ID: 1029473168

View in Genome Browser
Species Human (GRCh38)
Location 7:100767230-100767252
Sequence CTCACTGCTCAGAGGCTGTA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 188}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029473163_1029473168 20 Left 1029473163 7:100767187-100767209 CCTACATCAAAGCCGTCCACGTG 0: 1
1: 0
2: 0
3: 1
4: 56
Right 1029473168 7:100767230-100767252 CTCACTGCTCAGAGGCTGTAAGG 0: 1
1: 0
2: 1
3: 18
4: 188
1029473165_1029473168 4 Left 1029473165 7:100767203-100767225 CCACGTGACAGTCTTTGACCTCA 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1029473168 7:100767230-100767252 CTCACTGCTCAGAGGCTGTAAGG 0: 1
1: 0
2: 1
3: 18
4: 188
1029473164_1029473168 8 Left 1029473164 7:100767199-100767221 CCGTCCACGTGACAGTCTTTGAC 0: 1
1: 0
2: 0
3: 8
4: 71
Right 1029473168 7:100767230-100767252 CTCACTGCTCAGAGGCTGTAAGG 0: 1
1: 0
2: 1
3: 18
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029473168 Original CRISPR CTCACTGCTCAGAGGCTGTA AGG Exonic
900548032 1:3239404-3239426 CTCACTGCTGGGAGACTGTGGGG - Intronic
901091249 1:6643054-6643076 CTCAGGGCAGAGAGGCTGTAAGG + Intronic
901534746 1:9874914-9874936 CTCCCAGCTCAAAGGCTTTACGG - Intronic
901536183 1:9884138-9884160 CTCACTGCCCAGCAGCTGTTGGG - Intronic
902984679 1:20148396-20148418 CTCAAACCTCAGAGGCTCTAGGG - Exonic
904378487 1:30096095-30096117 CTCACTGCACAGGGGATGGAAGG - Intergenic
904429011 1:30450016-30450038 CTCACTGCTCACAGTCTGGTGGG + Intergenic
904606716 1:31701943-31701965 CTCACTGCACACAGGCTCAAGGG + Intronic
907928633 1:58978536-58978558 CTCTGTGCTCAGAGGAGGTAAGG - Intergenic
911443277 1:97957182-97957204 CTCACTGCCCAGACGATGTAAGG - Intergenic
912161911 1:106995875-106995897 CGCACTGCTCAGCAGCTTTAGGG - Intergenic
913248494 1:116891669-116891691 CTCTCTTCTCAGCAGCTGTAGGG - Intergenic
913411963 1:118561995-118562017 CACCCTGTCCAGAGGCTGTAGGG - Intergenic
915491097 1:156250440-156250462 CTAGCTGCTCAGAGGCTGCAGGG - Exonic
915613710 1:157017235-157017257 CTCACTGCCCAGATTCTGAATGG + Intronic
918236886 1:182589700-182589722 CTCACAGCTCTGAGGCAGTGCGG + Intergenic
921932660 1:220767829-220767851 CTCACTGCTTACTGGCTGTGTGG + Intronic
923018104 1:230142390-230142412 CCCCATGCTCAGAGGCTGTATGG + Intronic
923761420 1:236848644-236848666 CTCACTGCACCCAGGCTTTAGGG - Intronic
1064185796 10:13161137-13161159 CTCACTGCACAGATGGTGAAGGG + Intergenic
1066229276 10:33416375-33416397 TTCACTGCTCATATTCTGTATGG - Intergenic
1066455170 10:35566145-35566167 CTCCCTGCTCAGGGGCTCCAAGG - Exonic
1067735283 10:48845698-48845720 CTCTCTCCCCAGAGGCTTTATGG + Intronic
