ID: 1029470433

View in Genome Browser
Species Human (GRCh38)
Location 7:100751111-100751133
Sequence CAGTGGAATCACAGAGTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 216}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029470433 Original CRISPR CAGTGGAATCACAGAGTTGC TGG Intronic
901352734 1:8612254-8612276 CAGTGTAATGAGAGAGCTGCTGG - Intronic
901947558 1:12715794-12715816 GAGTTGAATCACAGAGTGGGGGG + Intergenic
903792290 1:25902551-25902573 CATTGGAACCACTGACTTGCAGG + Intronic
905780372 1:40703609-40703631 CAGTGAAATAACGGAGTAGCAGG - Intronic
907015827 1:51011968-51011990 CAGTTGAAGTACAGAGCTGCGGG + Intergenic
909136277 1:71804439-71804461 ATGTGGAATCACAGTGTTGTGGG + Intronic
912562785 1:110562271-110562293 GTGTGGAGTCACAGAGTGGCTGG - Intergenic
914387257 1:147181861-147181883 CAGTGGAGTCAAAGAACTGCTGG + Intronic
918141335 1:181722519-181722541 CAGCTGATACACAGAGTTGCTGG - Intronic
918153238 1:181817311-181817333 CAGTGGAATCAAAGTGTGGCAGG + Intergenic
919773706 1:201179517-201179539 CTGTGGAGTCAGAGAATTGCTGG + Intergenic
920844541 1:209583007-209583029 CAGAGGGAGCACAGAGTTTCCGG + Intergenic
921162021 1:212479666-212479688 CACTGGAAGCACACAGATGCTGG + Intergenic
922377260 1:224980783-224980805 CAGTGCAATCACAGTGGTGGTGG + Intronic
922909753 1:229205665-229205687 CAGTGGAGACACAGAAATGCTGG + Intergenic
922987461 1:229877070-229877092 CAGTTGACTCCCAGAGTTGCTGG + Intergenic
923111840 1:230897179-230897201 CAGTGGAATAATACAGTTTCTGG - Intergenic
923728172 1:236524941-236524963 CAGTATAATGACAGAATTGCTGG + Intronic
924596573 1:245450284-245450306 CACTGGATTCACAGGGTTGAGGG + Intronic
924714775 1:246563121-246563143 CAGTGGAAACACACAGCGGCAGG - Intronic
1066519408 10:36198896-36198918 AAATGGAATCACAGAGTTGGGGG + Intergenic
1068398700 10:56499669-56499691 CAGTGTGAACACAGAGTTGCAGG + Intergenic
1070705223 10:78632552-78632574 CAGATGAATCAGAGAATTGCAGG - Intergenic
1070750116 10:78959117-78959139 CAGTGGAATCACTGAATAGAAGG + Intergenic
1071490923 10:86135744-86135766 AAGCGGAATCACAGAGAGGCTGG + Intronic
1075936810 10:126350013-126350035 ACGTGCAATCACAGAGTTGAAGG - Intronic
1077453096 11:2662633-2662655 CAGGGGAATCACACCGTGGCCGG - Intronic
1078638686 11:13075819-13075841 AAGTGGAAACACAGAGATGGGGG - Intergenic
1079137162 11:17782043-17782065 CAGGGTAATCATACAGTTGCAGG - Exonic
1080383730 11:31798559-31798581 CAAACGAAGCACAGAGTTGCCGG - Intronic
1081693971 11:45096742-45096764 CTGTGGAATCACAGAGGCACTGG + Intronic
1083744268 11:64726507-64726529 GAGGGGCAGCACAGAGTTGCTGG - Intergenic
1084279058 11:68074617-68074639 CAGTGAAAACACAGCATTGCAGG + Intronic
1084578213 11:70004522-70004544 CAGTGGGAACACAGGGTTCCAGG + Intergenic
1084684028 11:70683235-70683257 CGGTGGAATCCCAGAGCTTCAGG - Intronic
