ID: 1029475555

View in Genome Browser
Species Human (GRCh38)
Location 7:100781689-100781711
Sequence CAGGCTGGAGTCTATGATCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 467
Summary {0: 1, 1: 1, 2: 26, 3: 94, 4: 345}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029475555 Original CRISPR CAGGCTGGAGTCTATGATCT CGG Intronic
901076546 1:6558667-6558689 CAGGCTGGAGTGCACGATCTCGG - Intronic
901279131 1:8018851-8018873 CAGGCTGGAGTCATTGATTCAGG - Intronic
901505943 1:9685986-9686008 CAGGTTGGAGGCTAGGATATTGG + Intronic
901586753 1:10301613-10301635 CAGGCTGGAGTGCCCGATCTCGG - Intronic
902545569 1:17187529-17187551 CAGGCAGGAGGTTGTGATCTGGG - Intergenic
902676988 1:18015644-18015666 CAGGCTGGAGACTGAGATCAGGG - Intergenic
903622565 1:24708439-24708461 CAGGCTGGAGTGTACAATCATGG + Intergenic
903948375 1:26978831-26978853 CAGGCTGGAGTGCACAATCTCGG - Intergenic
904444475 1:30557072-30557094 CAGGCTGGAGTGCACAATCTTGG - Intergenic
904622225 1:31782364-31782386 CAGGCTGGTGTCTATGTCCCGGG - Intergenic
904759674 1:32793591-32793613 CAGGCTGGAGTGATTGATCTTGG - Intronic
904912357 1:33944908-33944930 CAGTGTGGAGTCCATGCTCTTGG + Intronic
905152759 1:35944851-35944873 CAGACTGGAGTGCATAATCTTGG + Intronic
907119964 1:51999710-51999732 CAGGCTGGAGTGCATGATCCTGG - Intergenic
909480380 1:76123798-76123820 CAGGCTGGAGTGCATGATCTCGG + Intronic
915587414 1:156851713-156851735 CTGGATGGAGTCGATGGTCTTGG + Exonic
916156487 1:161854819-161854841 CAGGCTGGACTGCGTGATCTCGG - Intronic
916212608 1:162371059-162371081 CAGGCTGGAGTGCATGATCATGG + Intronic
916489508 1:165289055-165289077 GAGGCTGGAGTCTCTGGTGTGGG - Intronic
916586539 1:166154470-166154492 CAGGCTGGACTCTCTGCTCCTGG + Intronic
916587479 1:166161195-166161217 CAGGCTGGAGTGTGCAATCTTGG + Intronic
917813833 1:178687423-178687445 AAGGGTGGAGTATATGACCTAGG + Intergenic
917887659 1:179402119-179402141 CAGGCTGGAGTGCATGATGTCGG - Intronic
917923788 1:179772037-179772059 CAGGCTAGAGACTGTGACCTGGG - Intronic
918509870 1:185299853-185299875 CAGTCTGCAGTCTGTGAGCTTGG - Exonic
918978589 1:191525074-191525096 CAGCCTGGAGGGCATGATCTAGG - Intergenic
919613826 1:199779778-199779800 CAGGCTGGATTGTGTGATCTCGG - Intergenic
921921430 1:220674507-220674529 CAGGCTTGAGTTAATGATCCTGG + Intergenic
921955711 1:220981439-220981461 CAGGCTGGAGTGCGCGATCTCGG + Intergenic
922245906 1:223797461-223797483 CAGGCTGGAGTGCACCATCTCGG + Intronic
922863365 1:228838105-228838127 CAGGCTGGAGTCTTTGGGCCTGG - Intergenic
923655886 1:235916654-235916676 CAGGCTGGAGTGCATGATCTCGG + Intergenic
923765377 1:236888254-236888276 TAGGCTGGAGTCTAAGGTGTTGG - Intronic
924796798 1:247298529-247298551 CAGGCTGGTGTCACTGAGCTAGG + Exonic
1063719005 10:8559673-8559695 CAGGCTGGAGTAGACGATCTGGG + Intergenic
1063777036 10:9274838-9274860 CAGGCTGGAGTGCACGATCTCGG - Intergenic
1063887940 10:10598802-10598824 CAGGCTGGAGTGCGGGATCTCGG + Intergenic
1064055279 10:12092032-12092054 CATGCTGGAGTACGTGATCTCGG + Intronic
1064090755 10:12381384-12381406 CAGGCTGGAGTGCACGATCTTGG + Intronic
1065056866 10:21853741-21853763 CAGGCTGGAGTGTGCAATCTCGG - Intronic
1065429500 10:25639100-25639122 CAGGCTGGAGTGCTCGATCTCGG + Intergenic
1065639657 10:27768783-27768805 GAGGCTGGAGTTTGTGATATGGG - Intergenic
1065991626 10:31015769-31015791 GAGGCTGCAGTCTAAGATCATGG + Intronic
1066694699 10:38067342-38067364 CAGTCTGGAGTCTAGGATACAGG - Intergenic
1066997814 10:42579837-42579859 CAGTCTGGAGTCTAGGATACAGG + Intronic
1070630882 10:78083731-78083753 CAGGCTGGAGTGCACGATCTTGG - Intergenic
1071455808 10:85850606-85850628 CAGGCTGGAGGCTGTGTTTTAGG + Intronic
1072330132 10:94340582-94340604 CAGGCTTGAGTCTTTGCTCCTGG - Intronic
1073023723 10:100470174-100470196 CAGGCTGGAGTGTACAATCTTGG + Intronic
1073185500 10:101613102-101613124 CAGGCTGGGGGCTGTGATCACGG - Intronic
1073401744 10:103263014-103263036 CAGGTTGGAATGCATGATCTTGG - Intergenic
1074395055 10:113090950-113090972 CAGGCTGGAGTGTGTGATCTTGG + Intronic
1075713981 10:124545328-124545350 CAGGCGGAAGTCTATGTTATGGG - Intronic
1075760103 10:124849175-124849197 CAGGCTGGAGCATTTGCTCTGGG + Intergenic
