ID: 1029480262

View in Genome Browser
Species Human (GRCh38)
Location 7:100808000-100808022
Sequence AAGGCTCACCTGAGGGAGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 163}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029480262 Original CRISPR AAGGCTCACCTGAGGGAGTT GGG (reversed) Intronic
900439979 1:2649839-2649861 GATGCTCACCTGAGGGTGTGAGG - Intronic
900440052 1:2650290-2650312 GATGCTCACCTGAGGGTGTGGGG - Intronic
900454135 1:2765628-2765650 AATGCTCACCTGGGGGTGTGGGG - Intronic
900455582 1:2772890-2772912 AATGCTCACCTGGGGGTGTGGGG - Intronic
900906919 1:5565744-5565766 AAGGCTCAGCTGGTGAAGTTGGG - Intergenic
901226763 1:7617658-7617680 TAGGGTCACCTGAAGGACTTTGG + Intronic
901375421 1:8834928-8834950 GAGGATCACCTGAGCCAGTTAGG - Intergenic
905147273 1:35896739-35896761 AGAACTAACCTGAGGGAGTTAGG + Intronic
907514829 1:54986979-54987001 AAGGATCAGCTGAGCGAGTATGG - Intronic
912989641 1:114472638-114472660 GAGGATCACCTGAGGGTGTGAGG + Intronic
914764379 1:150625244-150625266 AAGGCTAACCTAACGTAGTTGGG - Intronic
915130594 1:153693135-153693157 AAGGCTGTCCTGGAGGAGTTTGG + Exonic
916078149 1:161215150-161215172 AAGGGCCAACTAAGGGAGTTGGG - Intergenic
916760747 1:167815163-167815185 GGGGCTCACCTGAAGGTGTTTGG - Intronic
917199638 1:172500995-172501017 AAGGCTTCCCTGAGGAAGTGGGG - Intergenic
917389563 1:174520111-174520133 AGGGCTCACCTCAGGCAGATTGG - Intronic
920033649 1:203051890-203051912 AGGGATCTCCTCAGGGAGTTTGG + Intronic
922028226 1:221773235-221773257 AAGGCTCACTTGATGGATATAGG - Intergenic
922919515 1:229290268-229290290 AAGGCCCACCTGAGGGCATGGGG + Intronic
924034153 1:239919057-239919079 AAGGGACACGTTAGGGAGTTGGG - Intergenic
1064778407 10:18805986-18806008 GAGGCTCCCCTGGGGAAGTTTGG - Intergenic
1067380808 10:45771462-45771484 AATGCTCAGCTGAGGGTGTTGGG - Intronic
1067888507 10:50112113-50112135 AATGCTCAGCTGAGGGTGTTGGG - Intronic
1076586270 10:131550122-131550144 AAGGCGCACCAGAGGGGCTTTGG - Intergenic
1076919026 10:133441763-133441785 AGGGCTCACCTGAGGCACTTAGG - Intergenic
1077663797 11:4091344-4091366 ACGGCTCATCTGAGGAGGTTTGG - Exonic
1078368545 11:10726323-10726345 AAGGCTCACCAGGAGGAGGTAGG - Intergenic
1078553697 11:12300450-12300472 AGGGCTCATCTGATTGAGTTAGG - Intronic
1080867887 11:36211714-36211736 AAACCTCACTTGTGGGAGTTGGG - Intronic
1082190967 11:49244458-49244480 AAGGCTTCCCTGAAGGAGTGAGG + Intergenic
1084792923 11:71486162-71486184 GAGGCTCACCTAAGGGAAGTGGG - Intronic
1085179259 11:74519896-74519918 AGGGCCAACCTAAGGGAGTTTGG - Intronic
1090409754 11:126499627-126499649 AACGCTCACGTTAGGGAGTGGGG + Intronic
1090971234 11:131644931-131644953 AAGGAGCACTTGATGGAGTTTGG - Intronic
1094293881 12:28881791-28881813 AATGGTCACCTGAGAGAGTTTGG - Intergenic
1097955175 12:65477835-65477857 AATGCTCAGCTGAGGGATTGAGG - Intronic
1101465083 12:104940341-104940363 AAGGCTCACCTGGGGGGGAGGGG + Intronic
1105042491 12:132971271-132971293 AAGGCTTAATGGAGGGAGTTTGG + Intergenic
1105898525 13:24738564-24738586 AAATCTCTCCTGAGGGAGTCAGG - Intergenic
1106469572 13:30042476-30042498 AGGGATCACCAGAGGGAGGTTGG - Intergenic
