ID: 1029489064

View in Genome Browser
Species Human (GRCh38)
Location 7:100860545-100860567
Sequence GGGGTGCCCCAGCACTTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 117}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029489064 Original CRISPR GGGGTGCCCCAGCACTTTGA GGG Intronic
902109672 1:14067755-14067777 TGGTTGCCCCAGAACTTTCAAGG - Intergenic
902386794 1:16080497-16080519 GGGCTGCCCCAGCATGATGATGG - Intergenic
905309413 1:37038774-37038796 GCCGTGCCCCAGCCCTTTGCAGG + Intergenic
906151302 1:43589136-43589158 GGGGTCCTCCAGCCCTTAGAGGG + Intronic
906375577 1:45294052-45294074 TGAGTGCCCCAGGACTTTTAGGG + Intronic
911742194 1:101399002-101399024 GAAGTGCCCCAGGAATTTGATGG - Intergenic
913517089 1:119613948-119613970 GGGGAGCCCCAGGACTGTCAGGG + Intergenic
914802179 1:150969839-150969861 GGGGTGCCCCAAAACATTGCAGG + Intronic
920229248 1:204459787-204459809 GGGATCACCCAGCACTATGAGGG - Intronic
921590217 1:216994369-216994391 CGGGTGCCCCATCACTGGGAGGG - Intronic
923458090 1:234183272-234183294 GTGTAGTCCCAGCACTTTGAAGG - Intronic
923458310 1:234185559-234185581 GGAGTGCCCCAGCCATGTGAAGG - Intronic
1065116297 10:22486396-22486418 GAGCTTCCCCAGGACTTTGAAGG + Intergenic
1068299550 10:55120947-55120969 GGGCAGCCCCACCACTGTGATGG - Intronic
1068713200 10:60156461-60156483 GGTGAGCCCCAGCACTGTGCTGG + Intronic
1071521174 10:86332259-86332281 GGGCTGCCCCAGGACGGTGAAGG + Intronic
1077222626 11:1424321-1424343 GGGGTGCCCCAGCACTGGGTGGG + Intronic
1077339006 11:2017745-2017767 CAGGTGCCCCAGCACACTGAGGG - Intergenic
1077430418 11:2513430-2513452 GGGACTGCCCAGCACTTTGAGGG - Intronic
1077545758 11:3169048-3169070 GGGGTGCACCTGGACTTTGGTGG + Intergenic
1079108039 11:17586510-17586532 GGAGTGCCCCTGCACTTGGAAGG + Exonic
1079573201 11:21970113-21970135 GGGGCTCCTCAGGACTTTGATGG + Intergenic
1084318173 11:68357855-68357877 GGGGTGCCCCAGGACTGCGTGGG - Intronic
1085252534 11:75153037-75153059 TGGCTGCCCCAGCACTTGCAGGG - Intronic
1089298177 11:117481930-117481952 GGGGTCCCCCAGCACTGAGGTGG + Intronic
1202821990 11_KI270721v1_random:72927-72949 CAGGTGCCCCAGCACACTGAGGG - Intergenic
1091786857 12:3248207-3248229 GGGGGGCCACAGCACCTTGAAGG - Intronic
1093779607 12:23120477-23120499 GGGGTGCCCCAGCTCCTTGTGGG + Intergenic
1102609201 12:114096317-114096339 GGGAGGCCCCACCACTTTGGGGG - Intergenic
1103915998 12:124376042-124376064 GGGGTGTCCCAGCACATAGCCGG - Intronic
1112331745 13:98482480-98482502 GGGGTGTCCCTGCACTCTGGAGG - Intronic
1116467026 14:45245686-45245708 GGGGTACTCCAGCATTTGGAAGG - Intronic
1119805981 14:77482641-77482663 GGGGTCCTCCACCACCTTGATGG + Exonic
1121942081 14:98080625-98080647 GGGTTTGCCCAGCACTTTGCAGG + Intergenic
1125748313 15:42012287-42012309 CAGGTACCCCAACACTTTGAAGG + Intronic
1127927623 15:63562090-63562112 GGGGAGCCCCAGCACCATGGGGG - Intronic
1128581803 15:68815999-68816021 TGTGTCCCCCAGCACCTTGAAGG + Intronic
1129274352 15:74435250-74435272 GGGGTGCCTCAGGACTCTGAGGG - Intergenic
1132751185 16:1458466-1458488 GGGGTGCCCCTGCCCTGTGGTGG - Intronic
1136536437 16:30902439-30902461 GCGGAGCCCCAGCACCTTGGCGG - Exonic
1137548283 16:49418965-49418987 GAGGGGCCCCAGCTCTTTGCTGG - Intergenic