1077282626 11:1752579-1752601 CAGGCTGGAGCCCATGGGCTGGG + Intronic
1077289933 11:1784364-1784386 GAGGCTGGAGTCTGAGATCAAGG + Intergenic
1077336388 11:2006798-2006820 GAGGCTGGAGTCCAAGATCAGGG - Intergenic
1077492315 11:2867314-2867336 GAGGCTGGAGTCCACGATCAAGG - Intergenic
1077529575 11:3088875-3088897 GAGGCTGGAGTCCAAGATCTCGG - Intronic
1077542734 11:3155120-3155142 GAGGCTGGAGTCCAAGATCGAGG - Intronic
1077762246 11:5114961-5114983 CAAGCTGGAGTGCATGATCTCGG + Intergenic
1077888206 11:6401592-6401614 CAGGCTGGTGGCGATGTTCTTGG + Exonic
1080535054 11:33213229-33213251 CAGGCTGGAGTGCACGATCTCGG - Intergenic
1081447241 11:43142452-43142474 CAGGCTGGAGTGCATGATCTCGG - Intergenic
1081733519 11:45387730-45387752 CAAGCCAGAGTCAATGATCTGGG - Intergenic
1082813905 11:57495777-57495799 CAGGCTGGAGTGTAGTGTCTTGG - Intronic
1083108254 11:60379581-60379603 CAGGCTAGAGTGCGTGATCTCGG + Intronic
1083691508 11:64411721-64411743 CAGGCTGGAGTGCAAGATCTCGG + Intergenic
1083799627 11:65039072-65039094 CAGGCTGGAGTGCACAATCTCGG + Intronic
1084124156 11:67087861-67087883 CAGGCTGGAGTGCTTGATCTTGG - Intergenic
1084288684 11:68147887-68147909 CAGGCTGGAGTACACGATCTGGG + Intergenic
1084721668 11:70909945-70909967 GAGGCTGGAGTCTGAGATCAAGG + Intronic
1085317458 11:75554276-75554298 CAGGCTGGAATCTAGGAGCTGGG + Intergenic
1086148768 11:83585274-83585296 CAGGATGGAGACATTGATCTGGG + Intronic
1086730435 11:90241759-90241781 CAGGCTGGACTCAAACATCTGGG + Intergenic
1088278848 11:108116873-108116895 GAGGCTGGAGTCCAAGATCCAGG - Intergenic
1089949428 11:122511465-122511487 CAATCTGGAGTCTATGGCCTTGG + Intergenic
1090575658 11:128100189-128100211 CAGGCTGGAGTTTAAGGTCATGG - Intergenic
1090611549 11:128475600-128475622 CAGGCTGGAGTGTGCGATCTCGG + Intronic
1090701518 11:129300098-129300120 CAGGCTGGAGTGCACGATCATGG - Intergenic
1091310407 11:134571369-134571391 GAGGCTGGAGTCTTGGCTCTGGG - Intergenic
1202819372 11_KI270721v1_random:61980-62002 GAGGCTGGAGTCCAAGATCAGGG - Intergenic
1091494699 12:962018-962040 AAGGCTAGAGTCTAAGATCAAGG - Intronic
1092056040 12:5508728-5508750 CAGGCTGAAGTCTGAGATCAAGG - Intronic
1092223662 12:6732284-6732306 CAGGCTGGAGTGCATGATCTCGG - Intergenic
1092377546 12:7968340-7968362 CAGGCTGGCCTCTAACATCTAGG - Intergenic
1092835161 12:12480767-12480789 CAGGCTGGAGTGCACGATGTCGG + Intronic
1094120632 12:26970311-26970333 GAGGCTGAAGTCCATGATCAAGG + Intergenic
1096010260 12:48207812-48207834 CAGGCTGCAGTGCACGATCTCGG + Intergenic
1096252106 12:50040073-50040095 CTGGCTGGAGTGTCTGAGCTGGG - Intergenic
1097212590 12:57383655-57383677 CAGGCTGGAGTGCATGATCTCGG - Intronic
1097443769 12:59644514-59644536 CAGGCTGGAGTGCATTTTCTTGG - Intronic
1098864422 12:75745770-75745792 CAGTATGGAGTCTAAGCTCTGGG - Intergenic
1102278632 12:111600886-111600908 CAGGCTGGAGTGCATGATCTCGG - Intergenic
1102363389 12:112309312-112309334 CTGGCTGGAAACAATGATCTTGG + Intronic
1102443270 12:112979654-112979676 CAAGCTGGACACTTTGATCTGGG - Intronic
1102587909 12:113935983-113936005 CAGGCTGGAGTGCGCGATCTTGG - Intronic
1102835214 12:116050886-116050908 CAGGCTGGCGTGCATGATCTCGG - Intronic
1103362944 12:120364383-120364405 AAGGCTGTGGTCTATGATGTTGG + Intronic
1103812486 12:123626851-123626873 CAGGCCGCAGTATATGATCTAGG - Intronic
1105015305 12:132783143-132783165 CAGGCTGGAGTGCACAATCTTGG - Intronic
1106182646 13:27381814-27381836 CGGGCTTGAGTCTGTGATGTTGG - Intergenic
1106543963 13:30714627-30714649 CAGGCTGGAGACTATGCGCTAGG - Intronic
1106674056 13:31938786-31938808 CAGGCTGGAGTGCATGATCTCGG + Intergenic
1107414115 13:40185335-40185357 CAGGCTGGAGTCTGCGATAGAGG - Intergenic
1107968073 13:45615259-45615281 AAGGCTGGAGTTTTCGATCTGGG + Intronic
1108084577 13:46772733-46772755 CATGCTGGAGTGCATGATCTTGG + Intronic
1109003496 13:56836618-56836640 CAAGCTGAAGTGCATGATCTTGG - Intergenic
1109330978 13:60929492-60929514 CAGGCTGGACTTCATGATCATGG - Intergenic
1109463924 13:62701976-62701998 CAGGCTGGATGGTGTGATCTCGG - Intergenic
1109839528 13:67904152-67904174 CAGGCTGGAGTGCACGATCTCGG + Intergenic
1110270528 13:73584542-73584564 CTGGCTGTAATCTGTGATCTCGG + Intergenic
1110290963 13:73806155-73806177 CAGGCTGGAGTGCATGATGTTGG + Intronic
