ID: 1029478356

View in Genome Browser
Species Human (GRCh38)
Location 7:100798618-100798640
Sequence TAGGGGAGACAGAAGGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029478349_1029478356 -3 Left 1029478349 7:100798598-100798620 CCCGGCGAGGCTGACATCACTAG No data
Right 1029478356 7:100798618-100798640 TAGGGGAGACAGAAGGAGCAGGG No data
1029478346_1029478356 21 Left 1029478346 7:100798574-100798596 CCACATGCGGGTGGCACATTCAG No data
Right 1029478356 7:100798618-100798640 TAGGGGAGACAGAAGGAGCAGGG No data
1029478350_1029478356 -4 Left 1029478350 7:100798599-100798621 CCGGCGAGGCTGACATCACTAGG No data
Right 1029478356 7:100798618-100798640 TAGGGGAGACAGAAGGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029478356 Original CRISPR TAGGGGAGACAGAAGGAGCA GGG Intergenic
No off target data available for this crispr