ID: 1029474453

View in Genome Browser
Species Human (GRCh38)
Location 7:100774851-100774873
Sequence GGAGGGGCATGATTCTTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 175}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029474453_1029474467 21 Left 1029474453 7:100774851-100774873 CCTCCAAAGAATCATGCCCCTCC 0: 1
1: 0
2: 0
3: 24
4: 175
Right 1029474467 7:100774895-100774917 GCCTCCTAGCCCTGGCCCTGGGG 0: 1
1: 0
2: 4
3: 49
4: 415
1029474453_1029474463 13 Left 1029474453 7:100774851-100774873 CCTCCAAAGAATCATGCCCCTCC 0: 1
1: 0
2: 0
3: 24
4: 175
Right 1029474463 7:100774887-100774909 CTCACCACGCCTCCTAGCCCTGG 0: 1
1: 0
2: 1
3: 10
4: 180
1029474453_1029474466 20 Left 1029474453 7:100774851-100774873 CCTCCAAAGAATCATGCCCCTCC 0: 1
1: 0
2: 0
3: 24
4: 175
Right 1029474466 7:100774894-100774916 CGCCTCCTAGCCCTGGCCCTGGG No data
1029474453_1029474465 19 Left 1029474453 7:100774851-100774873 CCTCCAAAGAATCATGCCCCTCC 0: 1
1: 0
2: 0
3: 24
4: 175
Right 1029474465 7:100774893-100774915 ACGCCTCCTAGCCCTGGCCCTGG 0: 1
1: 0
2: 3
3: 23
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029474453 Original CRISPR GGAGGGGCATGATTCTTTGG AGG (reversed) Intronic
900687150 1:3955785-3955807 GGAGGGGAATATTTCTTTAGGGG + Intergenic
900996549 1:6126276-6126298 GGTGGGGCAGGATTCTGTTGGGG - Intronic
901189912 1:7403608-7403630 GGAGCAGCATGGTGCTTTGGTGG + Intronic
904314358 1:29650673-29650695 GGAGGGGAATGACTGTTTGGAGG + Intergenic
904455139 1:30642973-30642995 GGAGGGGCATGGTTGCTGGGGGG - Intergenic
909859533 1:80587584-80587606 GGATGGACATGAATCTTTGGGGG - Intergenic
912403029 1:109411901-109411923 GGAGTAGCATTATTATTTGGAGG - Exonic
915281216 1:154823349-154823371 GGAAGGGAATGTTTCTTTTGTGG - Intronic
916535436 1:165698901-165698923 GGAGTGCCAAGAGTCTTTGGTGG + Intergenic
917615694 1:176741615-176741637 ATAGGGGCATGAATCTCTGGGGG + Intronic
918130090 1:181619781-181619803 GGAGGGTCATGATTATTTGAAGG + Intronic
921823929 1:219650268-219650290 GGAGGAGCATGATCCTACGGAGG + Intergenic
922716131 1:227873257-227873279 GGGGAGTTATGATTCTTTGGAGG - Intergenic
923616055 1:235538404-235538426 GGAGTGGTATGGTTGTTTGGGGG + Intergenic
1063337383 10:5229126-5229148 AGAGGGGCGTGATTCTGAGGGGG + Intergenic
1063352975 10:5373657-5373679 GGAGGGGCGTGGTGCTCTGGAGG - Intronic
1063539731 10:6919946-6919968 GCAGGGGTGTGATTTTTTGGGGG + Intergenic
1065193832 10:23241466-23241488 GGATAGGCATGATTATTTGGGGG + Intergenic
1065422266 10:25558454-25558476 GGAGGGGCAGGTTTCTTTAAAGG + Intronic
1066065719 10:31759764-31759786 GGAGGGGCTTCCTTCCTTGGGGG - Intergenic
1068228082 10:54132951-54132973 GGAGGGCTTTGATTATTTGGTGG + Exonic
1068258561 10:54545995-54546017 GGAAGTGTATGGTTCTTTGGGGG + Intronic
1073009558 10:100348670-100348692 AGAGGGGTTTGATTCTTTTGTGG - Intronic
1074862104 10:117518267-117518289 GGAGGGGGATCACTCTTTAGAGG + Intergenic
1074979841 10:118610642-118610664 GGAGAGGCATCAGGCTTTGGAGG - Intergenic
1075016238 10:118911914-118911936 GGAGGGGCAGGCTTTATTGGGGG - Intergenic