1111346043 13:86955483-86955505 CAGGCTGGAGTGCACGATCTCGG - Intergenic
1111813497 13:93120982-93121004 AAAGCTGGAGTCTGGGATCTGGG + Intergenic
1113067605 13:106387876-106387898 CAGGCTGGAGTGTGAGGTCTGGG + Intergenic
1113413223 13:110108208-110108230 CAGGCTGGAACCTGTGGTCTCGG + Intergenic
1113753470 13:112792196-112792218 AAGGCTGGAGTCTGGAATCTAGG + Intronic
1114755386 14:25253930-25253952 CAGGCTGGAGTGCATGATCTCGG + Intergenic
1115296260 14:31830753-31830775 CAGGCAGGATACTTTGATCTGGG + Intronic
1115547091 14:34473887-34473909 CAGGCTGGAGCGCATTATCTTGG + Intergenic
1115568505 14:34645871-34645893 CAGGCTGGTCTCTATTTTCTGGG + Intergenic
1115863740 14:37718885-37718907 TAGGCTGGAGTGCATGATCACGG - Intronic
1115960490 14:38831372-38831394 CAGGCTGGAGTGCACGATCTCGG + Intergenic
1116411721 14:44632253-44632275 CAGGCTGGAGTGCACGATCTTGG - Intergenic
1117390901 14:55261552-55261574 CAGGTTGGAGTGCATGATCTCGG - Intergenic
1117966792 14:61214569-61214591 GAGGCTGGAATCTAAGATCTTGG + Intronic
1119932079 14:78557093-78557115 CAGGCTGCAGTGCATGATCATGG + Intronic
1120089294 14:80312524-80312546 CAGGCTGGAGGGCACGATCTTGG + Intronic
1120348199 14:83317605-83317627 CAGGCTAGAGTTTATGCTCTTGG + Intergenic
1120892330 14:89502115-89502137 CAGGCTGGAATGTGGGATCTAGG - Intronic
1121763824 14:96468344-96468366 CAGGCTGGAGTGCGCGATCTCGG + Intronic
1122183145 14:99970579-99970601 CAGGCTGGAATGCAAGATCTCGG + Intergenic
1122594631 14:102881040-102881062 CAGGCTGGAGTGCATGATCTTGG - Intronic
1122788950 14:104176396-104176418 GAGGCTGGAGTGGATGGTCTGGG - Exonic
1126468047 15:48978751-48978773 GAGGCTGGAGTCCAAGATCAAGG + Intergenic
1128871236 15:71156816-71156838 CAGGCTGTATTCTAGGAGCTGGG - Intronic
1129047439 15:72748961-72748983 CAGGCAGAAGTGCATGATCTTGG + Intergenic
1129078105 15:73014881-73014903 CAGTGTGGAGTCTATCACCTGGG + Intergenic
1129115290 15:73362221-73362243 CAGGGTGAAGTCTGTGAACTGGG - Intronic
1129633553 15:77289784-77289806 CAGGCTGGAGTGCACGATATCGG - Intronic
1130240941 15:82190064-82190086 CAGGCTGGAGTGCGTGATCTTGG - Intronic
1130937998 15:88486370-88486392 CAGGCTGGACTCGAAGTTCTGGG - Intergenic
1131389252 15:92033903-92033925 CAGGCTGGCGTTGATGAGCTGGG + Intronic
1133065582 16:3204389-3204411 CAGGCAGGAGTCTATGCTTACGG - Exonic
1133067055 16:3215753-3215775 CAGGCGGGAGTCTATGCTTATGG - Intergenic
1133143400 16:3765022-3765044 CAGGCTGGAGTGCAGTATCTCGG + Intronic
1133951363 16:10396697-10396719 CAGGATGGAGTGCTTGATCTTGG + Intronic
1134060266 16:11195264-11195286 CAGGCTGGGGTGCATGATCTCGG + Intergenic
1134304114 16:13016960-13016982 TATGCTGGGGTCTCTGATCTCGG + Intronic
1134500845 16:14768057-14768079 CAGGCTAGAGTGCATGATTTTGG + Intronic
1134527371 16:14954596-14954618 CAGGCTAGAGTGCATGATTTTGG + Intergenic
1134545018 16:15101675-15101697 CAGGCTAGAGTGCATGATTTTGG - Intronic
1134579737 16:15360992-15361014 CAGGCTAGAGTGCATGATTTTGG - Intergenic
1134714972 16:16353206-16353228 CAGGCTAGAGTGCATGATTTTGG + Intergenic
1134722848 16:16396567-16396589 CAGGCTAGAGTGCATGATTTTGG + Intergenic
1134781776 16:16904556-16904578 CAGGGTGGAGCATATGACCTAGG + Intergenic
1134944580 16:18315304-18315326 CAGGCTAGAGTGCATGATTTTGG - Intergenic
1134951843 16:18355453-18355475 CAGGCTAGAGTGCATGATTTTGG - Intergenic
1135310186 16:21399513-21399535 CAGGCTAGAGTGCATGATTTTGG - Intergenic
1135363133 16:21831929-21831951 CAGGCTAGAGTGCATGATTTTGG - Intergenic
1135448657 16:22539131-22539153 CAGGCTAGAGTGCATGATTTTGG + Intergenic
1136149773 16:28339855-28339877 CAGGCTAGAGTGCATGATTTTGG - Intergenic
1136166009 16:28453659-28453681 CAGGCTAGAGTGCATGATTTTGG - Intergenic
1136196963 16:28661361-28661383 CAGGCTAGAGTGCATGATTTGGG + Intergenic
1136213302 16:28775484-28775506 CAGGCTAGAGTGCATGATTTGGG + Intergenic
1136258035 16:29055401-29055423 CAGGCTAGAGTGCATGATTTTGG + Intergenic
1136306931 16:29378656-29378678 CAGGCTAGAGTGCATGATTTTGG - Intergenic
1136320458 16:29480908-29480930 CAGGCTAGAGTGCATGATTTTGG - Intergenic
1136435031 16:30220248-30220270 CAGGCTAGAGTGCATGATTTTGG - Intergenic
1140100733 16:71914207-71914229 CAGGCGGGAGTGCACGATCTTGG + Intronic
