ID: 1029485653

View in Genome Browser
Species Human (GRCh38)
Location 7:100838398-100838420
Sequence GGCCCTAGTGGGGCACGCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029485643_1029485653 25 Left 1029485643 7:100838350-100838372 CCAGAAGACCTAAAAGAGGTTCT 0: 1
1: 0
2: 0
3: 20
4: 148
Right 1029485653 7:100838398-100838420 GGCCCTAGTGGGGCACGCGCAGG No data
1029485645_1029485653 17 Left 1029485645 7:100838358-100838380 CCTAAAAGAGGTTCTGGAGTTGT 0: 1
1: 0
2: 0
3: 14
4: 341
Right 1029485653 7:100838398-100838420 GGCCCTAGTGGGGCACGCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029485653 Original CRISPR GGCCCTAGTGGGGCACGCGC AGG Intronic
No off target data available for this crispr