ID: 1029488795

View in Genome Browser
Species Human (GRCh38)
Location 7:100859110-100859132
Sequence AAGCAGGACATAGACGAAGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 194}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029488795_1029488804 24 Left 1029488795 7:100859110-100859132 CCTTCTTCGTCTATGTCCTGCTT 0: 1
1: 0
2: 0
3: 13
4: 194
Right 1029488804 7:100859157-100859179 GACAGGTGTCTGGGGAGGGATGG 0: 1
1: 0
2: 7
3: 87
4: 743
1029488795_1029488803 20 Left 1029488795 7:100859110-100859132 CCTTCTTCGTCTATGTCCTGCTT 0: 1
1: 0
2: 0
3: 13
4: 194
Right 1029488803 7:100859153-100859175 TTGTGACAGGTGTCTGGGGAGGG 0: 1
1: 0
2: 7
3: 48
4: 425
1029488795_1029488807 27 Left 1029488795 7:100859110-100859132 CCTTCTTCGTCTATGTCCTGCTT 0: 1
1: 0
2: 0
3: 13
4: 194
Right 1029488807 7:100859160-100859182 AGGTGTCTGGGGAGGGATGGGGG 0: 1
1: 1
2: 50
3: 151
4: 993
1029488795_1029488800 15 Left 1029488795 7:100859110-100859132 CCTTCTTCGTCTATGTCCTGCTT 0: 1
1: 0
2: 0
3: 13
4: 194
Right 1029488800 7:100859148-100859170 TTCACTTGTGACAGGTGTCTGGG 0: 1
1: 0
2: 4
3: 23
4: 135
1029488795_1029488802 19 Left 1029488795 7:100859110-100859132 CCTTCTTCGTCTATGTCCTGCTT 0: 1
1: 0
2: 0
3: 13
4: 194
Right 1029488802 7:100859152-100859174 CTTGTGACAGGTGTCTGGGGAGG 0: 1
1: 1
2: 8
3: 52
4: 318
1029488795_1029488808 30 Left 1029488795 7:100859110-100859132 CCTTCTTCGTCTATGTCCTGCTT 0: 1
1: 0
2: 0
3: 13
4: 194
Right 1029488808 7:100859163-100859185 TGTCTGGGGAGGGATGGGGGTGG 0: 1
1: 1
2: 14
3: 166
4: 1616
1029488795_1029488806 26 Left 1029488795 7:100859110-100859132 CCTTCTTCGTCTATGTCCTGCTT 0: 1
1: 0
2: 0
3: 13
4: 194
Right 1029488806 7:100859159-100859181 CAGGTGTCTGGGGAGGGATGGGG 0: 1
1: 1
2: 9
3: 130
4: 1046
1029488795_1029488799 14 Left 1029488795 7:100859110-100859132 CCTTCTTCGTCTATGTCCTGCTT 0: 1
1: 0
2: 0
3: 13
4: 194
Right 1029488799 7:100859147-100859169 CTTCACTTGTGACAGGTGTCTGG 0: 1
1: 0
2: 2
3: 19
4: 132
1029488795_1029488805 25 Left 1029488795 7:100859110-100859132 CCTTCTTCGTCTATGTCCTGCTT 0: 1
1: 0
2: 0
3: 13
4: 194
Right 1029488805 7:100859158-100859180 ACAGGTGTCTGGGGAGGGATGGG 0: 1
1: 0
2: 3
3: 47
4: 440
1029488795_1029488797 7 Left 1029488795 7:100859110-100859132 CCTTCTTCGTCTATGTCCTGCTT 0: 1
1: 0
2: 0
3: 13
4: 194
Right 1029488797 7:100859140-100859162 TCTCCAGCTTCACTTGTGACAGG 0: 1
1: 0
2: 1
3: 13
4: 122
1029488795_1029488801 16 Left 1029488795 7:100859110-100859132 CCTTCTTCGTCTATGTCCTGCTT 0: 1
1: 0
2: 0
3: 13
4: 194
Right 1029488801 7:100859149-100859171 TCACTTGTGACAGGTGTCTGGGG 0: 1
1: 0
2: 1
3: 27
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029488795 Original CRISPR AAGCAGGACATAGACGAAGA AGG (reversed) Exonic
901337121 1:8460040-8460062 AAGGAGGACAATGACAAAGAGGG - Intronic
902139908 1:14344649-14344671 AAGGAGGCCAGAGACTAAGAGGG + Intergenic