1085061712 11:73453343-73453365 CCATGGAATCACAGAGATTCTGG - Intronic
1087159712 11:94936679-94936701 AAGTGGATTAACAGAGCTGCAGG - Intergenic
1090764486 11:129864913-129864935 CAGTGGAATCAGAGAGGAGCCGG + Intronic
1093527668 12:20121524-20121546 CTGTAGAATCACAGAATTTCAGG - Intergenic
1093692481 12:22123691-22123713 TAGTGGAATCATAAAGTTTCAGG - Intronic
1098445545 12:70562387-70562409 AAGTGAAAACACAGAGTTCCAGG - Intronic
1098546370 12:71716334-71716356 CAGAGGAGTCAGAGAGATGCTGG + Intergenic
1099236748 12:80091921-80091943 CTTTGGCATCACAGACTTGCTGG - Intergenic
1100799331 12:98214914-98214936 AAGTAGAATCACTGAGTTGAAGG - Intergenic
1103168235 12:118789385-118789407 CAGTGGAACCATATACTTGCCGG + Intergenic
1104615820 12:130267678-130267700 CAGGGGCATCACAGAGTGCCTGG - Intergenic
1104626988 12:130365142-130365164 GAGTGGGAACACAGCGTTGCAGG + Intronic
1104824704 12:131700945-131700967 CAGAGGAGTCACAGAAATGCTGG + Intergenic
1107018586 13:35729126-35729148 CTGTGGAATCAGAAAGATGCAGG + Intergenic
1109118965 13:58429284-58429306 GAAAGAAATCACAGAGTTGCAGG - Intergenic
1109157453 13:58928386-58928408 GTGTGGAATCAAAGAGTTGTAGG + Intergenic
1109550673 13:63895046-63895068 CTGTGCAATCTCAGAGTTCCTGG - Intergenic
1114595797 14:23910677-23910699 CAGAGAAATCACACAGTTGCTGG + Intergenic
1115848934 14:37571998-37572020 CAGTGGAATGACAGAGCTAAGGG - Intergenic
1116913823 14:50501138-50501160 CAGTGCAATCAGAAAGTTTCTGG + Intronic
1117483007 14:56168087-56168109 CAGTGCAGTCACAGTGGTGCTGG - Intronic
1118552693 14:66973288-66973310 CATTGGAATCAGAGAGGTGTAGG - Intronic
1119081085 14:71694343-71694365 CAGTGAAAACAGAGAGTTGAAGG - Intronic
1119162837 14:72467586-72467608 CAGTGGGATCAAAGAGGTGAAGG - Intronic
1119758882 14:77137684-77137706 CAGTGGGAACACAGAGATACAGG - Intronic
1121963976 14:98287560-98287582 CAGTGGAATCCCAGAGGTGGGGG + Intergenic
1122613750 14:103002765-103002787 CAGTGGAATCACTGGGTCGTTGG + Intronic
1123473919 15:20574550-20574572 CGATGGAATAACAGATTTGCCGG + Intergenic
1123644089 15:22425803-22425825 CGATGGAATAACAGATTTGCCGG - Intergenic
1123665387 15:22605694-22605716 CGATGGAATAACAGATTTGCTGG - Intergenic
1123734219 15:23169561-23169583 CGATGGAATAACAGATTTGCCGG + Intergenic
1123752370 15:23366957-23366979 CGATGGAATAACAGATTTGCTGG + Intronic
1123973168 15:25528068-25528090 CAGTGGAAGGACAGTGATGCTGG + Intergenic
1124284722 15:28390872-28390894 CGATGGAATAACAGATTTGCCGG + Intronic
1124297975 15:28520742-28520764 CGATGGAATAACAGATTTGCCGG - Intronic
1124319221 15:28700111-28700133 CGATGGAATAACAGATTTGCTGG - Intergenic
1124483301 15:30095323-30095345 CGATGGAATAACAGATTTGCTGG + Intergenic
1124489752 15:30147390-30147412 CGATGGAATAACAGATTTGCTGG + Intergenic
1124520277 15:30401898-30401920 CGATGGAATAACAGATTTGCTGG - Intergenic