1075246357 10:120825504-120825526 GGAGCTGGATAATTCTTTGGTGG + Intergenic
1076921270 10:133455902-133455924 GTAGGGGAATGATGCTTGGGAGG + Intergenic
1077351870 11:2096843-2096865 TGAGGGGCATGCTGCCTTGGGGG - Intergenic
1078919718 11:15818311-15818333 GGAGGGGCGTTCTACTTTGGTGG + Intergenic
1079433924 11:20425762-20425784 GGATGGGCACTAATCTTTGGGGG + Intronic
1080569501 11:33543091-33543113 GGGGAGGCATGATTCTCTGTGGG - Exonic
1081526893 11:43933740-43933762 GGCTGGGCTTGATTCTTGGGAGG + Intronic
1081853843 11:46291708-46291730 GGTGGGTCAAGAGTCTTTGGAGG + Intronic
1082856828 11:57815920-57815942 CGAGGGGCAGGAATCTCTGGAGG + Exonic
1088467310 11:110154787-110154809 TTAAGGGCATGATTCTTTGTTGG - Intronic
1089537988 11:119172526-119172548 GGAGGGGCTTGGTCCTTTGGGGG + Intronic
1089573828 11:119427380-119427402 GGGGGGGCATGACTCACTGGAGG - Intergenic
1089710279 11:120309623-120309645 GGAGGGACATGATGCTTGGAGGG + Intronic
1091053577 11:132397249-132397271 GGAGGGAAATGATTTTTTGAGGG - Intergenic
1091397614 12:163373-163395 GGAGGGGCCCGGTTCTGTGGAGG - Intronic
1091522887 12:1265694-1265716 GGTGGGGCATGATACTTTAAGGG - Intronic
1091903119 12:4161551-4161573 GGAGGGGCAACATTCTGTAGGGG - Intergenic
1092583519 12:9874055-9874077 GGAGGGTCATGATCCTTTCTTGG - Intergenic
1092924324 12:13259784-13259806 GGAGGGGGGTTGTTCTTTGGTGG + Intergenic
1094249234 12:28340630-28340652 GGTGTGGCTTGCTTCTTTGGTGG + Intronic
1096964407 12:55613933-55613955 GGAGGGACATGAATCATTGGTGG - Intergenic
1097983206 12:65755351-65755373 GGTGTGAGATGATTCTTTGGAGG - Intergenic
1100152798 12:91761326-91761348 GGATGGACATGAGTATTTGGGGG + Intergenic
1102053493 12:109879906-109879928 GAAGGGGCAGGAGGCTTTGGGGG + Intronic
1103553056 12:121750340-121750362 TGAGGGGCATGATCCTTAGCAGG - Intronic
1112006031 13:95254513-95254535 GGAGGAGCAGGATTTTTTTGTGG - Intronic
1114052793 14:18935755-18935777 GGAGATGAAGGATTCTTTGGAGG - Intergenic
1114109765 14:19466171-19466193 GGAGATGAAGGATTCTTTGGAGG + Intergenic
1115138623 14:30142183-30142205 GGCGGGACATGAGTCTTTGGGGG - Intronic
1118707743 14:68495511-68495533 GGAGGGGCAGGATGCTCTAGCGG + Intronic
1118869275 14:69727703-69727725 TGAGCGGAAAGATTCTTTGGAGG - Intronic
1118893493 14:69927716-69927738 GGAGGGGCAGGATTGCTTGGGGG + Intronic
1122081267 14:99269465-99269487 GGAGAGGGATGCCTCTTTGGAGG - Intronic
1122799022 14:104220701-104220723 GGATGGGCTTGCTCCTTTGGGGG + Intergenic
1124098214 15:26669193-26669215 GAAAGGGCAGGATTCTGTGGGGG - Intronic
1125380397 15:39080747-39080769 GGAGTGGCAGCATTCTTTGGAGG - Intergenic
1127829918 15:62741528-62741550 GGGTGGTCATGATTCTGTGGTGG + Intronic
1130019220 15:80213286-80213308 GCATAGGCATGAATCTTTGGGGG + Intergenic
1133001275 16:2852884-2852906 GGCGGGGCCTGATGCCTTGGAGG + Exonic
1134884279 16:17775988-17776010 GGAGGTGCAGGATTCTATGGAGG - Intergenic
1136518202 16:30780482-30780504 TGAAGGGCTTTATTCTTTGGAGG + Exonic
1136993590 16:35172679-35172701 GGAGGGGCAGGAAACTTTGAAGG + Intergenic
1137838894 16:51621849-51621871 GGAGGGATATGATTCATTGGGGG + Intergenic
1137838902 16:51621874-51621896 GGAGGGATGTGATTCATTGGGGG + Intergenic