1108525978 13:51286409-51286431 AAGGCTGATCTAAGGGAGTCAGG - Intergenic
1110464296 13:75783230-75783252 AAGGCCCAGCTGAGGGAGCAGGG + Intronic
1112387105 13:98949911-98949933 GAGGAGCACCTGGGGGAGTTTGG - Intronic
1117410176 14:55443296-55443318 AAGGCTCACCTGATTAGGTTAGG - Intronic
1119160242 14:72446461-72446483 AAGGCCTTCCCGAGGGAGTTAGG + Intronic
1120393657 14:83940575-83940597 AAGGCTCATCTCAGGCATTTTGG - Intergenic
1121027240 14:90625578-90625600 TAGGCTCACCTGGCGGAGGTCGG - Intronic
1121443790 14:93965952-93965974 AAGGCTCCTCTGAGGAGGTTGGG - Intronic
1122118250 14:99538205-99538227 AAGGCTCACCTGCTGGTGGTGGG - Intronic
1122817675 14:104321543-104321565 AAGGCTCCCCAGAAGGAGTCTGG + Intergenic
1122892050 14:104736569-104736591 CAGGCTCAGCTGAGGGAGACGGG - Intronic
1124969629 15:34474223-34474245 ATGCCTCCCCTGAGTGAGTTAGG - Intergenic
1129867274 15:78918647-78918669 TAGCCTCCCCTGAGGGATTTAGG - Intergenic
1132651303 16:1022543-1022565 GAGCCCCACCTGAGGGAGTCTGG + Intergenic
1133122831 16:3621485-3621507 AAGCCTCTGATGAGGGAGTTTGG - Intronic
1133384915 16:5361765-5361787 CAGGCTCACCTGAGACAGCTGGG - Intergenic
1136343849 16:29663067-29663089 GGGGCTCACCTGAGGGAGGCAGG - Intronic
1137720225 16:50623341-50623363 AAGGCTCGCCTGAGGAGGATAGG + Intronic
1139960538 16:70715011-70715033 AAGGCTCCTCTCAGGGACTTGGG + Intronic
1140523554 16:75603076-75603098 CAGCATCACCTGAGGGAGTGTGG + Exonic
1140756537 16:78072385-78072407 AAAGCCTACCTGAAGGAGTTAGG + Intergenic
1140969209 16:79996784-79996806 AGGGCTCACCTGACTGAGTCAGG + Intergenic
1142413374 16:89927293-89927315 GAGGATCACCTGGGGGAGGTGGG + Intronic
1142944010 17:3409696-3409718 AAGACTCACTTGTGGTAGTTTGG - Intergenic
1146685326 17:34837576-34837598 AAGGCTGAGATGATGGAGTTTGG + Intergenic
1146754126 17:35411328-35411350 AAGGCTCACCTGATGGAAAATGG - Exonic
1147157624 17:38552192-38552214 AAGGCTGCTCTGAGGGAGGTGGG + Intronic
1147421663 17:40324904-40324926 AAGGATCACCTGAGGGTGGCTGG - Intronic
1149259664 17:54864953-54864975 AAGGAAAACCAGAGGGAGTTAGG - Intergenic
1151686220 17:75648269-75648291 AAGATTTACCTGAGGGAGTCAGG - Intronic
1152880171 17:82810046-82810068 AAAGCTCTACTGAGTGAGTTGGG + Intronic
1156029329 18:32693909-32693931 AAGGCACATCTGAGAGAATTGGG - Intronic
1158407502 18:57173187-57173209 AGGGGTCACCTGAGAGAGTGAGG + Intergenic
1158651743 18:59294472-59294494 AAGGCTCAACTGGGACAGTTTGG + Intronic
1161084127 19:2326264-2326286 AGGGCTCACCTGATGCAGTCAGG - Intronic
1162937444 19:13988322-13988344 AGGGCCCCCCTGAGGGAGTGCGG + Intronic
1164917112 19:32060700-32060722 AAGGCTCACCTGAGCCAGGGAGG + Intergenic
1165636747 19:37346829-37346851 AAGGCTTCCCTGAGGGAAGTAGG - Intronic
1166040263 19:40198166-40198188 CAGGCTCCCATGAGGGAGTAGGG - Intronic
1168332329 19:55577967-55577989 AAGGCTCACCTGCGCGGGCTGGG - Exonic
925112291 2:1346686-1346708 AAGGTGCACCTGAGGCAGTCGGG + Intronic
925756282 2:7135046-7135068 CAGGCGCACCTGAGAGAGGTGGG - Intergenic
926365524 2:12129694-12129716 AGAGCTGACCTGAGGCAGTTGGG - Intergenic
927462415 2:23310534-23310556 AAAGCTGACCTGAGGGAGACTGG - Intergenic
928554513 2:32409703-32409725 ATTGCTTACCTGAGGAAGTTTGG + Intronic