904848831 1:33441526-33441548 AAGGAGGAGAAAGAGGAAGAAGG - Intergenic
906649710 1:47503902-47503924 AGGCAGGCCATAGAGGAAGGAGG + Intergenic
908674294 1:66585097-66585119 GAGCAGGAGATAGACCCAGAGGG - Intronic
908739908 1:67316842-67316864 AAGAAGGACATAAAAGAGGAGGG - Intronic
908964257 1:69738907-69738929 AAACAGGACCTAGAAAAAGATGG + Intronic
909152163 1:72020922-72020944 AAGCAGGACATAAACAAAATAGG + Intronic
909760581 1:79281164-79281186 ATGCCGAACATAGAAGAAGAAGG + Intergenic
911210983 1:95137669-95137691 AAGAAGGACAGAGAGGAAGAAGG - Intronic
915056002 1:153131454-153131476 AATCAGGAGATAAACCAAGAAGG + Intergenic
915226362 1:154414624-154414646 AAGCAGGATGTCGATGAAGACGG + Intronic
917391115 1:174538238-174538260 AAGCAGGAGAAAGCCTAAGAGGG - Intronic
918443161 1:184588918-184588940 AAGCAGGACTGAGAAGAAGCCGG - Intronic
921265719 1:213419085-213419107 CAGGGGGACATAGAGGAAGAAGG - Intergenic
924735721 1:246754002-246754024 AAGCAAGACAGGGACCAAGAAGG - Intronic
924947449 1:248855951-248855973 AAGGAGAACAAAGAGGAAGATGG + Intronic
1063357871 10:5417986-5418008 AAGCAGGACTTATACCAGGAAGG - Intronic
1064612226 10:17115324-17115346 AAGTAGGACATAGGCGAGGAGGG - Intronic
1068724810 10:60289243-60289265 AGGCAGGGCATAGATGAAAAAGG - Intronic
1069531512 10:69222924-69222946 AGGAAGCACAGAGACGAAGAAGG - Intronic
1070369121 10:75765152-75765174 AAGCAGGAAATAAATGAAGCTGG - Intronic
1074359870 10:112817000-112817022 AAGCAGGACAGAGAAGGAGCAGG + Exonic
1075081073 10:119384258-119384280 CAGCAGGAGAGAGAGGAAGAGGG - Intronic
1080306917 11:30846490-30846512 AAGCAGGACATAGATTTATAAGG + Intronic
1081757724 11:45556588-45556610 AAGCAGGACAGAGCCGGGGAGGG - Intergenic
1081853785 11:46291313-46291335 ATGCAGGACATATAGGAGGAAGG - Intronic
1083296982 11:61720220-61720242 ATGCAGGAGAAAGAGGAAGATGG - Exonic
1085302744 11:75467916-75467938 GAACAGGACAGAGACAAAGAAGG - Intronic
1085810601 11:79677644-79677666 AAGGAGGATAGAGAAGAAGAAGG - Intergenic
1086416784 11:86596875-86596897 AACCAGGTCATAGATGATGATGG + Intronic
1086615349 11:88811196-88811218 CAGCAGGACAGAGACTAAGCTGG + Intronic
1087150909 11:94858759-94858781 GAGCATGACACAGAAGAAGATGG - Intronic
1088125232 11:106416294-106416316 AAGCAAGTCAAAGACAAAGAGGG + Intergenic
1088389967 11:109303344-109303366 AGGGAGAACATAGATGAAGAGGG - Intergenic
1088448351 11:109955570-109955592 AAGCAGGACAAAAAGGAGGAGGG + Intergenic
1088888839 11:114029230-114029252 AAGCAAGACATAGAGGCAAAAGG - Intergenic
1090597444 11:128334881-128334903 AAACAGGACATGGAGGAAGTTGG - Intergenic
1091037561 11:132247188-132247210 GAGCTGGACATACACGCAGATGG - Intronic
1092217249 12:6692149-6692171 AAGGAGGACATTTAGGAAGAGGG + Intergenic
1095196858 12:39329455-39329477 AAGGAGGAGAAAGATGAAGAAGG + Intronic
1095355794 12:41273240-41273262 AAGAAGGAAATAGACATAGAAGG + Intronic
1095984241 12:47988961-47988983 AAGGTGGACAGAGAAGAAGACGG - Intronic
1096328444 12:50687580-50687602 TTGCAGGACATAGATGAAGCTGG + Intronic