1124538379 15:30564321-30564343 CGATGGAATAACAGATTTGCTGG + Intergenic
1124544842 15:30616385-30616407 CGATGGAATAACAGATTTGCTGG + Intergenic
1124753777 15:32390937-32390959 CGATGGAATAACAGATTTGCTGG - Intergenic
1124760273 15:32443264-32443286 CGATGGAATAACAGATTTGCTGG - Intergenic
1124778362 15:32605799-32605821 CGATGGAATAACAGATTTGCTGG + Exonic
1124958850 15:34379561-34379583 CAATGGAATAACAGATTTGCCGG - Intronic
1124975479 15:34525780-34525802 CAATGGAATAACAGATTTGCCGG - Exonic
1125852229 15:42914923-42914945 TAGTGGAAGCAGAGATTTGCAGG - Intronic
1126544732 15:49861020-49861042 CAGGGGAATGAAAGAGTTGTGGG - Intronic
1126585273 15:50280012-50280034 AAGTGGAATCACAGAAAGGCAGG - Intronic
1126665868 15:51076224-51076246 CTGTGGAATGACAGTGTTGAGGG + Intronic
1127122364 15:55782741-55782763 CAGCAGAATCACAGAATTGAGGG + Intergenic
1130314399 15:82782639-82782661 CAGTGGAATCAAATGGATGCTGG + Intronic
1131865094 15:96700007-96700029 CTGTGGAATCTCACAGATGCAGG - Intergenic
1134750548 16:16621491-16621513 CAATGAAAGCACAGATTTGCCGG - Intergenic
1134887497 16:17806630-17806652 CATGAGAATCACAGAGATGCTGG - Intergenic
1134994906 16:18732095-18732117 CAATGAAAGCACAGATTTGCCGG + Intergenic
1135090942 16:19516596-19516618 CTGAGGAATCACAGAATTGTAGG - Intronic
1139481689 16:67234241-67234263 CTGGGGAGTCCCAGAGTTGCCGG + Exonic
1140351751 16:74268842-74268864 TTGTGTACTCACAGAGTTGCTGG + Intergenic
1140714077 16:77706285-77706307 CAGTGGAGTCGCAGAGTTCGAGG - Intergenic
1140932780 16:79643099-79643121 TACTGAACTCACAGAGTTGCTGG - Intergenic
1141297797 16:82785945-82785967 CAGGGGAACCACACAGTAGCAGG - Intronic
1141712757 16:85709617-85709639 CAGAGGTATCACAGAGAGGCAGG + Intronic
1142516763 17:436118-436140 CTGTGGAATCACAGAAATGCTGG + Intergenic
1143843139 17:9750684-9750706 CCGTGGAAGGACACAGTTGCTGG + Intergenic
1145441373 17:23111149-23111171 CATTCAACTCACAGAGTTGCAGG + Intergenic
1145445097 17:23162318-23162340 CATTCAACTCACAGAGTTGCAGG + Intergenic
1145608587 17:25539755-25539777 CATTCAACTCACAGAGTTGCAGG + Intergenic
1145659625 17:26281145-26281167 CATTCAAATCACAGAGTTGAAGG + Intergenic
1145675506 17:26512334-26512356 CATTCAAATCACAGAGTTGAAGG + Intergenic
1146613660 17:34333122-34333144 CAGTGGAAACACAGATCTTCAGG + Intergenic
1148729524 17:49824015-49824037 CAGGTGAATTAGAGAGTTGCTGG + Intronic
1151179163 17:72313247-72313269 CAGGTGGATCAGAGAGTTGCTGG - Intergenic
1153244903 18:3064153-3064175 CATTGGAATCACAAAGCTGGAGG - Intergenic
1157167614 18:45372544-45372566 CAGAGGAGACACAGAGTCGCTGG + Intronic
1160376979 18:78420966-78420988 CAGTGGTCTCACAGAGTTGGGGG - Intergenic
1160470533 18:79128739-79128761 CAGTGAAATGGCAGAGTTGGCGG + Intronic
1164084861 19:21891834-21891856 CAGTGACATCACCGAGGTGCTGG - Intergenic