1067787417 10:49260684-49260706 CTTGCTGCTCAGAGGCTGGTGGG + Intergenic
1069957545 10:72061237-72061259 CACACTGCTCAGGGGATGTTGGG + Exonic
1070789924 10:79182920-79182942 CTCACTGCTCAGATGGTGAAGGG - Intronic
1071351450 10:84750271-84750293 CTCTCAGCTGAGAGGCTGGAGGG - Intergenic
1073930563 10:108569462-108569484 CTAACTGATCTGAGACTGTACGG - Intergenic
1075394983 10:122120557-122120579 GACGCTGCTCTGAGGCTGTAGGG + Intronic
1075732047 10:124642209-124642231 CTCCCTGCTGAGAGGCTTTACGG + Intronic
1076193203 10:128497622-128497644 CCCACAGCTCTGAGGCTGGAAGG - Intergenic
1076677657 10:132155819-132155841 CTCAGTACTCAGAGGCCGTGAGG - Intronic
1077372176 11:2188115-2188137 CTCCCCGCCCAGAGGCTGTGTGG - Intergenic
1080749663 11:35140134-35140156 CTCTCTGCTCTGAGGCTGCCAGG - Intronic
1081888722 11:46522009-46522031 CTCACTGCCCAGAGGCACTGAGG - Intronic
1083308163 11:61771555-61771577 CTCAATGCCCAGATGCTGAATGG + Exonic
1083320145 11:61840799-61840821 CTCAGTGCTCTGAGGCTACAGGG + Intronic
1083613089 11:64013705-64013727 CTCGCTCCTCACAGGCTGTCTGG + Intronic
1084570823 11:69958849-69958871 CTCAGTGTTGAGAGGCTGTGGGG - Intergenic
1087700294 11:101429624-101429646 TTCACTTCTCTGAGGCTCTAGGG + Intergenic
1089969168 11:122678608-122678630 CCCACTGCCCAGAGGCTGAAAGG + Intronic
1090361432 11:126175413-126175435 ATCACTGCCCAGAGCCTGCATGG + Intergenic
1096890035 12:54760424-54760446 CTCACTTCTCTGTGGCTGTAGGG + Intergenic
1102423332 12:112821332-112821354 ATCACTGTTCAGAGGCTTTCTGG + Intronic
1102569066 12:113816278-113816300 CTCACTGCTCTGGGGAGGTAGGG + Intergenic
1103734443 12:123050349-123050371 CTCAATGCTCAGAAGCAGTCAGG + Intronic
1103827038 12:123747288-123747310 CACACAGCTCAGAGACTGGAAGG - Intronic
1104993510 12:132640250-132640272 CTCCCTGCCCAGGAGCTGTAAGG + Intronic
1106411729 13:29515498-29515520 CTCAGGGCTGCGAGGCTGTAGGG + Intronic
1107553316 13:41496570-41496592 CTCTATGCCCAGAGGCTGCAGGG + Intergenic
1108999347 13:56778277-56778299 CTCCCTCCCCAGAAGCTGTATGG + Intergenic
1110898092 13:80782618-80782640 CTCACTGTTCAGAGCCTTGATGG - Intergenic
1113036564 13:106056409-106056431 CTCCCTCCCCAGAGGCTGTCTGG + Intergenic
1113382007 13:109812959-109812981 CAGTCTGCTCTGAGGCTGTAGGG - Intergenic
1114380936 14:22202814-22202836 CTCACAGCTCTCAAGCTGTAAGG + Intergenic
1115649317 14:35391562-35391584 CTGCCTCCTCAGAGGCTGCAGGG - Intergenic
1116320401 14:43454715-43454737 CAAACTGATCAGAGGCTGCAGGG + Intergenic
1117659855 14:57992344-57992366 CTCACTGTTCAGAGGTAATAAGG - Intergenic
1120918389 14:89730646-89730668 ATCACTGCACAGAGCCTATAAGG + Intergenic
1123024597 14:105418851-105418873 CTGCCTGCTCAGATGCTGGAGGG - Intronic