930835363 2:55787338-55787360 AATGTTTACCTGAGGGAGGTAGG - Intergenic
932144087 2:69304007-69304029 AAGGCTCATCTGAGGGAGGAGGG + Intergenic
933689566 2:85169173-85169195 AAGGCTGACCTGACCGAGTGAGG - Intronic
933857449 2:86429398-86429420 AGAGCTCACCTCAGGGAGTGGGG + Intergenic
935363687 2:102268336-102268358 AAGACACAGGTGAGGGAGTTGGG - Intergenic
935825465 2:106944223-106944245 AAGGCACACAGAAGGGAGTTCGG - Intergenic
937071502 2:119067184-119067206 AAGGCTCACCCCTGGGAGTCAGG + Intergenic
939511090 2:143105702-143105724 AAGGCTCATTTGGGGCAGTTAGG - Intronic
944469669 2:200039533-200039555 GTGGCTCAGCTGAGGGAATTTGG + Intergenic
1169254944 20:4090066-4090088 AAGCCTCACTTGAAAGAGTTTGG + Intergenic
1170628745 20:18050135-18050157 AAGGCCCACCAAAAGGAGTTGGG - Intronic
1172187674 20:33041426-33041448 TAGACTCACCCGAGGGACTTTGG + Intronic
1172190565 20:33059717-33059739 CAGGCTCACCTGAGAGGGTCAGG + Intronic
1173613690 20:44389026-44389048 GGGGCGCACCTGAGGGAGTGGGG - Intronic
1175295465 20:57905763-57905785 AAGGCTGACTTGTGGGAGATTGG - Intergenic
1175789228 20:61731235-61731257 GAGGGTCTCCTGAGGGATTTTGG + Intronic
1178432135 21:32526071-32526093 AAGGCCCAGCTGCAGGAGTTGGG - Intergenic
1178634800 21:34292784-34292806 AAGCCACACCTGAGGCAGTTTGG + Intergenic
1179912553 21:44457791-44457813 AGGGTTCACCAGAGGGAGCTTGG + Exonic
1182888332 22:33794974-33794996 AAGCATCCTCTGAGGGAGTTTGG - Intronic
1182994128 22:34797355-34797377 AAGGCTTTCCTGAGGAAGTATGG + Intergenic
1183527819 22:38334501-38334523 TAGACACCCCTGAGGGAGTTAGG + Intronic
1184131373 22:42518630-42518652 AAGGCTCTCCTGAGGAAGCGAGG - Intronic
1184141595 22:42580842-42580864 AAGGCTCTCCTGAGGAAGCGAGG - Intergenic
1185102343 22:48848085-48848107 GAGGCACACCTGTGGGAGGTGGG + Intronic
949399632 3:3652282-3652304 AAGGCTTCCCTGAGGAAGTGGGG - Intergenic
952567796 3:34679874-34679896 TAGTCTGACCTGAGGGGGTTGGG + Intergenic
952908209 3:38158077-38158099 AAAGCACACCTAAGGGGGTTTGG + Intergenic
954214349 3:49116172-49116194 AAGGCTGAACTCAGGGACTTAGG + Intronic
958266961 3:91449265-91449287 AAGGCTCAGCTCAGAGAGATGGG - Intergenic
964212515 3:154244369-154244391 AATGCTCACCAAAAGGAGTTGGG + Intronic
966190423 3:177267525-177267547 GTGGCTCACATGACGGAGTTTGG + Intergenic
966747863 3:183295578-183295600 GGGGGTCACCTGAGGGAGGTAGG - Intronic
971743806 4:30552722-30552744 AAGGCTAACCAGAGGGATATAGG - Intergenic
971916046 4:32871360-32871382 AAAGCTAACCTGAGAGTGTTGGG + Intergenic
973864066 4:55094289-55094311 AAGACTCGCCTGAGGAAGTATGG + Intronic
983327488 4:166275416-166275438 AATGCTCATCTGAGAAAGTTTGG + Intergenic
983839337 4:172437085-172437107 AAGGCACACATGAAGTAGTTGGG - Intronic
985816369 5:2131107-2131129 ATGGCCCAACTGAGGGATTTAGG - Intergenic
986059893 5:4178164-4178186 AGGGCTCACCTGATGAAGGTTGG + Intergenic
986209661 5:5659055-5659077 AAGGCACAGCTGAGGGCCTTTGG + Intergenic
987025910 5:13926188-13926210 AAGGAGCACCTGAGGGAGGATGG + Intronic
990104697 5:52244537-52244559 AAGGATCACCTGAGTGAGGCAGG - Intergenic
994718538 5:103352973-103352995 GAGGATCACCTGAGTGAGCTTGG + Intergenic