1142139479 16:88466430-88466452 CAGGATGGAGACTCTGACCTCGG - Intronic
1142267201 16:89070140-89070162 GAGGCTGGAGTCCAAGATCAAGG - Intergenic
1142386905 16:89771112-89771134 CAGGCTGGAGTGGACGATCTTGG - Intronic
1142403200 16:89871843-89871865 CAGCCTGGAGTCAAAGTTCTGGG - Intergenic
1142820346 17:2461318-2461340 CAGGCTGGAGTGCATGCACTAGG - Intronic
1144237456 17:13275388-13275410 AGAGCTGTAGTCTATGATCTTGG + Intergenic
1144743141 17:17595609-17595631 CAGGCCTGAGTCTATGAAGTGGG - Intergenic
1145276706 17:21435746-21435768 CAGGCTGGAGCACATAATCTTGG - Intergenic
1145713001 17:26993610-26993632 CAGGCTGGAGCGCATAATCTTGG - Intergenic
1146006103 17:29161743-29161765 CAGGCTGGAGACTAGGGCCTGGG - Intronic
1146419835 17:32673152-32673174 CAGGCTGGAGTGCAGTATCTTGG + Intronic
1147177612 17:38666000-38666022 CAGGCTGGAGTGCACAATCTTGG - Intergenic
1147844222 17:43393600-43393622 CAGGCTGGAGGGCATGATCTTGG - Intergenic
1148473516 17:47911460-47911482 CAGGCTGGGGTGCATGATCTTGG - Intronic
1148559259 17:48596740-48596762 CTGGCTGGAGTCTGTGTTCGAGG - Intronic
1148884045 17:50758481-50758503 CAGGCTTGAGTGCATGATCTCGG - Intergenic
1149415563 17:56456446-56456468 CAGGCTGGAGAGCACGATCTCGG + Intronic
1150075270 17:62186775-62186797 CCTGCTGGAATCTATGATCTAGG + Intergenic
1151722222 17:75863722-75863744 CAGGCTGGAGCGTACAATCTTGG - Intergenic
1151746049 17:76012349-76012371 CAGGTTGGAGTGCGTGATCTCGG + Intronic
1152010190 17:77708238-77708260 GAGGCTGAAGTCCAAGATCTAGG + Intergenic
1152455778 17:80415314-80415336 CAGCCTGAAGACTATGAGCTCGG - Intronic
1154116488 18:11616621-11616643 CAGGCTAGAGTGCATGATTTTGG - Intergenic
1155010838 18:21776222-21776244 CAGGCTGGAGTGCACGATCACGG - Intronic
1155766567 18:29641813-29641835 CAGGCTGGAGTGTACAAACTTGG - Intergenic
1157257168 18:46149682-46149704 CAGGCTAGAGTGTGTGATCATGG + Intergenic
1158069227 18:53450952-53450974 CATGGTGGAGTCTATTCTCTAGG - Intronic
1158356811 18:56630150-56630172 CAGGCTGGAGTGCACGATCTTGG - Intronic
1158594496 18:58804353-58804375 CAGTCTAGAGTCTAGGCTCTAGG - Intergenic
1159211491 18:65327960-65327982 CAGGCTGGAGGGCATGATCATGG + Intergenic
1159379902 18:67643500-67643522 CAGGCTGGAGTACATGATCTCGG + Intergenic
1159534942 18:69704048-69704070 GAGGCTGGAGTCTGAGATCAGGG - Intronic
1159781538 18:72666314-72666336 CAGGCTGGAGTGCAAGATCATGG + Intergenic
1160713155 19:562613-562635 CAGGCTGGTGTCGGTGAACTGGG + Intergenic
1160758010 19:767941-767963 CAGGCTGGAGTGCGTGATCTCGG + Intergenic
1161540217 19:4846269-4846291 CAGGCTGGAGTGGATGATCATGG - Intronic
1161619061 19:5288960-5288982 CAGGCTGGAGTGGCGGATCTGGG - Intronic
1161886050 19:6996493-6996515 GACACTGGAGTTTATGATCTTGG - Intergenic
1162861683 19:13510263-13510285 CACACTGGAGTGCATGATCTTGG - Intronic
1163317636 19:16552383-16552405 CAGGCTGGAGTGCACAATCTCGG + Exonic
1163422972 19:17225407-17225429 CAGGCTGGAGGGCATGATCATGG - Intergenic
1163468683 19:17484534-17484556 CAGACTAGAGTCCATGATCATGG - Intronic
1164002881 19:21121080-21121102 CAGGCTGGAGTGTGCAATCTCGG + Exonic
1164451350 19:28368271-28368293 CAGGCTGGAGTGTGTGATCATGG + Intergenic
1164754351 19:30678889-30678911 CAGGCTGGAGTGAACTATCTTGG - Intronic
1165709819 19:38003093-38003115 CAGGCTGGAGTGTGTGAACTCGG - Intronic
1165956279 19:39503796-39503818 CGGGCTGGAGTCTGTGCTCTTGG - Intronic
1166212017 19:41312828-41312850 CAGGCTGGAGTACGTGATCTCGG + Intronic
1166834245 19:45657531-45657553 CAGGCTAGAGTGCACGATCTCGG - Intergenic
1167679698 19:50911591-50911613 GAGAGTGGAGTCTAGGATCTGGG - Intergenic
1168377670 19:55894089-55894111 CAGGCTGGAGTGCATGATCATGG + Intronic
925133619 2:1511571-1511593 GAGGCTGGAGTCCAAGATCAAGG + Intronic
925280472 2:2681015-2681037 CAGGCTGGAGTGCGTGATCTCGG - Intergenic
926116287 2:10215383-10215405 CAGGCTGGGGTCTGTGTGCTTGG + Intergenic
926487719 2:13483307-13483329 CAGGCTAGAGTGCGTGATCTTGG + Intergenic
926700947 2:15803019-15803041 CTGGCAAGTGTCTATGATCTGGG + Intergenic
927142243 2:20138350-20138372 CAGTTTGGAAACTATGATCTGGG + Intergenic
927538252 2:23882244-23882266 CAGGCTGGAGTGCATGATCTTGG + Intronic
928699903 2:33888003-33888025 GGGGCTGGAGTCTATGTTCCAGG - Intergenic
