ID: 1029488795

View in Genome Browser
Species Human (GRCh38)
Location 7:100859110-100859132
Sequence AAGCAGGACATAGACGAAGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 194}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029488795_1029488802 19 Left 1029488795 7:100859110-100859132 CCTTCTTCGTCTATGTCCTGCTT 0: 1
1: 0
2: 0
3: 13
4: 194
Right 1029488802 7:100859152-100859174 CTTGTGACAGGTGTCTGGGGAGG 0: 1
1: 1
2: 8
3: 52
4: 318
1029488795_1029488800 15 Left 1029488795 7:100859110-100859132 CCTTCTTCGTCTATGTCCTGCTT 0: 1
1: 0
2: 0
3: 13
4: 194
Right 1029488800 7:100859148-100859170 TTCACTTGTGACAGGTGTCTGGG 0: 1
1: 0
2: 4
3: 23
4: 135
1029488795_1029488806 26 Left 1029488795 7:100859110-100859132 CCTTCTTCGTCTATGTCCTGCTT 0: 1
1: 0
2: 0
3: 13
4: 194
Right 1029488806 7:100859159-100859181 CAGGTGTCTGGGGAGGGATGGGG 0: 1
1: 1
2: 9
3: 130
4: 1046
1029488795_1029488808 30 Left 1029488795 7:100859110-100859132 CCTTCTTCGTCTATGTCCTGCTT 0: 1
1: 0
2: 0
3: 13
4: 194
Right 1029488808 7:100859163-100859185 TGTCTGGGGAGGGATGGGGGTGG 0: 1
1: 1
2: 14
3: 166
4: 1616
1029488795_1029488804 24 Left 1029488795 7:100859110-100859132 CCTTCTTCGTCTATGTCCTGCTT 0: 1
1: 0
2: 0
3: 13
4: 194
Right 1029488804 7:100859157-100859179 GACAGGTGTCTGGGGAGGGATGG 0: 1
1: 0
2: 7
3: 87
4: 743
1029488795_1029488801 16 Left 1029488795 7:100859110-100859132 CCTTCTTCGTCTATGTCCTGCTT 0: 1
1: 0
2: 0
3: 13
4: 194
Right 1029488801 7:100859149-100859171 TCACTTGTGACAGGTGTCTGGGG 0: 1
1: 0
2: 1
3: 27
4: 225
1029488795_1029488805 25 Left 1029488795 7:100859110-100859132 CCTTCTTCGTCTATGTCCTGCTT 0: 1
1: 0
2: 0
3: 13
4: 194
Right 1029488805 7:100859158-100859180 ACAGGTGTCTGGGGAGGGATGGG 0: 1
1: 0
2: 3
3: 47
4: 440
1029488795_1029488799 14 Left 1029488795 7:100859110-100859132 CCTTCTTCGTCTATGTCCTGCTT 0: 1
1: 0
2: 0
3: 13
4: 194
Right 1029488799 7:100859147-100859169 CTTCACTTGTGACAGGTGTCTGG 0: 1
1: 0
2: 2
3: 19
4: 132
1029488795_1029488803 20 Left 1029488795 7:100859110-100859132 CCTTCTTCGTCTATGTCCTGCTT 0: 1
1: 0
2: 0
3: 13
4: 194
Right 1029488803 7:100859153-100859175 TTGTGACAGGTGTCTGGGGAGGG 0: 1
1: 0
2: 7
3: 48
4: 425
1029488795_1029488807 27 Left 1029488795 7:100859110-100859132 CCTTCTTCGTCTATGTCCTGCTT 0: 1
1: 0
2: 0
3: 13
4: 194
Right 1029488807 7:100859160-100859182 AGGTGTCTGGGGAGGGATGGGGG 0: 1
1: 1
2: 50
3: 151
4: 993
1029488795_1029488797 7 Left 1029488795 7:100859110-100859132 CCTTCTTCGTCTATGTCCTGCTT 0: 1
1: 0
2: 0
3: 13
4: 194
Right 1029488797 7:100859140-100859162 TCTCCAGCTTCACTTGTGACAGG 0: 1
1: 0
2: 1
3: 13
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029488795 Original CRISPR AAGCAGGACATAGACGAAGA AGG (reversed) Exonic