1137838924 16:51621948-51621970 GGAGGGATGTGATTCCTTGGGGG + Intergenic
1137838932 16:51621973-51621995 GGAGAGGTGTGATTCTCTGGGGG + Intergenic
1137838958 16:51622072-51622094 GGAGGGATGTGATTCATTGGAGG + Intergenic
1137947377 16:52747008-52747030 GGATGAGGATGAGTCTTTGGAGG - Intergenic
1138514248 16:57527171-57527193 GGAGGGGCAGTCTTATTTGGAGG + Intronic
1138910236 16:61387831-61387853 GCATGGGCATTATTCTTTGAGGG + Intergenic
1139814988 16:69662336-69662358 GGAAGGATATGATTCTTTTGGGG + Intronic
1140912641 16:79467907-79467929 GTAAGTGCATGATGCTTTGGGGG + Intergenic
1141327749 16:83078339-83078361 GGACGGGGATGATGGTTTGGGGG + Intronic
1141527033 16:84618190-84618212 GGAGCGTCTTGATTCTCTGGCGG + Intergenic
1147794670 17:43033928-43033950 GGAGGGACCTCAATCTTTGGAGG - Intergenic
1150077793 17:62207977-62207999 GGTGGGACATGATTCTTGGTTGG - Intergenic
1150434461 17:65143250-65143272 GGAGCTGGATCATTCTTTGGGGG - Intronic
1150637844 17:66928660-66928682 AGAGAGGCAGGATTCATTGGAGG - Intergenic
1152154839 17:78626121-78626143 GTACGGACATGATTTTTTGGGGG - Intergenic
1158887074 18:61838706-61838728 GGAGGTGCATCAATCTTTGTTGG - Intronic
1160051752 18:75440221-75440243 GGAGGGGCGTGCCTCTTGGGTGG - Intergenic
1160085488 18:75773362-75773384 GGAGGATCATGATTCTAGGGAGG - Intergenic
1160948467 19:1654406-1654428 GGAGGGGCTTGTGGCTTTGGTGG - Intergenic
1160963608 19:1735840-1735862 GGAGGGGCATAATTCTTCTCAGG - Intergenic
1161316350 19:3619337-3619359 GGAGGGGCCTGACCCGTTGGGGG + Intronic
1163290655 19:16377142-16377164 GGAGGAGCAGGTTTCTTCGGAGG + Exonic
1165803705 19:38567819-38567841 GGAGGTGCTTGCTTCTTGGGGGG - Exonic
925675967 2:6361122-6361144 GGAGGAGGATTATTCTCTGGAGG - Intergenic
926932361 2:18053311-18053333 GAAGTAGCATTATTCTTTGGGGG - Intronic
928286616 2:29995551-29995573 ACAGGGGCATGCTTGTTTGGTGG - Intergenic
928480927 2:31683066-31683088 CAAGGAGCGTGATTCTTTGGAGG + Intergenic
932562005 2:72881405-72881427 GAAGGAGCAGGGTTCTTTGGAGG - Intergenic
932922574 2:75934012-75934034 GGGGTGGAATGCTTCTTTGGTGG - Intergenic
933477982 2:82817153-82817175 GGAGTGGCATGTTTGTTTGGGGG - Intergenic
934758427 2:96840208-96840230 TGAGGGGCACGGTGCTTTGGGGG - Intronic
936526608 2:113245817-113245839 GGAAAGGCATGATCCTTTGCTGG - Intronic
937465774 2:122131781-122131803 GGCAGGACATGTTTCTTTGGGGG + Intergenic
938593986 2:132767853-132767875 GGGGTGGCAGGATGCTTTGGAGG + Intronic
941481754 2:166024102-166024124 GGTGGTGCATGCTACTTTGGAGG + Intronic
942030887 2:171957647-171957669 GGATGGACATGAATCTTTGAGGG + Intronic
943509397 2:188805140-188805162 ATAAGGGCATGATTCATTGGGGG - Intergenic
945232043 2:207601980-207602002 GGAGAGGCATTAATCTTTGAGGG + Exonic
948376064 2:237521035-237521057 GGAGTGGTATGGTTGTTTGGGGG + Intronic
1169232473 20:3900304-3900326 GAAGGGGCGTGATTGTCTGGAGG + Intronic
1172968210 20:38854011-38854033 TGAAAGGCATGATTCATTGGGGG + Intronic
1174410989 20:50335427-50335449 GGAGGAGTATGAGTCTTTGGTGG + Intergenic
1175142112 20:56868527-56868549 GGATGGGCATGATTCCGTGTGGG + Intergenic