1164097747 19:22026868-22026890 CAGTCACATCACAGAGGTGCTGG + Intergenic
1164876349 19:31693437-31693459 CAGGGAAATGACAGGGTTGCTGG - Intergenic
1168697106 19:58409736-58409758 CAGAGGAATATCAGAGCTGCTGG - Intronic
926554255 2:14338930-14338952 CTTTGGAATCAGAGTGTTGCTGG - Intergenic
926871271 2:17420405-17420427 TGGTGGAATCACTGAGTTGAAGG - Intergenic
930964080 2:57298407-57298429 CAGGGGAATCCAAGAGTTCCTGG - Intergenic
934151758 2:89154115-89154137 CTGGGGAATCACAGAGCAGCAGG + Intergenic
934215502 2:90027791-90027813 CTGGGGAATCACAGAGCAGCAGG - Intergenic
936372331 2:111912537-111912559 GAGTGGAAACACTGAGTTGTAGG + Intronic
943201751 2:184835773-184835795 CAATGGAGACACAGAGTTGAAGG + Intronic
943385451 2:187199036-187199058 CCATAGGATCACAGAGTTGCAGG - Intergenic
945566381 2:211405501-211405523 CAGTGAAATCACAGAGATTATGG - Intronic
945686247 2:212974173-212974195 CAGTGGAATCCCTGAAGTGCAGG - Intergenic
946066585 2:216992767-216992789 CAGCGGCATCACTGACTTGCAGG + Intergenic
948272242 2:236683517-236683539 CAGAGGAATCACAGGCTTGGGGG + Intergenic
948350999 2:237340785-237340807 CAGGGGAATGACACAGTTGCAGG - Exonic
948883802 2:240873224-240873246 CAGTGGAAACACTGGGGTGCTGG - Intronic
1169989272 20:11482591-11482613 TAGAGGAATCACAGAGTTTACGG + Intergenic
1170369123 20:15629139-15629161 CAGTAGAATTGCTGAGTTGCAGG + Intronic
1172631735 20:36383130-36383152 CTTTAGAAGCACAGAGTTGCTGG + Intronic
1172913320 20:38426248-38426270 CAGTGGAGTCGCAGAGTTCGAGG + Intergenic
1174874679 20:54214416-54214438 AAGTAGAATCACAGAGCTGAAGG + Exonic
1175369743 20:58480279-58480301 CAGTGCACTCAGAGAGTTGAAGG + Intronic
1177498684 21:21921778-21921800 CAGTGGAACCTCAGAGATCCAGG + Intergenic
1179668714 21:42930557-42930579 CACTTCAATCACAGAGTTGGAGG - Intergenic
1182060143 22:27391478-27391500 CAGAGGCATGACAGAGTTGAAGG + Intergenic
1183531450 22:38356067-38356089 CAGTGGAAACACACAGCGGCAGG + Intronic
1183815027 22:40292645-40292667 CAGAGGAATCACGGTGGTGCAGG - Intronic
1184506200 22:44904943-44904965 CAGCGGAATGACAGATGTGCCGG - Intronic
950007543 3:9701184-9701206 GAGTGGAAGCAGAGAGCTGCTGG + Intronic
950142289 3:10623683-10623705 CAGTGGTATCACAGAGAACCAGG - Intronic
951757843 3:26111739-26111761 CAGTGGTAGCAAAGAGTAGCAGG + Intergenic
952883381 3:37998866-37998888 CAGTGGACTCTCAGGGTCGCAGG + Intronic
954287178 3:49627194-49627216 GAGGGGCATCACAGAGTTCCAGG + Intronic
956286805 3:67619225-67619247 AAGTGGAATAACACAGTTTCTGG - Intronic
957683109 3:83464525-83464547 CATTGTAATCACAAAGATGCTGG + Intergenic
963286432 3:143438604-143438626 CAGTGGAATCAGTGTGTCGCAGG + Intronic
963608987 3:147441566-147441588 CAGTGGAAATCCAGAGATGCGGG + Intronic
964435547 3:156648168-156648190 GATTGGAATAGCAGAGTTGCAGG + Intergenic