1096817595 12:54211145-54211167 AAGCAGGTCATAAACAAAGCGGG + Intergenic
1098178227 12:67816309-67816331 AAGCAGGACAAACATAAAGAAGG - Intergenic
1098495915 12:71135457-71135479 AAGCAGGAGAAAAAAGAAGAAGG + Intronic
1100527310 12:95431855-95431877 GAGAAGGACAAAGACGGAGAAGG + Intergenic
1107054426 13:36087863-36087885 AAGGTGGTCAGAGACGAAGAGGG + Intronic
1107364069 13:39651287-39651309 AAGCAGGAGAGAAAAGAAGAAGG - Intergenic
1107631129 13:42343794-42343816 AAGCAGGAGAAAGACCAAAAGGG - Intergenic
1108521171 13:51248218-51248240 AAATAGGAAATAGAGGAAGAAGG - Intronic
1110412599 13:75220442-75220464 AAGCTGGACACAGAGGAAGATGG - Intergenic
1113090317 13:106611223-106611245 AAGCAGTACATACATGAAAAAGG + Intergenic
1113784225 13:112994037-112994059 AATCAGGAAAAAGACGAAGGCGG - Intronic
1115833716 14:37373681-37373703 TTGCAGGACATGGACGAAGTTGG - Intronic
1116810571 14:49536151-49536173 AAACAAAAGATAGACGAAGAAGG + Intergenic
1119355405 14:74001930-74001952 AAAGAGGATATAGAAGAAGAGGG + Intronic
1121404099 14:93708338-93708360 AAGCATGACTGAGACGGAGAAGG - Intergenic
1121427405 14:93862335-93862357 TAGAAGGAGATAGACCAAGAAGG - Intergenic
1121712774 14:96051839-96051861 AAGGATGACAAAGACGATGAAGG - Intronic
1121983005 14:98471101-98471123 AAAGAGGAGATAGAGGAAGAAGG - Intergenic
1122679304 14:103445355-103445377 AAGCAGGACAGGGAGGAAGCAGG - Intronic
1124020178 15:25913851-25913873 AAGCAGGATTTGGAAGAAGAAGG - Intergenic
1125430902 15:39592610-39592632 AATCAGGATATTGATGAAGATGG + Exonic
1132700108 16:1218688-1218710 AAGCAGGACAGGGAGGAAGATGG + Intronic
1133675288 16:8065332-8065354 AAGCAGGTCAGAGACCAAGCTGG - Intergenic
1134243789 16:12524832-12524854 GAGCAGTACTTACACGAAGAAGG - Exonic
1139001854 16:62520242-62520264 AAGCAGAATATAGACTAGGAGGG + Intergenic
1139271637 16:65689246-65689268 AGCCAGGACACAGAGGAAGAAGG + Intergenic
1141382068 16:83585653-83585675 AAGCAGGATATCCAAGAAGAAGG + Intronic
1141756235 16:85992934-85992956 AAGAAGGACAGAAAGGAAGAAGG - Intergenic
1145246622 17:21273838-21273860 CAGCAGGAGATAAACAAAGAGGG + Intergenic
1145846139 17:28041091-28041113 GGGCGGGACCTAGACGAAGAAGG - Intergenic
1146165522 17:30585282-30585304 AAGCAAGACAGAGAGAAAGAAGG + Intergenic
1147816708 17:43215835-43215857 AAACAGGAAAAAGACGATGAAGG - Exonic
1149197223 17:54135708-54135730 AAGCTGCACACAGATGAAGAGGG - Intergenic
1150905635 17:69333823-69333845 AAGCAGCACAGAGTCAAAGAAGG - Intergenic
1153850954 18:9093815-9093837 AAGGAGGAGAAAGAAGAAGAAGG - Intergenic
1157790030 18:50523445-50523467 AAGGAGGACAAGGACGAAAAGGG - Intergenic
1159099067 18:63938279-63938301 AAGCTGGACAAAGAAAAAGAAGG - Intergenic
1159271236 18:66153804-66153826 AAGAAGAAGAAAGACGAAGAAGG + Intergenic
1162689835 19:12420163-12420185 AAGTTGGACATAGAGGCAGATGG + Intronic
1163289072 19:16366874-16366896 AAGCAGGAACTAGACCTAGAAGG - Intronic