1139158974 16:64479893-64479915 GGGCTGCCCCAGAAATTTGAAGG + Intergenic
1139375626 16:66494748-66494770 GGGGTGCCCCCGCTCCTGGATGG - Intronic
1141233944 16:82197984-82198006 GGGGGTCCCCAGGACTTTGGTGG + Intergenic
1142595371 17:1027209-1027231 GCGGTGCCCCAGCTTTTGGATGG - Intronic
1143400308 17:6638880-6638902 GGGGTGCCCCAGGCCTGTGGGGG - Intronic
1144827773 17:18116031-18116053 GCTGTGTCCCAGCACTTAGACGG + Intronic
1145269078 17:21394898-21394920 GGGGTCCCTCAGCACTTCCAGGG - Intronic
1145971589 17:28959548-28959570 GGGGGGTCCCAGCAATTTGTGGG - Intronic
1146841130 17:36155101-36155123 GGTTTGACCCAGCACTTTGGGGG + Intergenic
1151566556 17:74901680-74901702 TGGGTGCCTCCGCACTTTGTAGG - Intergenic
1152366410 17:79859169-79859191 GTGGTGCCCCTGCCCTTTCAGGG + Intergenic
1152778038 17:82214113-82214135 GGGGTGCACAAGCACTGAGAAGG - Intergenic
1158976576 18:62715972-62715994 GGGGCGCCCCAGCCCATTGCCGG + Exonic
1162860866 19:13505411-13505433 GGGGGGCCGCCGCACTTTTAGGG - Intronic
1163062115 19:14768322-14768344 GGGTTGCCCCAGGGCTGTGAAGG + Intronic
1163126457 19:15246795-15246817 TGGGGGCCCCAGCACTTGCAAGG - Intronic
1163790781 19:19305042-19305064 GGGGTGCCCCAGCAGCTCCAAGG - Intronic
1168266865 19:55228126-55228148 GAGAGGCCCCAGCACTTGGATGG - Intronic
928047745 2:27954356-27954378 GGAGTGCAGCAGCACTGTGAGGG + Intronic
931196820 2:60059630-60059652 GGGGTGGCCCTGCACATTGCAGG + Intergenic
931235306 2:60407671-60407693 GTGGTGGCCCTGCATTTTGAAGG - Intergenic
932314308 2:70769207-70769229 GTGGTGCCCCAGAACCTGGAAGG - Intergenic
932769615 2:74493159-74493181 AGGATGTCCCAGCCCTTTGAAGG - Exonic
933474066 2:82766450-82766472 GGCCTGCCCCAGCACTGTGTTGG + Intergenic
936094899 2:109523997-109524019 GAGGTGGCCCAGGACTCTGAAGG - Intergenic
938137347 2:128770264-128770286 GGGGTGCCACCGCATTTTCAGGG - Intergenic
948513659 2:238489448-238489470 GGGGTGGCCCGGCAGGTTGAGGG - Intergenic
948588896 2:239037204-239037226 GGGGTGCCCCAACAGTCTGTGGG - Intergenic
1172305601 20:33878097-33878119 TGGGAGACCCAGCTCTTTGATGG + Intergenic
1172483918 20:35287387-35287409 GGGGTGCCCCAGCTCTGTCCCGG - Exonic
1172875470 20:38161470-38161492 TGGCTGACCCTGCACTTTGAGGG - Exonic
1173381788 20:42551265-42551287 GGAGTGGCCCAGCTCTTTGCAGG - Intronic
1173751980 20:45484188-45484210 GGGATGCCCCCTCACTATGATGG - Intergenic
1175403664 20:58714157-58714179 TGGGTGCACCAGCACCCTGAAGG - Intronic
1175890460 20:62313648-62313670 GGGGTACCCCAGTACCTTCACGG - Exonic
1178466375 21:32852247-32852269 GGGGAGCCCCAGCATAGTGACGG - Intergenic
1179089214 21:38248544-38248566 GAGGTGCAGCAGCACTTTGAGGG + Intronic
1181085916 22:20439273-20439295 GAGGGGCCCCAGCACTGGGAGGG - Intronic
1183516612 22:38270564-38270586 GGGCTGCCCCAGCACAGTGCAGG + Intronic
949908309 3:8878000-8878022 GGGCTGCCCTAGCACTTGGCAGG + Exonic
950569828 3:13793097-13793119 GGGGTGCGCCAGCCCTGGGAAGG - Intergenic
956168638 3:66415301-66415323 GGGGTGGCCCAGCAGCTTCAAGG - Intronic
960044254 3:113180768-113180790 GAGGGGCCCCAGGGCTTTGAAGG - Intergenic
961726410 3:128933789-128933811 GTGGTGCCACAGCATTTGGAAGG - Intronic
962463482 3:135635966-135635988 GCTGTGGCCCTGCACTTTGATGG + Intergenic