1175615820 20:60397486-60397508 GGAGGGGGATGATTCTACAGAGG + Intergenic
1175773054 20:61635698-61635720 GGAGGAGGAGGATTCTCTGGGGG + Intronic
1175813471 20:61871610-61871632 GGAGGGGGATGTCTCTTTAGAGG + Intronic
1178352669 21:31884001-31884023 GGAGAGGCATGATACTGTGTGGG + Intronic
1179542097 21:42089768-42089790 GGAGGGGCATTAGTATTTTGTGG + Intronic
1179552955 21:42154868-42154890 GGAGGGGCATGAGTGTCTGAGGG + Intergenic
1180083578 21:45497592-45497614 GGAGGGCCCTGATTCCCTGGAGG - Exonic
1180471267 22:15658130-15658152 GGAGATGAAGGATTCTTTGGAGG - Intergenic
1180571165 22:16721508-16721530 GGAGAGGCATTATAATTTGGAGG + Intergenic
1182848125 22:33448101-33448123 GGTGTGGAATGATTATTTGGTGG + Intronic
1184853400 22:47133712-47133734 GGAGGGCCATGGAGCTTTGGCGG + Intronic
953181865 3:40603143-40603165 TGAGAGGCATTATTCATTGGGGG + Intergenic
953213654 3:40897996-40898018 GGTGGGGCAGGATTATGTGGAGG + Intergenic
954838596 3:53493130-53493152 GGATGGGCTAGTTTCTTTGGAGG + Intergenic
955371591 3:58356446-58356468 AGATGGGAATGATTCATTGGAGG + Intronic
955747910 3:62158230-62158252 GGTTGGGGATGATTCTTAGGAGG + Intronic
958742818 3:98095646-98095668 TGAGGGGCCTGATTGTTAGGAGG - Intergenic
964897417 3:161614407-161614429 GGACAGACATGAATCTTTGGGGG - Intergenic
965166796 3:165204479-165204501 GCAAGGGCATGATTCATTGGGGG - Intergenic
967215505 3:187206598-187206620 GGAAGGACATGAGTTTTTGGGGG - Intergenic
969167675 4:5330838-5330860 GGAGGGGAGTGTGTCTTTGGAGG + Intronic
970730551 4:19098382-19098404 GGAGGGGGAAGATCTTTTGGAGG + Intergenic
972869532 4:43280077-43280099 AGAGGGTCATCATTCTTTGGTGG - Intergenic
974491524 4:62571163-62571185 AGAGGGGCCTGATTGTTTGAAGG - Intergenic
976653325 4:87459724-87459746 GGAGGGGGTTGGTGCTTTGGGGG + Intergenic
978216201 4:106207600-106207622 GGAGGGGCATGATGAAATGGAGG - Intronic
979742130 4:124165266-124165288 GGAGGGCGATGATTCCTTTGGGG - Intergenic
983302825 4:165948855-165948877 GGAGGGGCTTGAATCTTTGAGGG + Intronic
983851934 4:172591929-172591951 GGAGGAGCAAAACTCTTTGGAGG + Intronic
984051253 4:174868093-174868115 GAAGGGACATGAGTCATTGGGGG + Intronic
984863616 4:184261544-184261566 GGAGAGGCAAGATTCTGAGGAGG + Intergenic
986545239 5:8889899-8889921 AGAGATGCATGAGTCTTTGGTGG + Intergenic
987816443 5:22906959-22906981 GGAGGTGCAAGAATGTTTGGAGG + Intergenic
989626151 5:43431255-43431277 GGACTGGGATGAATCTTTGGAGG - Intergenic
994051540 5:95367558-95367580 GGAGGGGAAATATTCTTGGGGGG + Intergenic
995405191 5:111786860-111786882 AGAAGGGCATGAATCTTTGGTGG + Intronic
997827423 5:137119147-137119169 GGAGAGGGATCATTCTCTGGTGG - Intronic
999950802 5:156648134-156648156 ACAGGGGCATGGTTGTTTGGTGG - Intronic
1001272061 5:170320297-170320319 GCGGGGGCATGAATTTTTGGAGG + Intergenic
1001454454 5:171849996-171850018 GGAGAGGAATGGTTCTTTAGAGG - Intergenic
1001650937 5:173315902-173315924 GGAGGGGAATCATTGGTTGGGGG - Exonic
1003083311 6:3039986-3040008 GGAATGGCATGCTTTTTTGGGGG + Intergenic
1006993179 6:38233003-38233025 GGATGGTCATGCTTCCTTGGTGG + Intronic
1007428803 6:41764445-41764467 GGAGAGGCATGATCCCTTGGGGG - Intergenic