928963367 2:36952810-36952832 CAGGGAGGAGCCTGTGATCTGGG - Intronic
929143039 2:38683299-38683321 TTGGGTGGGGTCTATGATCTAGG - Intronic
929299519 2:40287433-40287455 CATGCTGAAGTCTATGATTCAGG - Intronic
930613658 2:53571078-53571100 CAGGCTGGAATGCATGATCTCGG + Intronic
930720593 2:54633888-54633910 CAGGCTGAACTATATGTTCTAGG + Intronic
931729399 2:65139643-65139665 CAGGCTGGAGTGCACGATCTCGG - Intergenic
932348498 2:71012154-71012176 CAGACTGGAGTTTCTGTTCTTGG + Intergenic
932580020 2:72987161-72987183 CAGGCTGGAGTGCGTGATCTTGG + Intronic
933327125 2:80852347-80852369 GGGGCTGGTGTCTCTGATCTTGG + Intergenic
933377554 2:81499479-81499501 CAGGCTGGAGTGCTGGATCTTGG + Intergenic
933842928 2:86302172-86302194 CAGGCTGGAGTCTGGGACCCGGG - Intronic
933899590 2:86840033-86840055 GAGGCAGGAGTCTAGGGTCTGGG + Intronic
935381183 2:102452621-102452643 CAGGCTGGAATGCATGTTCTTGG + Intergenic
935521753 2:104115005-104115027 CAGTCTGAAGTATATGATCGTGG - Intergenic
935714473 2:105927838-105927860 CTGGCTGGATCCTAGGATCTAGG + Intergenic
935780969 2:106509193-106509215 GAGGCAGGAGTCTAGGGTCTGGG - Intergenic
936079126 2:109420303-109420325 TAGGGTGAAGTCTATGAACTTGG + Intronic
936372959 2:111918370-111918392 TAGGCTGGAGTATATGTTTTGGG + Intronic
937373548 2:121319546-121319568 CAGGCTGGAGACTGAGCTCTGGG - Intergenic
938763279 2:134443939-134443961 CAGGCAGGAGTCAGTGCTCTTGG + Intronic
938826030 2:135006309-135006331 CTGTCTGGTTTCTATGATCTAGG + Intronic
938832156 2:135062069-135062091 CAGGCTGGAGTGCTTGATCTTGG + Intronic
938897131 2:135763612-135763634 CAGGCTGGTCTCTATTTTCTGGG - Intronic
939864156 2:147454132-147454154 CAGGCTGGAGTTTATGAGGCTGG - Intergenic
940027180 2:149220491-149220513 CAGGTAGGAGCCTATGATCTTGG - Intergenic
940901844 2:159132860-159132882 CAGGGTTGAGTCTATGAGTTAGG + Intronic
941263911 2:163335095-163335117 CAGGCTGGAGACTAAGGTATGGG - Intergenic
941442214 2:165552743-165552765 CAGGCTGGAGTGTGCAATCTTGG + Intronic
942187660 2:173439523-173439545 CAGGCTGGAGTGCATTATCTCGG - Intergenic
942365224 2:175219183-175219205 CAGGCTGGACTCTAACTTCTGGG - Intergenic
942366082 2:175229140-175229162 CAGGCTGGACTCTAACTTCTGGG + Intergenic
944512721 2:200480425-200480447 TAGGCTGGAGTGCATGATCATGG + Exonic
945741451 2:213667989-213668011 CAGGCTGGAGTGCATGATCTCGG + Intronic
946245203 2:218383436-218383458 CAGGCTGGCATCTAGCATCTAGG + Intronic
947400128 2:229723644-229723666 CAGGCTGGAGTGCATGATCTTGG + Intergenic
947547814 2:231023650-231023672 CAGGCTGGAGTTTAGTATCATGG - Intronic
947564232 2:231183874-231183896 GAGGCTGGAGTCCAAGATCAAGG - Intergenic
947738494 2:232473414-232473436 CAGGCTGCATTCTTTGATCCTGG + Intergenic
948575265 2:238945876-238945898 CAGGCTGGAGGGTATCCTCTGGG - Intergenic
1169611855 20:7389941-7389963 CATGCTGGAATCTGTGATCTAGG - Intergenic
1170032932 20:11961185-11961207 CAGGCTTGAGTCTGGTATCTTGG + Intergenic
1171095904 20:22332126-22332148 AAGGCTGGAGCCTAAGATGTTGG + Intergenic
1173501263 20:43555681-43555703 CAGGCTGGAGTGCACAATCTCGG - Intronic
1173843905 20:46176248-46176270 CAGGCTGGAGGCTGAGATATGGG - Intronic
1173990896 20:47302659-47302681 CAGGTTTGAGTCTTTGCTCTGGG - Intronic
1176516529 21:7788554-7788576 CAGGCTGGACTCAATCTTCTGGG + Intergenic
1178285849 21:31324760-31324782 CAGGCTGGAGACAAAGATTTTGG + Intronic
1178349119 21:31859146-31859168 CAAGCTGGAATGTATGATCTCGG + Intergenic
1178650557 21:34418566-34418588 CAGGCTGGACTCAATCTTCTGGG + Intergenic
1179137463 21:38692778-38692800 CAGGCTGGAGTTCATGATCTCGG - Intergenic
1179186618 21:39089830-39089852 GAGGCTGGAGTCCAGGATCAAGG - Intergenic
1179636427 21:42713943-42713965 CAGGCTGGAGTGCATGACCATGG + Intronic
1179708286 21:43194922-43194944 AAGGCTGGAGTCTGAGGTCTGGG + Intergenic
1180721481 22:17912076-17912098 CAGGCTGGAGTCTAGCTCCTGGG - Intronic
1180734317 22:18004310-18004332 CAGGCTGGAGTGCATGATCTCGG + Intronic
1180771401 22:18390177-18390199 CAGGAGGGAGGCTATGGTCTTGG - Intergenic
1180784654 22:18540066-18540088 GAGGCTGGAGTCCATCATCAGGG - Intergenic
1180925689 22:19552997-19553019 CAGGCTGGAGTGTGTGATCTCGG + Intergenic
1181062533 22:20288577-20288599 CAGGCTGGAGTGTGCGATCTCGG + Intergenic