962579380 3:136784106-136784128 AGGGTGCCCTAGCTCTTGGAGGG - Intergenic
966080326 3:175992407-175992429 GTAGTCCCACAGCACTTTGAGGG + Intergenic
967758455 3:193196998-193197020 GGGGTGCCCTAGTGCTTTGGTGG - Intergenic
969361688 4:6668135-6668157 CGGGCGCCCCAGCACTTTGGGGG - Intergenic
977515515 4:98017088-98017110 GGGCTGGCCTAGCACTTTGTTGG + Intronic
985532099 5:439817-439839 GGGGTGGCCCAGGTCTTTGGGGG + Intergenic
985878680 5:2620326-2620348 GGGCTGCCCCAGCCCTTTGGGGG - Intergenic
986016572 5:3762666-3762688 GGGCTGCCCCAGCTCTGTGTTGG + Intergenic
986524074 5:8654251-8654273 GGGTAGCCCCAGTGCTTTGAAGG + Intergenic
988396789 5:30705890-30705912 GGGTTGCCTCATCACTTTGTTGG - Intergenic
994657297 5:102609476-102609498 GGGGTGACCCTGCAATTGGAGGG - Intergenic
997893274 5:137694039-137694061 GGGGTTTCCCAGGACTTTCAGGG + Intronic
998523562 5:142821957-142821979 GGGCTGACCCAGCCCTTTGAGGG + Intronic
999426332 5:151490544-151490566 GGGGTCCCCCAGCTCTTAGCAGG + Exonic
1000373545 5:160559398-160559420 GGGGTCACCCAGCAATTTGGAGG - Intergenic
1001971657 5:175960074-175960096 GGGGTGCCACGCCACTGTGAAGG + Exonic
1008464843 6:51818810-51818832 CTGGTGCTCCAGCACATTGATGG + Intronic
1010157171 6:72808590-72808612 CTAGTGCCCCAGCACTTTCAAGG + Intronic
1019573400 7:1724624-1724646 GGGGAACCCCCGCCCTTTGAGGG + Intronic
1019649234 7:2147638-2147660 CGGGTGCCCCAGCTCTCAGAGGG + Intronic
1024956496 7:54926637-54926659 GGGGTGACCCAGCACATCCACGG + Intergenic
1027908229 7:84213866-84213888 AGGTTGCCCCAGCACTATCATGG + Intronic
1028056581 7:86252653-86252675 GGTGTGCCCCAGCACTGTGCTGG + Intergenic
1029489036 7:100860385-100860407 GGGGTTCACCAGCACCTTGCAGG + Intronic
1029489064 7:100860545-100860567 GGGGTGCCCCAGCACTTTGAGGG + Intronic
1029489150 7:100860990-100861012 GGGGTGCACTGGCACTTTGCAGG + Intronic
1032728712 7:134616334-134616356 GGAGTGCTACAGCACTTTGGTGG - Intergenic
1033477060 7:141701825-141701847 GGGGTGCCCCCGAGCTTTGGGGG - Intronic
1036604428 8:10293225-10293247 GGGGTGCGCCATCCCTATGATGG + Intronic
1038497097 8:28011167-28011189 GGGGTGCCCCACTTCTCTGAAGG + Intergenic
1039115618 8:34088632-34088654 GGGATTGCCCAGCATTTTGAAGG + Intergenic
1048809934 8:138276607-138276629 AGGGTGCCTCAGAACTTGGAGGG - Intronic
1049543091 8:143217403-143217425 GTGGTGCTCCAGCACTCTGGAGG - Intergenic
1051462625 9:17339405-17339427 GTGGGGCCCCAGCCCTTTTAAGG - Intronic
1052609686 9:30757622-30757644 ATGGTGCCCAAGCACATTGAAGG - Intergenic
1056753292 9:89367193-89367215 GGGGTGGCCCTGCACACTGATGG - Intronic
1058273618 9:103008809-103008831 GGGCTTCCCCTGCACTTAGAGGG - Intronic
1059618187 9:115973876-115973898 GGGGTCCCCAAGAAGTTTGAGGG + Intergenic
1060789433 9:126476082-126476104 GGGGGCCCTCAGGACTTTGACGG - Intronic
1203785228 EBV:123889-123911 GGGGTTGTCCAGCATTTTGATGG + Intergenic
1188862240 X:35271595-35271617 GGGCTGACCCAGCACTGGGAAGG + Intergenic
1188891508 X:35616742-35616764 GGGGTGCTGCAGCACTTTCATGG + Intergenic
1192968479 X:76205792-76205814 GAGGTGACCCAGCACTGTGCTGG - Intergenic
1196263674 X:113615947-113615969 GGGATGCCCCCACACTTTCATGG - Intergenic
1200169999 X:154065521-154065543 GTGGTGGCCCAGCACTTTGGGGG + Intronic