1164843153 19:31409730-31409752 AAGCAGGACATGGCAGAGGAAGG - Intergenic
1166500939 19:43340825-43340847 AATCAGAACAGAGACAAAGAGGG - Intergenic
1166509158 19:43392625-43392647 AATCAGAACAGAGACAAAGAGGG + Intergenic
1166954287 19:46452668-46452690 AAGCTGGACAAAGACGAGGCGGG + Intergenic
1167866382 19:52332000-52332022 TATGAGGACATAAACGAAGAAGG + Intergenic
926881387 2:17548297-17548319 GGGCAGGAAATAGAGGAAGAAGG - Intronic
927226931 2:20776259-20776281 AAACAGGACTTAGACTAAAAGGG - Intronic
928623296 2:33113385-33113407 AAGCAGGAAAGAGATGAGGATGG + Intronic
930597184 2:53403105-53403127 AAGCAGGGGATAGATGATGAGGG - Intergenic
931087334 2:58847401-58847423 AAGGAGGACAGAGATGAAGGTGG - Intergenic
933031673 2:77336126-77336148 AAGAAGGACAGAAACAAAGAAGG + Intronic
933917853 2:87014591-87014613 CAGCAGGACAAAGGTGAAGAGGG + Intronic
934005142 2:87755323-87755345 CAGCAGGACAAAGGTGAAGAGGG - Intronic
934506180 2:94896583-94896605 AAGCAGTACGTAGACCAAGAGGG + Intergenic
935531688 2:104240457-104240479 AAGAAGGAAAAAGAAGAAGAAGG + Intergenic
935768099 2:106389415-106389437 CAGCAGGACAAAGGTGAAGAGGG - Intergenic
937063037 2:118994351-118994373 AAGCAAGAGACAGAGGAAGAAGG - Intronic
938761317 2:134428914-134428936 AAGCAGGACAAAGCCAAGGAGGG + Intronic
941242214 2:163053555-163053577 AAGGAGGAGAAAGATGAAGAAGG + Intergenic
942559424 2:177204620-177204642 CAGCAGGACACAAACGAACAAGG + Intergenic
947557940 2:231113891-231113913 AGGCAGGACATAGAACAAGTGGG + Exonic
948745876 2:240093729-240093751 AAGCAAGACACAGACGTACACGG + Intergenic
948840220 2:240645116-240645138 AAACAGGACATGGAAGCAGAAGG - Intergenic
1169342578 20:4807719-4807741 AGTCAGGCCATAGACAAAGATGG - Intronic
1169606394 20:7324418-7324440 AAGCAAGACAGAGAGAAAGAAGG - Intergenic
1169824336 20:9750321-9750343 AAGCATAACATTGACGAAGGAGG + Intronic
1172390028 20:34559830-34559852 GAGCAGGAGAAAGACGAGGACGG + Exonic
1175392609 20:58636570-58636592 AAGCATTTCAGAGACGAAGAGGG + Intergenic
1175537962 20:59728699-59728721 AGGCAGGACAGAGATTAAGACGG - Intronic
1175922870 20:62458266-62458288 AGGCTGGACATAGAGGAAGGAGG + Intergenic
1176110361 20:63408072-63408094 AAGGAGGACAGAGAGGAGGAAGG + Intronic
1176980223 21:15373363-15373385 CAGCAGGGCATAGGAGAAGAAGG - Intergenic
1177264190 21:18762918-18762940 AAGCAGGATATAGTCTAAAAAGG - Intergenic
1178150310 21:29786556-29786578 AAGCTGGACAGACACCAAGAAGG - Intronic
1178793354 21:35721048-35721070 AAATAGGACATAGACGTAGAGGG - Intronic
1178923579 21:36756920-36756942 AAGAAGGACAAAAAGGAAGATGG - Intronic
1179239972 21:39581373-39581395 AGGCAGGACATAGAGGCAGCAGG - Intronic
1183771436 22:39929540-39929562 AAGGAGGACAAAGATGCAGAAGG - Intronic
1184939464 22:47751030-47751052 GAGCAGAACACAGACGAAGTAGG + Intergenic
1185030125 22:48438322-48438344 CCGCAGGCCATAGAAGAAGACGG + Intergenic
950693197 3:14677386-14677408 AAGCAGGACAGGGAGGAAAAGGG - Intronic
951116910 3:18874409-18874431 TAGCAGGAACTACACGAAGAAGG + Intergenic
