ID: 1029484459

View in Genome Browser
Species Human (GRCh38)
Location 7:100830933-100830955
Sequence ACCCACGTTCTGTAATTTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 55}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029484459 Original CRISPR ACCCACGTTCTGTAATTTAG TGG (reversed) Intronic
907207831 1:52790209-52790231 ATCTACTTTCTTTAATTTAGTGG + Intronic
909357930 1:74730690-74730712 ACCCAAGTCCTGTAATTAAATGG + Intronic
1063606529 10:7527344-7527366 CCCCACTTTCTGCTATTTAGGGG + Intergenic
1069293963 10:66820284-66820306 ATCCACTTTCTGTACTTTATAGG - Intronic
1072866642 10:99068849-99068871 ACCCAAGTTGTCTAATTTATTGG - Intronic
1079707926 11:23644636-23644658 AGCCACATTCTCAAATTTAGTGG + Intergenic
1092712041 12:11349189-11349211 TTCCATCTTCTGTAATTTAGTGG + Intergenic
1099087705 12:78265976-78265998 ATCCAAGTTCTGTAACTTATTGG + Intergenic
1100133676 12:91527361-91527383 ACCCAAATTCTGTGATTCAGTGG - Intergenic
1107920975 13:45207038-45207060 ACACACGGTCTTTGATTTAGTGG + Intronic
1111684752 13:91488215-91488237 ACTGATGTTCTGTATTTTAGGGG + Intronic
1123027356 14:105432993-105433015 AACCCCGTGCTGTAATATAGGGG + Intronic
1124806561 15:32889693-32889715 ACCCACGTGCTGGAGGTTAGGGG - Intronic
1131201030 15:90396088-90396110 TGTCACTTTCTGTAATTTAGAGG + Intronic
1133185670 16:4096144-4096166 ACACACGCCCTGCAATTTAGTGG + Intronic
1135947713 16:26879478-26879500 ACTCACTTTCTGTCATTTATTGG - Intergenic
1137798865 16:51244389-51244411 AACAAGGTTTTGTAATTTAGGGG + Intergenic
1137821046 16:51446267-51446289 ACCCTGGTCCTGTAATCTAGAGG - Intergenic
1142302358 16:89266093-89266115 ACCAAAGTTCTGTGATTGAGGGG + Intergenic
1148922022 17:51045732-51045754 AGCCATCTTCTGTATTTTAGAGG - Intronic
1149705569 17:58691788-58691810 CCCGAAGTTCTGTAATTTAGAGG + Intronic
1150986567 17:70204653-70204675 CCCCACGGTCTTTCATTTAGTGG + Intergenic
1152320496 17:79606359-79606381 ATCCACCATCTTTAATTTAGGGG - Intergenic
1156883278 18:42105852-42105874 AACCATGTTCTGTGATTTAAAGG - Intergenic
1159011743 18:63064517-63064539 AAAAACATTCTGTAATTTAGTGG + Intergenic
1159593008 18:70355153-70355175 TTCCACTTTCTGTCATTTAGTGG - Intergenic
1164503655 19:28840329-28840351 ACCCTGGTTCTGTGATTTACTGG + Intergenic
1167389773 19:49187150-49187172 ACCCTCTTACTGAAATTTAGTGG + Intronic
925862472 2:8193333-8193355 GGCCATGTTCTGGAATTTAGTGG - Intergenic
928910027 2:36410571-36410593 GCCCATGTTCTGTTATTAAGAGG + Intronic
930326824 2:49930368-49930390 ACACACACTCTGTATTTTAGAGG - Intronic
942188138 2:173444281-173444303 ACACAGGCTCTGTATTTTAGAGG - Intergenic
945065736 2:205946402-205946424 AGCCACATCCTGTAACTTAGGGG - Intergenic
947077248 2:226358520-226358542 ACCCCCATTCTGTACTGTAGAGG - Intergenic
947779642 2:232746635-232746657 CCCCAAGTTCTGTTCTTTAGAGG + Intronic
1178012133 21:28300889-28300911 TCCCATGTCCTGTATTTTAGTGG - Intergenic
1181837501 22:25622891-25622913 ACATAGTTTCTGTAATTTAGGGG + Intronic
949858702 3:8485950-8485972 ACCCACTATCTATAATATAGTGG - Intergenic
971352654 4:25866898-25866920 ACCCACCTCCTGTAATCTGGAGG - Intronic
971591689 4:28476882-28476904 ACCCAAGTTCTGACATTTACTGG + Intergenic
975394990 4:73864254-73864276 ACTCAAGCTCTGTATTTTAGGGG - Intergenic
975999637 4:80358302-80358324 ACATACGTTCTGTTATTTTGGGG + Intronic
978011628 4:103692559-103692581 ACCAACTTTCTGTAATTAAGAGG + Intronic
989187953 5:38643055-38643077 ATCCTGGTTCTGTCATTTAGGGG + Intergenic
994581122 5:101643107-101643129 ACACACTTTCTGTGATTTCGTGG + Intergenic
995705180 5:114981394-114981416 TCACACTTTCTGTAATTTAGGGG + Intergenic
999852811 5:155561033-155561055 ACCCACTTTGTGTGATTTCGGGG - Intergenic
1011971704 6:93233088-93233110 ACCCACCTCCTGTAACCTAGAGG + Intergenic
1021802542 7:24321788-24321810 ATCCATTTACTGTAATTTAGTGG - Intergenic
1022451673 7:30521941-30521963 AACCACATTCTATTATTTAGAGG + Intronic
1028824259 7:95251456-95251478 ACCCACATTGGGTAATTTAGTGG - Intronic
1029484459 7:100830933-100830955 ACCCACGTTCTGTAATTTAGTGG - Intronic
1037943249 8:22970559-22970581 ACCCAGGTTCTGAAATGCAGTGG - Intronic
1039870252 8:41539969-41539991 GTCCACCTTCTGTAAGTTAGGGG - Exonic
1042418246 8:68552638-68552660 ATCCTTGTACTGTAATTTAGGGG + Intronic
1047614489 8:126552038-126552060 ACCCATTTTCTGTAATTATGTGG + Intergenic
1052124043 9:24754052-24754074 AGCCACTCTCTGTCATTTAGAGG - Intergenic
1061762978 9:132863215-132863237 CCCCATGTTCTGTACCTTAGAGG - Intronic
1188538302 X:31221262-31221284 ACCCAAGTTAAGGAATTTAGAGG - Intronic
1197276775 X:124488682-124488704 ACACTCATTCTATAATTTAGAGG - Intronic