998480148 5:142456330-142456352 ATGGCTCACCTGATTGAGTTGGG + Intergenic
999658757 5:153836241-153836263 ATGGCTCACTTGTAGGAGTTGGG - Intergenic
999976151 5:156914008-156914030 AATGCTATCCAGAGGGAGTTTGG - Intergenic
1000477315 5:161727270-161727292 AAAGTTCAACTGAGGGAGGTGGG + Intergenic
1000704159 5:164490171-164490193 AGGGCTTAACAGAGGGAGTTTGG - Intergenic
1002477876 5:179479280-179479302 GCGGATCACCTGAGGGAGTTTGG - Intergenic
1003065536 6:2901667-2901689 CAGGCTCACCTGGAGGAGTCAGG - Intronic
1003086649 6:3065578-3065600 CAGGCTCACCTGGAGGAGTCAGG + Intronic
1003876660 6:10443647-10443669 AAGGGTTACCTTTGGGAGTTGGG + Intergenic
1005983582 6:30856170-30856192 AAGGGTCATCTGAAGGGGTTTGG - Intergenic
1006664760 6:35684682-35684704 AAGGTCCACCAGAGGGAGTGTGG - Intronic
1007493800 6:42245057-42245079 TAGAATCACCTGAGGGAGTGAGG + Intronic
1008186681 6:48401163-48401185 TTGGCTCACCTGCTGGAGTTGGG - Intergenic
1008988253 6:57572339-57572361 AAGGCTCAGCTCAGAGAGATGGG + Intronic
1009546884 6:65031759-65031781 AAGGCTCACATCAAAGAGTTAGG + Intronic
1011693999 6:89895641-89895663 GAGGCTCACCTGAGGGTTCTGGG - Exonic
1014256569 6:119166306-119166328 AGGGCCAACCTGAGGAAGTTTGG - Intergenic
1016827970 6:148405545-148405567 AAGGCTCACAGGAGTGAGGTGGG - Intronic
1019163725 6:170085737-170085759 CACGCTCACCTGATAGAGTTCGG - Intergenic
1019326042 7:438741-438763 AAGGCAGTCCTGAGGGAGATGGG - Intergenic
1019925242 7:4187180-4187202 AGGGGGCACCTGAGGGAGTGGGG + Intronic
1019994421 7:4714667-4714689 AAGGCTCATCTTAAGGATTTTGG + Intronic
1022115697 7:27258642-27258664 CAGGATCACCTGGGGGAGCTTGG - Intergenic
1026473951 7:70718122-70718144 AAGGCCCACCTGATGGGGTGGGG - Intronic
1029480262 7:100808000-100808022 AAGGCTCACCTGAGGGAGTTGGG - Intronic
1031552952 7:123137435-123137457 AGGGCTCACCTGATTAAGTTAGG - Intronic
1031673287 7:124578496-124578518 AGGGCTCACCTGATGAAGTCAGG - Intergenic
1035185277 7:157121406-157121428 AAGGCTCAACGGAGGCAGGTGGG + Intergenic
1049183196 8:141234111-141234133 ATCGCTCACCTGAGGGAGTGGGG + Intronic
1050104391 9:2150422-2150444 TAGTCTCACCTGATGGAGATGGG - Intronic
1051993451 9:23182662-23182684 GAGGCTCAGCTGAGGCAGTTTGG + Intergenic
1052857975 9:33418693-33418715 AGGGCTCCCCTGAGAGAGTAGGG + Intergenic
1058721857 9:107771719-107771741 AAGCCTCCCCTGATGGACTTGGG - Intergenic
1059745281 9:117194161-117194183 AAGGCCCACATGAGGGTTTTAGG - Intronic
1060998333 9:127887475-127887497 AGGGCTCACCTGCAGTAGTTGGG + Exonic
1185544846 X:935295-935317 AAGGTTGAACTGAGGGAGCTAGG + Intergenic
1186672585 X:11782089-11782111 AAGGATCTCCTAAGGCAGTTAGG + Intergenic
1187316124 X:18196812-18196834 AAGGGTGACCTGAGAGAGGTGGG + Intronic
1187354306 X:18552688-18552710 AAGGCTCCTCTGAGGAAGTGAGG + Intronic
1189869342 X:45366184-45366206 AAGGCTCACCTGATTAAGTCAGG - Intergenic
1191957982 X:66667008-66667030 AAGGCTCACCTCTGGGTATTGGG + Intergenic
1192194910 X:69021564-69021586 AAGGCTCATAAGAGGGAGTGGGG + Intergenic
1198954146 X:142108854-142108876 AAGTATCACATTAGGGAGTTAGG + Intergenic
1200961862 Y:9003263-9003285 AAGGCTCACCTGAAAGAATGAGG - Intergenic
1202578843 Y:26357279-26357301 AAGCATCACCTGTTGGAGTTTGG + Intergenic