953266492 3:41394262-41394284 CAGAAGGACAAAGAGGAAGACGG + Intronic
953823418 3:46229880-46229902 AAGCAGGACAGAGAGGGAGGAGG + Intronic
957764127 3:84599573-84599595 AAGGAGGACATAGCCCAAGAAGG + Intergenic
959628549 3:108481913-108481935 AAGCAGGACATGGTGGAACAAGG + Intronic
962061037 3:131927809-131927831 TAGCAGGACATAGAAGTAGCTGG + Intronic
962149735 3:132880143-132880165 AAGAAGGACATACACCCAGAAGG - Intergenic
963088973 3:141464181-141464203 AAGCAGAACAAAGAAGAAGGTGG - Intergenic
964781162 3:160339685-160339707 AAGCAAAACATAGAAGAAAATGG + Intronic
965039516 3:163488623-163488645 GAGCAGGAGAAAGAGGAAGAAGG + Intergenic
966034959 3:175400414-175400436 AAGAAGGACACAGACAAACATGG - Intronic
967758025 3:193192269-193192291 AAGCAAGTCATAGACAAATATGG - Intergenic
969360587 4:6660804-6660826 GAGGAGGAGATAGAAGAAGAAGG + Intergenic
970815643 4:20152723-20152745 AAGCAGGGCACAGAGGCAGATGG + Intergenic
971735918 4:30452007-30452029 AAGCAGGAGAGAGAGGGAGAGGG - Intergenic
973608868 4:52614336-52614358 AAGCAGGATAAATACAAAGAAGG + Intronic
974331812 4:60489451-60489473 AAGAAGGACCTAGACAGAGAGGG - Intergenic
974556839 4:63461644-63461666 AAGCAGGAGAGAGAAGGAGAAGG + Intergenic
976657366 4:87503318-87503340 AAGGATGCCATAGACAAAGAAGG - Intronic
977969930 4:103201294-103201316 AAGCAGGACAGAGAGTGAGAAGG - Intergenic
978827770 4:113045348-113045370 AAGATGGACAAAGACTAAGATGG - Intronic
980884469 4:138747234-138747256 CAGCAGGACAGAGAGGAAGCTGG + Intergenic
981068875 4:140513955-140513977 AAGGATGACATGGACGAAGCTGG + Intergenic
985005060 4:185526120-185526142 GAGCAGGGCATGGAGGAAGATGG + Intronic
985202868 4:187502445-187502467 AAGCAGATCTTAGAAGAAGATGG + Intergenic
985679993 5:1250927-1250949 AAGAAGGAAAGAGAAGAAGAAGG - Intergenic
990847363 5:60157938-60157960 AAGAAAGAAAGAGACGAAGAGGG - Intronic
993635766 5:90341651-90341673 AAGCAGGAAATGGAAGTAGATGG + Intergenic
993855806 5:93073477-93073499 AAGCAGGACAGAGAGAAAGGAGG - Intergenic
994364177 5:98892457-98892479 AAGCAGGACACAGACATGGAAGG + Intronic
998699577 5:144682881-144682903 AACCAGGACATAGAGGCACAGGG - Intergenic
1003113679 6:3269123-3269145 CAGCAGAACATACACGAACAAGG + Intronic
1005217313 6:23546255-23546277 AAGCAGGAAATAGAGGATGAAGG - Intergenic
1008856917 6:56099585-56099607 AAGAAGGAAAAAGAGGAAGAGGG - Intronic
1010457342 6:76073021-76073043 AAGCAGAACATAGAAGAGAATGG - Intergenic
1012258586 6:97061588-97061610 AACCAGGACAGATAGGAAGAAGG - Intronic
1013684311 6:112561466-112561488 AAGCAGGACAAAGAAGAGCAAGG - Intergenic
1015907526 6:138132354-138132376 AAGCAGTACTAAGACTAAGACGG - Intergenic
1016606384 6:145933724-145933746 AAGCAGGTTATAGACAAATAAGG - Intronic
1018128943 6:160709589-160709611 CAGCAGGACAAAGGTGAAGAGGG - Intronic
1019056208 6:169225315-169225337 AACGAGGACATAGATGACGACGG - Exonic
1019914499 7:4124056-4124078 AAGCAGGCCATAGCCTAACAGGG - Intronic