1126358158 15:47818023-47818045 CTCCCTGCTCAGAGCCTCTCTGG + Intergenic
1127858934 15:62976915-62976937 CTCTCTGCTCAGATGCTGAGAGG + Intergenic
1128248682 15:66150169-66150191 CTCCCTGCTCGGGGGCTGGAGGG - Intronic
1129457222 15:75682434-75682456 CTGACTGCTGAGTGGCTGGACGG + Exonic
1130062158 15:80577873-80577895 CACACTGCTCTGAGGCTCTGGGG + Intronic
1131083455 15:89555919-89555941 CTCAGGGCTCAGAGGCTGCAGGG + Intergenic
1133111372 16:3550034-3550056 CACCCTGCTCTGAGGCTGTCTGG - Intronic
1133264832 16:4576682-4576704 CACACTTCTCAAAGGCTGCAGGG - Intronic
1133398364 16:5466249-5466271 CCCACTGCACAGACACTGTATGG - Intergenic
1133451439 16:5907063-5907085 ATGACTCCTCAGAGGCTTTAGGG + Intergenic
1134047925 16:11114868-11114890 CTCGCTTTTCAGAGGCTGTGGGG - Intronic
1134894765 16:17875201-17875223 CACACTAATCAGAGGCTCTATGG + Intergenic
1135007974 16:18844738-18844760 CTCACTGCTCAAATTCAGTAAGG + Intronic
1137554068 16:49459338-49459360 CTCAAGGTTCAGAGGCCGTATGG - Intergenic
1137948110 16:52755408-52755430 CTCACTACTCAGTAGCTGTAGGG - Intergenic
1138639152 16:58369036-58369058 CTTAGTTCTCAGAGGCTGTGTGG - Intronic
1141263044 16:82471188-82471210 CTCACTGCTCAGAGGTTAAGAGG - Intergenic
1141533576 16:84663305-84663327 CGAACAGCTCAGAGGCTGAATGG - Intronic
1141945301 16:87305340-87305362 CTCAGAGCTCAGAGGCTGGAGGG + Intronic
1144353913 17:14426323-14426345 ATACCTGCTCAGAGGCTGGAAGG - Intergenic
1144459634 17:15447984-15448006 CACACTGCTCAGGAGCTGTCAGG - Intronic
1146309034 17:31752872-31752894 CTCCCTGCTCAGAGGAAGTTAGG - Intergenic
1147866118 17:43553614-43553636 CTGACTGCCCCCAGGCTGTAGGG + Intronic
1148824575 17:50382987-50383009 CTCACTGCTGAGAGTCGGTCTGG + Exonic
1149668136 17:58380821-58380843 TCTCCTGCTCAGAGGCTGTAGGG + Intronic
1150101450 17:62427250-62427272 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1151712100 17:75812848-75812870 CTCACAGCTCACAGGGTGAAAGG - Intronic
1152580470 17:81163520-81163542 CACACAGCACAGAGGCTGGAAGG + Intronic
1152802429 17:82337150-82337172 CCCACTGCTCACTGGCTGGAAGG + Intergenic
1152832003 17:82503261-82503283 CTCAGAGCTCAGAGTCTGTTGGG + Intergenic
1154234409 18:12590613-12590635 CTCAGGGCTCAGGGGTTGTAAGG - Intronic
1159041967 18:63332882-63332904 TTCAGTGCTCTGAGGGTGTAGGG - Intronic
1160037454 18:75315046-75315068 CTCTCTCTACAGAGGCTGTAGGG - Intergenic
1160841879 19:1149990-1150012 CTGACTTCTCAGAAGCTGCACGG + Intronic
1163411793 19:17159467-17159489 CTCACCTCGCTGAGGCTGTAGGG - Exonic
1166271924 19:41719752-41719774 CTGAGGGCTCAGAGACTGTAAGG - Intronic
925033958 2:672239-672261 CTCACTTGACAGAGGCTGTGTGG + Intronic
