGGTGAGAGGAGGGCTTGAGAGG - Intergenic
1047223891 8:122940482-122940504 GGGTGACACGGGGCCCTGAGAGG - Intronic
1047411845 8:124630374-124630396 GGGTGGGAGCAGGAACAGAGGGG + Intronic
1047432806 8:124807171-124807193 GGGTGAGGGCAGCCCCTCACAGG - Intergenic
1048979116 8:139693719-139693741 GTGTGGGAACAGGGCCTGAGCGG + Intronic
1049318066 8:141980253-141980275 GAGTGAGAGCAGGCACTGGCTGG - Intergenic
1049470575 8:142773461-142773483 GGGTGGGAACGGGCCCGGAGCGG - Intronic
1052712178 9:32070121-32070143 TGGTGGGAGCAGGCTCTGTGCGG - Intergenic
1052898803 9:33772298-33772320 GGGTGAGAGCAGGATCTCACAGG + Intronic
1056665812 9:88579737-88579759 GGGTGAGAGAAGGGGGTGAGTGG + Intronic
1057264226 9:93603494-93603516 AGGTGAGGGCTGGCCCAGAGGGG - Intronic
1057542753 9:95990692-95990714 TGGTGGGAGCAGGCTCTGTGAGG + Intronic
1057910301 9:99015219-99015241 GGGTGGGAGGATGCCCTGAAAGG + Intronic
1058421951 9:104840970-104840992 GGATGAGAGCAGTTCCTGATAGG - Intronic
1060204330 9:121673839-121673861 TGGGGAAACCAGGCCCTGAGAGG - Intronic
1060798319 9:126527429-126527451 GGGAGATGGCAGGCCCTGTGGGG - Intergenic
1060962548 9:127691358-127691380 GGATGAGAGCAGGCACTGAGGGG - Exonic
1060966001 9:127712671-127712693 GGGTGGCAGCAGGCCCACAGTGG - Intronic
1062283579 9:135763024-135763046 CAGGCAGAGCAGGCCCTGAGTGG + Intronic
1062483510 9:136763229-136763251 GGGTGAGGGCGGGGCCTGTGAGG + Intronic
1186323562 X:8455120-8455142 GGGTGGGAGGATGCCGTGAGTGG - Intergenic
1186785826 X:12955227-12955249 GGCTGACAGGAGCCCCTGAGAGG + Intergenic
1192719599 X:73678388-73678410 TGGTGGCAGCAGGCCCTGGGTGG + Intronic
1197147438 X:123185201-123185223 GGGTGAGACTAGGAGCTGAGCGG + Intronic
1199432390 X:147776232-147776254 TGGTGGGAGCAGGCTCTGTGTGG + Intergenic
1200206344 X:154319394-154319416 GGCTGAGAGCATGCCCTTTGGGG + Intronic
1200771004 Y:7125464-7125486 GGGTTAGAGCTGGCCCTGCATGG - Intergenic
1201023354 Y:9680606-9680628 AGCTGAGAGCAGGCCCTAAGTGG + Intergenic