1020416379 7:7950899-7950921 AAGCAGGACACTGGGGAAGAGGG - Intronic
1020543731 7:9495871-9495893 AAACAAGACACAGACAAAGAAGG + Intergenic
1021042903 7:15885333-15885355 AAGCAGGACATAGAATTAGAAGG + Intergenic
1023073448 7:36460373-36460395 AAGCTGGCCATAGAAAAAGAGGG - Intergenic
1024282520 7:47731325-47731347 AAGCTGGACACAGACGCAGAGGG + Intronic
1027842879 7:83336736-83336758 ATGAAGGACATAGACGATTAGGG - Intergenic
1029488795 7:100859110-100859132 AAGCAGGACATAGACGAAGAAGG - Exonic
1030772591 7:113492825-113492847 AAGCAGGACCTATACAACGATGG + Intergenic
1030887353 7:114954740-114954762 TCCCAGGACATAGACCAAGATGG - Intronic
1030953955 7:115827397-115827419 AAGCAGGAGACAGAGGAGGAGGG + Intergenic
1031077087 7:117223216-117223238 AACAAGGACCTAGACTAAGAGGG - Exonic
1031419359 7:121531532-121531554 AAGCAGGATTTAGAAGAAGATGG - Intergenic
1034241226 7:149612644-149612666 AAGCAGGAGAGAGAGGAAGCAGG - Intergenic
1034554880 7:151844046-151844068 AAGGAGGAGATAGAAGGAGATGG + Intronic
1035246889 7:157568368-157568390 AAGAAGGACATTCACAAAGAGGG + Intronic
1035977114 8:4324826-4324848 AAGCAAGACAAAGAAGAGGAGGG + Intronic
1042970530 8:74403329-74403351 AAGGAGGAAATAGAAGAAGAGGG + Intronic
1043005751 8:74816041-74816063 AAGAATGACAGAGAAGAAGAAGG - Intronic
1043835476 8:85040454-85040476 GAGCAGGACATTAACGAATAGGG + Intergenic
1044185019 8:89240418-89240440 AAGGAGGACCCAGATGAAGAAGG + Intergenic
1044893496 8:96862897-96862919 CAGCTGGACCTAGACCAAGATGG - Intronic
1044941820 8:97351202-97351224 AAGCAGAACTTAGAAGACGAGGG - Intergenic
1046706601 8:117460422-117460444 AAGCAAGAAATTGAAGAAGAGGG - Intergenic
1048638680 8:136328421-136328443 AAGCAGGACATTAACAAAGGAGG + Intergenic
1049444624 8:142624322-142624344 AGGCAGGACAAAGACGAGGCAGG - Intergenic
1051554303 9:18365581-18365603 AAGCAGGAATTAGAAGAAAAGGG + Intergenic
1052827179 9:33185801-33185823 AAGCAGGACAAAGTCAGAGAGGG + Intergenic
1056725279 9:89109052-89109074 AAGATGGACATTGAGGAAGAAGG - Intronic
1057466963 9:95323157-95323179 AAGCAGGAGAGAGGGGAAGAGGG - Intergenic
1057845344 9:98518461-98518483 AAGCAGGACTTAGACATAGGAGG - Intronic
1059079667 9:111234711-111234733 AAGGAGGACATAGGGAAAGAAGG - Intergenic
1186774604 X:12852540-12852562 AAGATGAAAATAGACGAAGAAGG - Intergenic
1187025803 X:15434220-15434242 AAGAAGGAGATAGAAGAAGGAGG + Intronic
1187025812 X:15434291-15434313 AAGAAGGAGATAGAAGGAGAAGG + Intronic
1190043220 X:47088958-47088980 AAGAAGAAGATAGAAGAAGAAGG + Intronic
1191856476 X:65631072-65631094 AAGCAGGATATAGAGGTAGATGG - Intronic
1193227524 X:79001504-79001526 TACCAGGACATAGATGAAGCTGG + Intergenic
1197144790 X:123159511-123159533 AAGCAAGACAGAGAGGAAGGAGG + Intergenic
1197902643 X:131390750-131390772 AAGCAGGACAGAGAGGTAAATGG - Intronic
1199864970 X:151837312-151837334 CATCAGAACATAGAGGAAGAGGG + Intergenic
1199975098 X:152890090-152890112 AAGCAGGGCAGAGGGGAAGATGG + Intergenic