925191178 2:1885018-1885040 CTAACTGGTCAGAGACTGCAGGG - Intronic
925284398 2:2706325-2706347 ATCAAAGCTCAGAGGCTGTGTGG - Intergenic
925417471 2:3680684-3680706 CTCAGGGCTCACATGCTGTAGGG + Intronic
925758921 2:7165453-7165475 CTCACTTCTATGAGGCTGAAAGG - Intergenic
926427506 2:12752752-12752774 GTCCCTGATCAGATGCTGTAAGG + Intergenic
926506966 2:13728696-13728718 GTCACTGCTCAGATGTTATATGG + Intergenic
930208417 2:48611149-48611171 CTCACTGCTATGTGGCTGTTGGG + Intronic
934133313 2:88970412-88970434 CACATGGCTCAGAGGCTGCATGG + Intergenic
935329232 2:101964354-101964376 TTCCCTGCTTAGAGGCTGGAAGG - Intergenic
935740543 2:106143724-106143746 CTCCCTGCTGAGAGCCTGTAAGG - Intronic
936341044 2:111633086-111633108 GACACTGCTAAGAGGCTGTTTGG - Intergenic
936343141 2:111655166-111655188 TTCACTGATCACAGGCTGCAGGG + Intergenic
936508801 2:113129362-113129384 CTCACTGCTCACCAGCTGTGAGG + Intronic
939651489 2:144767972-144767994 CTCTCTGGTGAGTGGCTGTAGGG + Intergenic
940382207 2:153028255-153028277 CTCACTGGTCAGATGCTGTAAGG + Intergenic
940853209 2:158707558-158707580 CCCACTGCTCAGCTGCTGTGTGG + Intergenic
944676459 2:202036695-202036717 CTCCCGGCTCCGAGGCTGAACGG + Exonic
947354495 2:229277763-229277785 CTCACTGCTGGGAGGTGGTAGGG + Intergenic
948049641 2:234969775-234969797 CCCACTGGGCAGAGGCAGTAAGG - Intronic
948589305 2:239039087-239039109 CCCAGTGCTCTGAGTCTGTAAGG - Intergenic
948941551 2:241199514-241199536 CTCCCTGCTCAGAGGCCTCAGGG + Intronic
1170615718 20:17948574-17948596 TTCACGGCTCAAAGGCTGCAGGG + Intronic
1172053813 20:32140263-32140285 CTAACTGCTCAGTGCCTGTTAGG + Intronic
1172948793 20:38708613-38708635 CCCAGGGCTCAGAGGCTGTGGGG - Intergenic
1173569794 20:44068722-44068744 GGCACTGCTCAGAGCCTGAAGGG + Exonic
1175727260 20:61327592-61327614 CTCAGGGCTGGGAGGCTGTAGGG + Intronic
1178959836 21:37055478-37055500 ATCACTGCTGAGTGGCAGTATGG - Intergenic
1179908772 21:44437270-44437292 CTCCCTGCCCAGGGGCTGCAGGG - Intronic
1180171195 21:46059291-46059313 CCCATTGCTCAGTGTCTGTATGG + Intergenic
1181028542 22:20139072-20139094 CTCAGAGCTCAGAGGCAGTGGGG - Intronic
1182547390 22:31084146-31084168 CTCCATGCACAGAGGCCGTAGGG + Intronic
1184099230 22:42333212-42333234 CTCGCTGTGCAGAGGCTTTAGGG + Intronic
1184387205 22:44182929-44182951 CTCACTCCTCAGAGCTTGTCAGG - Intronic
949599397 3:5581646-5581668 CTCAATGCTAGGAGGCTGTGGGG + Intergenic
952408578 3:33026742-33026764 CTCTCTGCTGAGAGGATGGAGGG + Intronic
953339567 3:42122170-42122192 CTCACTGGTCATATGCTTTAAGG + Intronic
954988209 3:54814344-54814366 CACACTGGCCAGAGGCTGGAAGG + Intronic