964490410 3:157229823-157229845 CAGTGGAGACACAGACCTGCTGG + Intergenic
969243611 4:5918297-5918319 AAGTGGAGTCACAGAGTGGGAGG + Intronic
971254154 4:24998785-24998807 CACTTGAGTCACAGATTTGCAGG - Intergenic
972436219 4:39037713-39037735 CTGTATACTCACAGAGTTGCGGG + Intergenic
975539580 4:75492981-75493003 CAGTGGCATCTCTGAGTTGATGG + Intronic
980491764 4:133536767-133536789 CAGTGGAAGCACTAAGTTTCTGG + Intergenic
980652260 4:135733364-135733386 CAGCGCACTCACACAGTTGCTGG + Intergenic
980965235 4:139514616-139514638 CAGTGGCCTCACTGAGTTACTGG + Intronic
982015233 4:151146826-151146848 CAGTTAAAAAACAGAGTTGCTGG - Intronic
982825505 4:159999450-159999472 CTGTGGTATCACTGAGTTGAGGG + Intergenic
983378122 4:166956344-166956366 AAGTGCAAGCACAGTGTTGCTGG - Intronic
984043357 4:174765886-174765908 GAATAGAATCACAGAGATGCTGG + Intronic
984821498 4:183886476-183886498 CAATGGACTCACAGACATGCAGG - Intronic
987757114 5:22110520-22110542 CAGTGCAATCATAGGGTTGTGGG + Intronic
990327971 5:54696943-54696965 GAGGGGACTCACAGAGTTGGAGG - Intergenic
992635025 5:78718800-78718822 GTGTGGAACCACAGAGTTGGAGG + Intronic
993559140 5:89382036-89382058 CAGAGCTATAACAGAGTTGCTGG + Intergenic
994627878 5:102243425-102243447 CAGTGCAATCACAGTGGTGGTGG + Intronic
994925218 5:106108570-106108592 CAGTGGATACAGAGAGATGCAGG - Intergenic
996396478 5:123018642-123018664 CAGAGGACTCACAGATTTGGAGG - Intronic
997280962 5:132645197-132645219 CAGTGGGGTCAAAGAATTGCTGG - Exonic
998095472 5:139393682-139393704 CAGTGGAATCAGTGTGTTGCTGG - Exonic
1001958607 5:175865996-175866018 AAATAGAATAACAGAGTTGCAGG - Intronic
1004606684 6:17201380-17201402 CAGTGGGTTCACAGTCTTGCTGG - Intergenic
1006468248 6:34209303-34209325 GAGAGGAGTCACAGAGTTGGTGG + Intergenic
1009998588 6:70925076-70925098 CGGTGCAATCACAGAGGTGTGGG - Intronic
1013058936 6:106612846-106612868 TAGGGGAATGACAGAGTAGCAGG + Intronic
1013059246 6:106616000-106616022 CATTTGAACCACAGAGTTGGAGG - Intronic
1013811029 6:114044723-114044745 CAGTGGACTCAAAGAGAAGCAGG - Intergenic
1018265514 6:162020212-162020234 CACTGCAGTCACAGATTTGCAGG - Intronic
1019763961 7:2835710-2835732 AAGTAGAATCACAGAGCTGAAGG + Intronic
1021313881 7:19121848-19121870 CACTTGTATCAAAGAGTTGCTGG + Intergenic
1021592464 7:22278678-22278700 TATTGGTATCACAGAATTGCAGG + Intronic
1021915023 7:25422755-25422777 CAGGGGAATCACAGAACTGAGGG - Intergenic
1023967893 7:44972649-44972671 CAGTGGGAGCTCAGAGTTACTGG + Intronic
1025780940 7:64601281-64601303 CAGTCAAATCACTTAGTTGCTGG - Intergenic
1028859342 7:95630761-95630783 CAGTGGTTTCTCAGAGATGCAGG + Intergenic
1029028221 7:97440851-97440873 TAGTGTATTCACAGAGTTGTAGG + Intergenic
1029470433 7:100751111-100751133 CAGTGGAATCACAGAGTTGCTGG + Intronic
1029868272 7:103659820-103659842 CACCTAAATCACAGAGTTGCTGG - Intronic