1181128232 22:20714118-20714140 GAGGCTGGAGTCCATCATCAGGG - Intronic
1181156046 22:20921757-20921779 CAGGCTGGAGTGTGCGATCTCGG + Intronic
1181241557 22:21479423-21479445 GAGGCTGGAGTCCATCATCAGGG - Intergenic
1181565558 22:23734999-23735021 CAGGCTGGATTCTAGGCACTGGG + Intergenic
1182100540 22:27654688-27654710 CTGGCTGGAGTAGAGGATCTTGG - Intergenic
1182921972 22:34088560-34088582 TGTGCTGGAGTCTGTGATCTTGG + Intergenic
1183145777 22:35990223-35990245 CAGGCAGGAGTCAAGGGTCTAGG + Intronic
949766915 3:7536723-7536745 CAGCCTTGAGTCAGTGATCTTGG + Intronic
950626410 3:14250554-14250576 GAGGCTGAAGTCCATGATCAAGG - Intergenic
951909801 3:27737869-27737891 CAGGCTGGAGTGCGTGATCTTGG - Intergenic
954392011 3:50272791-50272813 CAGGCTGGAGTGCTCGATCTCGG - Intronic
954572868 3:51656792-51656814 CAGGCTGGAGTGCATGATCTTGG + Intronic
954968048 3:54628179-54628201 CAGGCTGGAGTGCACAATCTCGG - Intronic
955568151 3:60271999-60272021 CAGTTAGTAGTCTATGATCTTGG - Intronic
955754778 3:62216165-62216187 CAGGCTGGAGTGCATGATCTCGG - Intronic
955929082 3:64037665-64037687 CAGGCTGGAGTGCATGATCTCGG + Intergenic
956068757 3:65425023-65425045 CAGGCTGGAGTGCATGATCATGG - Intronic
956118253 3:65940363-65940385 GAGGCTGAAGTCTAAGATCAGGG + Intronic
956833240 3:73073992-73074014 CAGGCCGGAGTGCATGATCTCGG + Intergenic
956839846 3:73128461-73128483 CAGGCTGGAGTGCAGTATCTTGG + Intergenic
957409778 3:79824541-79824563 CAGCCTGGAGTCTATGGATTTGG + Intergenic
959631795 3:108515152-108515174 CAGGCTTCAGTATCTGATCTGGG + Intronic
960805509 3:121579783-121579805 CAGGCTGGTGTCTAACACCTGGG - Intronic
961694897 3:128697948-128697970 CAGGCTGGAGTGCGCGATCTCGG + Intergenic
961825466 3:129596886-129596908 CGGGCTGGATTCCATGAGCTGGG + Intronic
963273430 3:143307735-143307757 CAGGCTGGAGACCTTGATCCAGG - Intronic
966069809 3:175861978-175862000 CAGCCTGGCATCTGTGATCTGGG + Intergenic
967929538 3:194680822-194680844 CAGGCTGGAGTGCGTGATCTTGG - Intergenic
968019930 3:195376341-195376363 CAGGCTGGAGTGCGTGACCTTGG - Intronic
968126910 3:196166742-196166764 GAGGCTGGAGTGCACGATCTCGG - Intergenic
968624659 4:1621715-1621737 CAGGCTGGGGTCTCAGAGCTGGG - Intronic
969379564 4:6784982-6785004 CAGGCTGGAGTCCGCGATCTCGG + Intronic
970074482 4:12201991-12202013 CAGGCTGGAGTGTGTGATCTTGG + Intergenic
970629985 4:17930290-17930312 CAGGCTGGACTCAAACATCTGGG - Intronic
970952905 4:21776811-21776833 CAAGCTGGAGTATACAATCTCGG + Intronic
971107522 4:23542911-23542933 CAGGCTGGAGTGCACAATCTCGG - Intergenic
972194460 4:36636558-36636580 CAGTTTGGAGACTATAATCTGGG + Intergenic
972619491 4:40733238-40733260 CAGGCTGGAGTGCCTGATCTCGG + Intergenic
972699181 4:41477286-41477308 CAGGGTGGACTCTATGGGCTTGG + Intronic
973763698 4:54144497-54144519 TAGGCTGGAGTGCACGATCTTGG + Intronic
974498450 4:62664812-62664834 CAGGCTGGAGTGCACGATTTCGG + Intergenic
976074530 4:81282402-81282424 GAGGCTGAAGTCTAAGATCAAGG - Intergenic
976420964 4:84843443-84843465 CAGGCTGGAGTGCACGATCACGG + Intronic
977566328 4:98584149-98584171 CAGGCTGGAGTCTAGCTCCTGGG + Intronic
978134669 4:105243007-105243029 CTGGCATGAGTCTTTGATCTGGG - Intronic
980060999 4:128129302-128129324 CAGGCTGCAGTGTGTGACCTCGG - Intronic
980183568 4:129433413-129433435 CATGATAGAGTCTATGATGTAGG - Intergenic
981641121 4:146945058-146945080 CAGGCTGAAGTCTATAAGCCTGG - Exonic
986084023 5:4424850-4424872 CAGGCTGGAATCTAATATATGGG - Intergenic
986266644 5:6196775-6196797 GAGGCTGGAGTCCGAGATCTAGG - Intergenic
987245025 5:16040131-16040153 CAGGCTCTAGTTTTTGATCTTGG - Intergenic
987377906 5:17253775-17253797 CAGACTGGAATCTGTGATCAAGG + Intronic
987387329 5:17342485-17342507 GAGGCTGGAGTCCAAGATCAAGG + Intergenic
988123582 5:26999192-26999214 CAGGCTGGAGGGCATGATCTCGG - Intronic
988581612 5:32473583-32473605 CAGGCTGGAGTGGACAATCTGGG + Intergenic
989652933 5:43713651-43713673 CAGGCTGGAGTCAAACTTCTGGG + Intergenic
990256384 5:53975082-53975104 CAGGCTGGAGTAGAGGATGTTGG - Intronic
990609748 5:57445218-57445240 CATGTTGGAGTTTATGCTCTAGG + Intergenic
991554757 5:67882856-67882878 CAGGCTGGAGTGCAGCATCTTGG - Intergenic
992331853 5:75725189-75725211 CAAGATGGAGACTATGACCTGGG - Intergenic