956005400 3:64773332-64773354 CTCACAGCCCACAGGCTGAAGGG + Intergenic
958078927 3:88720072-88720094 TTCCCTGCTCTGAGACTGTAGGG + Intergenic
961100169 3:124191782-124191804 GGCACTGGGCAGAGGCTGTAAGG + Intronic
961380412 3:126492935-126492957 CTCACAGACAAGAGGCTGTATGG - Intronic
963953152 3:151224721-151224743 CACACTTCTCAGAAGCTGTCAGG + Intronic
963953259 3:151225795-151225817 CACACTTCTCAGAAGCTGTCAGG + Intronic
967314013 3:188133662-188133684 CAAACTGCTCAGAGGATTTAAGG - Intergenic
967511823 3:190321979-190322001 CTCACTGCTCAGATTCAGCAAGG + Exonic
968170541 3:196506183-196506205 CTGACTTCTCAGAGGCTGCTAGG + Intergenic
973276176 4:48312181-48312203 CTCACTGCAGAGGGGCTGAAAGG + Intergenic
975994936 4:80302946-80302968 CTCACTGCCCAGGGCCTGCAGGG - Intronic
983529507 4:168794707-168794729 CTTACTGCTCACAGCCTGTGGGG + Intronic
985564035 5:606376-606398 GTCACGGCTCAGTGGCTGAAGGG + Intergenic
988537419 5:32081315-32081337 CTGGCTGCTCAGTGGGTGTAAGG - Intronic
991252597 5:64580265-64580287 CTCACTTCTTATAGGCAGTAAGG - Intronic
993738878 5:91511612-91511634 CTCACTGTTCAGTGGATGAATGG + Intergenic
997212927 5:132088043-132088065 CACTCTGCTCTGAGGCTGTAGGG + Intergenic
999639648 5:153659481-153659503 CTCCCTGCTCTGAGACTGTGGGG + Intronic
1000212195 5:159118033-159118055 GGCTCTGCTCAGGGGCTGTATGG + Intergenic
1001634977 5:173203286-173203308 CTCACTCCTCAATGGCTATAGGG - Intergenic
1002003951 5:176216701-176216723 CTCATTGTTCTGAGGCTGTCTGG - Intergenic
1002182843 5:177440463-177440485 CTCACTGCTCAATGACTGTGAGG - Intronic
1002222422 5:177693939-177693961 CTCATTGTTCTGAGGCTGTCTGG + Intergenic
1003616757 6:7661227-7661249 CTGAGGGCTCAGAGGCTTTAGGG + Intergenic
1007176840 6:39902955-39902977 CCCTCTGCTGAGGGGCTGTAGGG - Exonic
1008958303 6:57239973-57239995 CATACAGCTCAGAGACTGTAGGG + Intergenic
1009418911 6:63443561-63443583 CTCACTGCTGAGAGTCGGTCTGG - Intergenic
1010687975 6:78874338-78874360 GTTACTGCTCAGAGGTAGTAGGG + Intronic
1012831746 6:104212087-104212109 CTCAGTGCTCAGGGGTTTTATGG - Intergenic
1017454526 6:154589101-154589123 CTCTCTCTTCAGTGGCTGTAGGG + Intergenic
1019102113 6:169640018-169640040 CTCAGGGGTCAGAGGCTGCAGGG - Intronic
1020720616 7:11740149-11740171 CTCACTCCTCAGTGGCTTCAAGG + Intronic
1021690088 7:23223016-23223038 CCCACTGGTAAGAGGCTGTGGGG - Intergenic
1021988581 7:26120706-26120728 CTCACTGCCCAGAGGCTTCAGGG - Intergenic
1023978395 7:45051033-45051055 CCCACTGCTCTGAGGGTGGATGG - Intronic
1026146439 7:67750617-67750639 CTGACCACTCAGAAGCTGTAGGG - Intergenic
1029123751 7:98284087-98284109 CTCGGCCCTCAGAGGCTGTAGGG + Intronic