1012278599 6:97302302-97302324 TGAGAGGCATGGTTCATTGGAGG + Intergenic
1012603632 6:101130542-101130564 GGAGGGTCATGATGTGTTGGGGG + Intergenic
1013780222 6:113720559-113720581 GGAGGGGCATGAGTCAGGGGAGG - Intergenic
1016127934 6:140428697-140428719 GGAACTGCATGATTCTTTGTTGG - Intergenic
1016241971 6:141940999-141941021 GGAGGGGCATGACTGTTAGAAGG + Intergenic
1016983672 6:149877538-149877560 GGAGGGGCAGAAGTCTGTGGGGG - Intergenic
1017049932 6:150380919-150380941 GCATAGGCATGAGTCTTTGGGGG - Intronic
1018990214 6:168668858-168668880 GGAGGGGGATGATGGTGTGGGGG - Intronic
1019041274 6:169108136-169108158 GGAGGGGCCTAATTCCATGGAGG - Intergenic
1019319667 7:409852-409874 GCAGAGGCAGGAGTCTTTGGAGG - Intergenic
1020788184 7:12594224-12594246 GGAGGATCATGATGCTCTGGTGG + Intronic
1021549444 7:21854416-21854438 AGAGGGGGTTGATTTTTTGGAGG - Exonic
1027839909 7:83296388-83296410 GGGAGGGCAAGATTCTATGGGGG - Intergenic
1028479294 7:91287209-91287231 GGAGGGGGATGATGGTTGGGGGG - Intergenic
1029474453 7:100774851-100774873 GGAGGGGCATGATTCTTTGGAGG - Intronic
1030674792 7:112373348-112373370 GGAGTGGTATAATTGTTTGGGGG - Intergenic
1033042233 7:137928920-137928942 CGGGGGGCATGATTCACTGGGGG + Intronic
1033539617 7:142344886-142344908 GGAGGGGCATGAGCCTTGGCTGG - Intergenic
1034885808 7:154798044-154798066 TGAGGGACGTGATTCTTTGTTGG + Intronic
1034949248 7:155285902-155285924 GATGGGGCATGAGTGTTTGGTGG - Intergenic
1035031813 7:155865763-155865785 GGAGGAGCATGAGACTTGGGAGG + Intergenic
1035186645 7:157131507-157131529 GGAGGGGCAAGATTATATGGAGG - Intergenic
1039437412 8:37569592-37569614 GGGGGAGCATGAATCTTTGGTGG - Intergenic
1042331325 8:67583643-67583665 GGAGTGGCATGGTTGTTTGTGGG + Intronic
1043094404 8:75948205-75948227 GGGGGGGCCAGCTTCTTTGGAGG - Intergenic
1043274618 8:78377660-78377682 AGTGTGGCATGATTCATTGGGGG - Intergenic
1044205556 8:89488877-89488899 GGAGGGGCATAAATCATTGGTGG - Intergenic
1046069846 8:109237357-109237379 GAAGAGGCCTGATTCTGTGGTGG - Intergenic
1047191983 8:122686695-122686717 GGTGGGGCAGGATCATTTGGGGG - Intergenic
1052298094 9:26921290-26921312 AGAAGAGCATGATTCTTCGGAGG - Intronic
1055029297 9:71757114-71757136 GGAAGGGCTAGATTATTTGGGGG - Intronic
1056013322 9:82355422-82355444 GGTGGTGAATGATACTTTGGGGG + Intergenic
1056670277 9:88622003-88622025 ACAGGGGCATGAATCTTTGGAGG - Intergenic
1057519059 9:95746560-95746582 GGAGGAGCAGGATTTTTTCGGGG - Intergenic
1059257771 9:112946300-112946322 GGAGGACCATGAGTCTTTGGTGG + Intergenic
1185825973 X:3249988-3250010 GGGGCTGCATGATTCTCTGGTGG - Intergenic
1188649169 X:32610048-32610070 GGAGTGGCATGATGCTATTGAGG - Intronic
1189408754 X:40750490-40750512 GGAGAGACATGAATCATTGGGGG + Intergenic
1193041767 X:77011430-77011452 GGAGGGGCAGGACTCCTTAGAGG + Intergenic
1193698802 X:84739763-84739785 GGAGGATCATGATGCTCTGGTGG - Intergenic
1194755586 X:97734755-97734777 GGAGGGGCATAAATCTGTGGTGG + Intergenic
1197716148 X:129707330-129707352 GGAGGGGTGTGTTTATTTGGTGG - Intergenic
1200231273 X:154444949-154444971 GGAGGAGCTTGATCCTTTTGGGG + Intronic