1034282594 7:149864410-149864432 CAGTGGCATCCCAGAGCAGCAGG + Exonic
1035289866 7:157831001-157831023 CAGGTAAATGACAGAGTTGCAGG + Intronic
1035697002 8:1605633-1605655 CAGCGGGATCACAGATTTGCTGG - Intronic
1037196397 8:16196296-16196318 CAGTGGAACCACAAACTGGCAGG + Intronic
1039731126 8:40280026-40280048 CTGTGATATCACAGAGATGCTGG - Intergenic
1041040692 8:53843262-53843284 CAGTAGAATGACAGAGGCGCCGG + Exonic
1044429328 8:92090112-92090134 CAGTTCAATCACTGACTTGCTGG - Intronic
1044794774 8:95885674-95885696 CAGTGGAATCTCAGCCTTACAGG - Intergenic
1045113794 8:98959905-98959927 TAGTGGAATCACTGAGTTAAAGG - Intergenic
1046134987 8:110014113-110014135 TAGTGGTATCCCAGAGGTGCTGG + Intergenic
1048316851 8:133369283-133369305 CAGGGGAATCACTGAGTTCAGGG - Intergenic
1048416434 8:134232380-134232402 CAGTGGTATTTCTGAGTTGCTGG - Intergenic
1052063423 9:23987699-23987721 CAGTGGAATCATAGTGGTGTTGG + Intergenic
1053588858 9:39490076-39490098 CAGGGGAATTGCAGAGTTACAGG + Intergenic
1054577445 9:66875219-66875241 CAGGGGAATTGCAGAGTTACAGG - Intronic
1055216987 9:73876530-73876552 CAAAAGAAACACAGAGTTGCAGG + Intergenic
1057486856 9:95492178-95492200 CAGTGAAAACACAGCATTGCAGG + Intronic
1057586447 9:96332980-96333002 CACTTGAACCACAGAGTTGGAGG - Intronic
1058745522 9:107986787-107986809 CACAGTAATAACAGAGTTGCTGG - Intergenic
1060778249 9:126392455-126392477 CAGTGGCATCACAGGGTGTCGGG - Intronic
1061344425 9:130010909-130010931 CAGTAGAAACATAGACTTGCAGG + Intronic
1061355760 9:130103747-130103769 CAGTGGAGTCACTCAGGTGCTGG - Intronic
1061665340 9:132157572-132157594 CAGTCGAGTCGCAGAGCTGCTGG + Intergenic
1062504875 9:136868114-136868136 CAGTGGAAGCACATCCTTGCTGG - Intronic
1203694186 Un_GL000214v1:80481-80503 CTCTGGAATTACTGAGTTGCTGG - Intergenic
1203642087 Un_KI270751v1:23582-23604 CTCTGGAATTACTGAGTTGCTGG + Intergenic
1185845602 X:3434930-3434952 TGGTGGAATCACTGAGATGCGGG + Intergenic
1186729532 X:12394229-12394251 CAGTGGAATCCTAGAATTTCAGG + Intronic
1189613319 X:42760918-42760940 CAGTGGAATCAAAGCCTTCCAGG + Intergenic
1189842878 X:45100437-45100459 AAGTGAACTCACAAAGTTGCTGG - Intronic
1190194617 X:48306432-48306454 CAGTGGCAACAAAGTGTTGCTGG - Intergenic
1190384542 X:49872230-49872252 CATTGGAATCACATGGGTGCAGG + Intergenic
1190436616 X:50431945-50431967 CAAGGGACTCACAGAGTGGCAGG - Intronic
1190661114 X:52655034-52655056 CAGTGGCAACAAAGTGTTGCTGG - Intronic
1191943654 X:66505464-66505486 CAGTGCAATCCTAGAGGTGCTGG + Intergenic
1193216749 X:78873610-78873632 CAGAGGAATCATAGAATTTCAGG + Intergenic
1194263968 X:91733413-91733435 CAGCTGAACCACAGAGTTGGTGG + Intergenic
1196888897 X:120273217-120273239 GAGTAGAATCACAGAGCTGAAGG + Intronic
1197388312 X:125827453-125827475 CTGTGGAATCCTAGTGTTGCAGG - Intergenic