1029473168 7:100767230-100767252 CTCACTGCTCAGAGGCTGTAAGG + Exonic
1029541141 7:101182792-101182814 CTGAGTGCTCAGAGGTTGCAGGG + Intergenic
1029615828 7:101656646-101656668 CTCGAGGCTCAGAGGCTGTGAGG + Intergenic
1029677553 7:102080762-102080784 CTCTCTGCACCGAGGCTGTTGGG + Intronic
1032030600 7:128480109-128480131 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1034764018 7:153700666-153700688 CTCACACCTCACAGGCTGCAAGG + Intergenic
1035708574 8:1695728-1695750 GAGGCTGCTCAGAGGCTGTAGGG - Intronic
1038245308 8:25849480-25849502 CTCATGGATCAAAGGCTGTAAGG - Intronic
1041768789 8:61450088-61450110 CTCTCATCTCAGAGGCTCTATGG + Intronic
1043242439 8:77952287-77952309 CTCATGCCACAGAGGCTGTATGG + Intergenic
1043758258 8:84031527-84031549 CTCAGTGCTCAAAGTCTGGAGGG - Intergenic
1047846851 8:128815477-128815499 CACACTGCTCAGTGGGTGAACGG + Intergenic
1047922926 8:129654008-129654030 CTCAGTGCTCAGAGGGTCTTGGG - Intergenic
1048072987 8:131040792-131040814 CCCACTGCTCCGCGGCTGCAGGG + Exonic
1053552347 9:39097330-39097352 CTCACTGCTCTGAAGCTGTGGGG + Intronic
1055340808 9:75280795-75280817 GTCACTGCTCAGATGCTGGTGGG - Intergenic
1055714699 9:79104153-79104175 GTCATTGGTCACAGGCTGTAGGG + Intergenic
1056070301 9:82979300-82979322 CTAACTCCTCAGAGGATGTGCGG + Intergenic
1057845773 9:98521350-98521372 CTCACCCATCAGAGGCTGTGAGG - Intronic
1059470102 9:114498516-114498538 AGCACTGCTCAGAGAATGTATGG + Intronic
1060101173 9:120842498-120842520 CTCACTGCTCAGAGGCAGCGAGG + Intronic
1060665434 9:125429728-125429750 GTCCCTGCCCAGAGGCTGTGAGG - Intergenic
1061653001 9:132066176-132066198 GTGACTGCCCAGAGGCTGTGGGG + Intronic
1061879589 9:133562147-133562169 CTCACTGGCCAGAGACTGCAAGG - Intronic
1061968659 9:134031294-134031316 CTCACTGCCCTGTGGCTGGAGGG + Exonic
1062581952 9:137232686-137232708 CTCACTGCCCAGCAGCTGGAAGG - Exonic
1186159037 X:6757215-6757237 CTAACTGCTCAGTGTTTGTAGGG - Intergenic
1187160093 X:16756651-16756673 CTCACTTCTTAGAGGCAGTACGG + Exonic
1188807456 X:34609171-34609193 CTCACTGCTCAGAGCCATTCAGG - Intergenic
1189177629 X:38973759-38973781 CTCCCTGCACAGAAGCTTTAAGG - Intergenic
1189391920 X:40583565-40583587 CTCACTGCCCAGAGACTCTGAGG - Intronic
1193195908 X:78631507-78631529 CCCAATTCTCAGAGGATGTATGG + Intergenic
1196062980 X:111431194-111431216 CTCTCTGCTCAGAAACTGTCAGG + Intergenic
1198315845 X:135465204-135465226 CCTTCTCCTCAGAGGCTGTAAGG + Intergenic
1200157434 X:153984688-153984710 CTTACTTCACAGAGGCTGGAGGG + Intergenic
1201728855 Y:17184648-17184670 CTCAAGGCTCAGAAACTGTAGGG + Intergenic
1201924098 Y:19266115-19266137 CTCCATCCTCAGAGGATGTATGG - Intergenic