994698247 5:103100149-103100171 CAGGCTAGAGTGCATGATCTTGG + Intronic
994946185 5:106395090-106395112 GAGGCTGGAGTGCACGATCTCGG + Intergenic
996631661 5:125640013-125640035 CAGGCTGCACCCTCTGATCTTGG - Intergenic
997076519 5:130685112-130685134 CAGGCTGGAGTGCAGTATCTTGG - Intergenic
998210350 5:140192462-140192484 CAGGCTTTAGTCTTTGATTTAGG + Intronic
1001390041 5:171371406-171371428 CAGACTGGAGTTGATGATCCAGG + Intergenic
1001963975 5:175897333-175897355 CAGAATGGAGGGTATGATCTTGG - Intergenic
1002068295 5:176663491-176663513 CAGGCTGGAGTGTATGATCTCGG - Intergenic
1002189316 5:177470509-177470531 CAGGCTGGAGGGTTTGAACTGGG - Intronic
1003329711 6:5119943-5119965 CAAGCTGGAGTGCATGATCTCGG + Intronic
1003638291 6:7854743-7854765 CAGGCTGGAGTGCGTCATCTTGG - Intronic
1004655670 6:17657511-17657533 CAGGCTGGAGTGCACGATCTTGG - Intronic
1004918391 6:20353667-20353689 CAGCCTGGATTCTAGGAGCTGGG + Intergenic
1005995641 6:30929657-30929679 CAGGCTGGAGTGCATGGTCTTGG + Intergenic
1006392790 6:33768670-33768692 CAGGCTGGACTGTATGAGATGGG - Intergenic
1006485249 6:34334586-34334608 CATGCTGGAGTGCACGATCTTGG - Intronic
1007219062 6:40264279-40264301 CAGGCTGGAGTTCATGCTCCTGG - Intergenic
1007476032 6:42120670-42120692 CAGGCTGGAGTGCACGATCTTGG + Intronic
1007634558 6:43290780-43290802 CAGGCTGGAGTCAATCTCCTGGG - Intergenic
1008369422 6:50715547-50715569 CTGGCAGGAGTCTTTGATCTGGG - Exonic
1008510481 6:52271220-52271242 GAGGCTTGAGTAGATGATCTGGG + Intronic
1008655592 6:53610049-53610071 CAGGCTGGAGTGCACGATTTTGG + Intronic
1008868187 6:56240386-56240408 GAGGCTGGAATCTAAGATCAAGG - Intronic
1010197808 6:73257447-73257469 CAGACTGGAGTACACGATCTCGG + Intronic
1013102673 6:106999814-106999836 CAGGCTAGAGTGTGCGATCTTGG - Intergenic
1015500083 6:133922766-133922788 CAGGCTGGAGTACACGATCTCGG + Intergenic
1016492477 6:144622231-144622253 CAGGCTGGAGTACACGATCTTGG + Intronic
1017828922 6:158106782-158106804 CAGGCTGGAGTGTGCAATCTCGG - Intergenic
1017863933 6:158425652-158425674 CAGGCTGGAGTGCACGATCTTGG + Intronic
1018068447 6:160140229-160140251 CAAGCTGGAGTGTGCGATCTCGG - Intronic
1019260729 7:80520-80542 CAGGCTGTCTTCTATGATCAAGG - Intergenic
1019608264 7:1921091-1921113 CAGGCAGGAGTGTGTCATCTGGG - Intronic
1020510588 7:9051671-9051693 CAGGCTGGCTACTATGGTCTGGG + Intergenic
1022905609 7:34852456-34852478 CAGGCTGGAGCAGAGGATCTTGG + Intronic
1023178510 7:37457115-37457137 CAGGCTGGAGTGCATGATTTTGG - Intergenic
1023935287 7:44735417-44735439 CAGGCTGGTGTCTAACACCTGGG - Intergenic
1024043383 7:45572075-45572097 CAGGCTGGAGTGTAAGATCATGG + Intergenic
1024952095 7:54874129-54874151 CAGGCTGGAATGCATGATCTTGG - Intergenic
1025946659 7:66109982-66110004 CAGCCTGGAGTGCACGATCTTGG + Intronic
1026877949 7:73890494-73890516 CAGGCTGGGGTCCTTGATCCTGG + Intergenic
1027006990 7:74703227-74703249 CAGGCTGGAGTACAGGATTTGGG + Intronic
1027988037 7:85320298-85320320 CAGGCTGGAGTGCATGAACTTGG + Intergenic
1028811856 7:95096872-95096894 CAGGCTGAAGTCTTTGCTTTCGG + Intronic
1029279862 7:99428688-99428710 CAGGCTGGAGTGAGCGATCTTGG - Intronic
1029475555 7:100781689-100781711 CAGGCTGGAGTCTATGATCTCGG + Intronic
1030087519 7:105829662-105829684 CATGCTGAAATCTATGATTTTGG - Intronic
1032431031 7:131861686-131861708 CAGGCTGGATTCTAAGAGCTGGG + Intergenic
1032525933 7:132578024-132578046 CTGGATGTAGTCTAGGATCTAGG - Intronic
1032696524 7:134341369-134341391 CAGGCTGGAGTGCATGATCTTGG - Intergenic
1033079756 7:138284307-138284329 CAAGCTGGAGTGTGTGATCATGG - Intergenic
1034072840 7:148203692-148203714 CAGGCTGGAGTACACGACCTTGG - Intronic
1034705829 7:153143208-153143230 CAGGCTGGAGTGCAGGATCTCGG + Intergenic
1034965939 7:155391006-155391028 CCTGCTGGAGTCTAAGATGTCGG + Intronic
1035021031 7:155800630-155800652 CAGGCTGGTGTTTACAATCTCGG - Exonic
1035239486 7:157520483-157520505 CTGGCTGCAGTCTTTGCTCTCGG + Intergenic
1035752295 8:2004631-2004653 GGGGCTGGAATTTATGATCTGGG + Exonic
1035771759 8:2153248-2153270 TAGGCTGGAGTGCATGATCTCGG + Intronic
1036760665 8:11506638-11506660 CAGGGTGGGGTCTAAGTTCTGGG + Intronic
1037355317 8:18013158-18013180 CTGCCTGGAGTGTATGAGCTTGG + Intronic
1037644840 8:20783855-20783877 CAGGCTGCAGTCTTCAATCTTGG - Intergenic
1037776408 8:21838675-21838697 CAGGCTGGTCTGTATCATCTGGG + Intergenic
1041292930 8:56324053-56324075 CAGGCTGGAGTGCGTGATCTCGG - Intergenic
1041345691 8:56895305-56895327 CAGGCTTGAGTGCATGATCCAGG + Intergenic
1041722379 8:60987877-60987899 CAGGCTGGAGGGCATGATCATGG - Intergenic
1042934209 8:74042471-74042493 CAGGCTGGAGTGAACGATCTCGG - Intergenic
1043331412 8:79122283-79122305 CAGGCTGGTGTTGATGAACTGGG - Intergenic
1044122316 8:88412823-88412845 CAGGGTGGAGGCTATATTCTAGG - Intergenic
1044421440 8:92000253-92000275 CAGGCTGGAGTGACTGATCTGGG - Intronic
1044592372 8:93926725-93926747 CTGGCTGGAGTGCATGATCTCGG + Intergenic
1046423256 8:114012033-114012055 CAGGCTGGAGTGCATGATCTTGG - Intergenic
1047282311 8:123456328-123456350 CAGGCTGGTGTGCACGATCTTGG + Intronic
1049143884 8:140983334-140983356 CAGGCTGAAGTGCATGATCTTGG - Intronic
1049331565 8:142056790-142056812 CAGGGTGAAGTCTGTGCTCTTGG + Intergenic
1049950610 9:640284-640306 TGGGCTGGAGTGTGTGATCTCGG + Intronic
1050103760 9:2144624-2144646 AGGATTGGAGTCTATGATCTAGG + Intronic
1051357565 9:16253747-16253769 CAGGCTGGGCTCTGTGCTCTGGG + Intronic
1051667936 9:19482943-19482965 CAGCCTGAAGTATGTGATCTTGG + Intergenic
1053175008 9:35916204-35916226 CAGGCTGGATTCTGGAATCTAGG + Intergenic
1054935853 9:70686868-70686890 CAGGCTGGAGTGCATGATCTTGG + Intronic
1056192992 9:84203132-84203154 CAGGCTGGAGTGTGTGATCTCGG - Intergenic
1056208463 9:84342461-84342483 CAGGCTGGAGTGCATGATCATGG + Intergenic
1056264482 9:84882812-84882834 CAGGCTGGAGTTCGCGATCTCGG + Intronic
1057981275 9:99666296-99666318 CAGGCTGGAGTTTGTCATCTTGG + Intergenic
1058463959 9:105209912-105209934 CAGGCTGGAGTGCACAATCTCGG + Intergenic
1058551490 9:106120112-106120134 CCTGCTGGAGTTTATGACCTAGG + Intergenic
1059915158 9:119091305-119091327 CAGGCTGGTGACTATGACCCAGG + Intergenic
1060246224 9:121948686-121948708 CAGGCTGGAGTTCAGGATCTGGG + Intronic
1061447324 9:130647618-130647640 CAGGCTGGAGTGCAGGGTCTCGG - Intergenic
1062330580 9:136042037-136042059 CAGGCTGGAGTGCACGATCTTGG + Intronic
1062362404 9:136194003-136194025 CTGGCTGGAGTCTCTGCCCTGGG + Intergenic
1185482486 X:458148-458170 CAGGCTGGAGTGCAAAATCTCGG - Intergenic
1185597927 X:1319336-1319358 CAGGCTGGAGTGCACGATCATGG + Intergenic
1185736733 X:2501160-2501182 CTGGCTGGAGTCTGTGGTCCTGG - Intronic
1186485366 X:9930460-9930482 CAGGCTGGAGTGCACAATCTGGG - Intronic
1187393629 X:18902184-18902206 GAGGCTGGAGTGTGCGATCTTGG + Intronic
1187912256 X:24121652-24121674 CAGGCTGGAGTGTGCGTTCTCGG - Intergenic
1189168394 X:38884825-38884847 CAAGCTGGAATGCATGATCTTGG + Intergenic
1189634777 X:42994972-42994994 CAGGTTGGAGTGCATGATCATGG - Intergenic
1189680067 X:43506604-43506626 GAGGCTGGAGTCTAAGATCAAGG - Intergenic
1190075600 X:47314757-47314779 TAGGCTGGAGTGCATGATCACGG - Intergenic
1190201154 X:48362461-48362483 CAGGATGGAGTGCACGATCTCGG + Intergenic
1190765042 X:53469138-53469160 CAGGCTGGAGTGCCTGATCTCGG + Intergenic
1190913690 X:54794290-54794312 CAGGCTGGAGGAAATGTTCTTGG - Intronic
1192048613 X:67702464-67702486 CAGGCTGCAAGGTATGATCTGGG - Intronic
1192108563 X:68340953-68340975 CAGGCTGGAGTGTGTGATCTCGG - Intronic
1194042204 X:88955467-88955489 CAGGTTTGAGTCTGTGAGCTTGG + Intergenic
1194768978 X:97877467-97877489 CAGGCTGGAGTGCACGATCTTGG + Intergenic
1195615843 X:106911305-106911327 CAGGATGGAAGCTATGTTCTGGG - Intronic
1195780793 X:108461643-108461665 CAGGCTGGATGGCATGATCTCGG + Intronic
1195934808 X:110114739-110114761 CAGGCTAGAGTTTTTGGTCTGGG - Intronic
1197737220 X:129860207-129860229 CAAGCTGGAGTGCATGATCTGGG - Intergenic
1198307150 X:135394467-135394489 CAGGCTGGAGTGCACAATCTCGG - Intergenic
1198910901 X:141613252-141613274 CAGGCTGGAGTGCACGATCTCGG + Intronic
1199769073 X:150962473-150962495 CAGGCTGGAGTGCTCGATCTCGG - Intergenic
1200272553 X:154699419-154699441 CAGGCTGGTGCCTCTGGTCTTGG - Exonic
1201589811 Y:15602801-15602823 CTGGCAGGAGTCTATGGTGTAGG - Intergenic
1202358260 Y:24074719-24074741 CAGCCTGAAGTCTAGGTTCTAGG + Intergenic
1202512518 Y:25595394-25595416 CAGCCTGAAGTCTAGGTTCTAGG - Intergenic