ID: 1029489203

View in Genome Browser
Species Human (GRCh38)
Location 7:100861278-100861300
Sequence CTGTGTCCCCAGAGAGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 553
Summary {0: 1, 1: 1, 2: 4, 3: 53, 4: 494}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029489200_1029489203 3 Left 1029489200 7:100861252-100861274 CCCAACTTCCGGTGAGAGACTCA 0: 1
1: 0
2: 1
3: 7
4: 53
Right 1029489203 7:100861278-100861300 CTGTGTCCCCAGAGAGAAGAAGG 0: 1
1: 1
2: 4
3: 53
4: 494
1029489193_1029489203 28 Left 1029489193 7:100861227-100861249 CCTGAGCCTGGAGTGGGCCTCGG 0: 1
1: 0
2: 2
3: 29
4: 262
Right 1029489203 7:100861278-100861300 CTGTGTCCCCAGAGAGAAGAAGG 0: 1
1: 1
2: 4
3: 53
4: 494
1029489201_1029489203 2 Left 1029489201 7:100861253-100861275 CCAACTTCCGGTGAGAGACTCAG 0: 1
1: 0
2: 0
3: 14
4: 92
Right 1029489203 7:100861278-100861300 CTGTGTCCCCAGAGAGAAGAAGG 0: 1
1: 1
2: 4
3: 53
4: 494
1029489202_1029489203 -5 Left 1029489202 7:100861260-100861282 CCGGTGAGAGACTCAGATCTGTG 0: 1
1: 0
2: 1
3: 16
4: 168
Right 1029489203 7:100861278-100861300 CTGTGTCCCCAGAGAGAAGAAGG 0: 1
1: 1
2: 4
3: 53
4: 494
1029489197_1029489203 11 Left 1029489197 7:100861244-100861266 CCTCGGCCCCCAACTTCCGGTGA 0: 1
1: 0
2: 1
3: 10
4: 128
Right 1029489203 7:100861278-100861300 CTGTGTCCCCAGAGAGAAGAAGG 0: 1
1: 1
2: 4
3: 53
4: 494
1029489195_1029489203 22 Left 1029489195 7:100861233-100861255 CCTGGAGTGGGCCTCGGCCCCCA 0: 1
1: 0
2: 1
3: 21
4: 228
Right 1029489203 7:100861278-100861300 CTGTGTCCCCAGAGAGAAGAAGG 0: 1
1: 1
2: 4
3: 53
4: 494
1029489198_1029489203 5 Left 1029489198 7:100861250-100861272 CCCCCAACTTCCGGTGAGAGACT 0: 1
1: 0
2: 0
3: 6
4: 68
Right 1029489203 7:100861278-100861300 CTGTGTCCCCAGAGAGAAGAAGG 0: 1
1: 1
2: 4
3: 53
4: 494
1029489199_1029489203 4 Left 1029489199 7:100861251-100861273 CCCCAACTTCCGGTGAGAGACTC 0: 1
1: 0
2: 2
3: 3
4: 41
Right 1029489203 7:100861278-100861300 CTGTGTCCCCAGAGAGAAGAAGG 0: 1
1: 1
2: 4
3: 53
4: 494

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029489203 Original CRISPR CTGTGTCCCCAGAGAGAAGA AGG Intronic
900121523 1:1050415-1050437 CCATGACCCCAGGGAGAAGATGG + Exonic
900393270 1:2443095-2443117 CTGTGCCCCCAGGGAGAACCAGG - Intronic
900572702 1:3366633-3366655 TTTTGTTCCCAGAGAGAAAAAGG + Intronic
900610246 1:3541672-3541694 CACTGTCCCCAGGGAGAGGAAGG - Intronic
900640224 1:3684943-3684965 CCTTGTCCCCAGAGAGCAGCCGG - Intronic
900773679 1:4565550-4565572 GTGAGGACCCAGAGAGAAGATGG - Intergenic
901186577 1:7377256-7377278 CTGTCTCCCCATAGCGAGGACGG - Intronic
901775951 1:11560568-11560590 CTGTGTGCTCAGATAGAAGTAGG - Intergenic
901816901 1:11799493-11799515 CTGTGGCCCCAGAGGGAATGAGG + Intronic
902173736 1:14633729-14633751 CTGAATCCTCAGAGAGAGGATGG - Intronic
903406039 1:23097093-23097115 CTGTTTCCTCACAGGGAAGAAGG + Intronic
903410711 1:23140974-23140996 CAGTGTGCCCAGGGAGAAGGTGG + Intronic
904215518 1:28915309-28915331 CTGGGTTCCCAGCGAGCAGAGGG + Intronic
904316721 1:29670656-29670678 CTGTGGTCCCAGAGAGGTGAAGG + Intergenic
905668619 1:39777308-39777330 CTGCTTCCCCAGACAGAAGCTGG - Intronic
906460355 1:46031482-46031504 TTGAGTCCCCAGAGAGCAGCCGG - Exonic
906647079 1:47482999-47483021 CTGTGGCCCCAGAGAGTGGGAGG + Intergenic
906838425 1:49109243-49109265 CTGTTCCCTCAGAGAGCAGAAGG - Intronic
906926300 1:50120871-50120893 ATGTGTGGCCAGAGAGAAGATGG + Intronic
907431614 1:54415378-54415400 CTGTGTGCCCAGAGAGGTGAAGG - Intergenic
907677499 1:56532195-56532217 CTGTTCCCCCAGGGATAAGAAGG + Intronic
908629740 1:66089567-66089589 CTGTATCCTCAGAAACAAGATGG - Intronic
908805098 1:67922308-67922330 CTCTGTCTTCAGAGATAAGAAGG - Intergenic
909239389 1:73192840-73192862 CTGTGTCCTCACATGGAAGAAGG + Intergenic
910863851 1:91769411-91769433 GTGTGTGCCCAGAGAGAAGTTGG - Intronic
910984210 1:92989831-92989853 CTGTGTCCTCACATAGAGGAAGG + Intergenic
911168149 1:94743482-94743504 CTGTGTCCTCACATAGTAGAAGG - Intergenic
911441175 1:97927490-97927512 CTGTGTCCTCAGATGGCAGAAGG + Intergenic
912556225 1:110518074-110518096 CAGTGTCTCCAGGCAGAAGATGG + Exonic
913221839 1:116666741-116666763 CGGATTCCCCAGAGAGAACAGGG + Exonic
913428230 1:118758603-118758625 TTCTCTCCCCAGAGAGAATATGG - Intergenic
915979108 1:160409088-160409110 CTTTGTCCCTGGTGAGAAGAGGG + Intronic
916171765 1:162006540-162006562 CTGTGTGCTCTGAGCGAAGATGG - Intronic
917963757 1:180165942-180165964 CTGGGTCCCCAGACAGAAACAGG - Intronic
920844399 1:209581830-209581852 CTGTGTCCCCATATAGTGGAAGG + Intergenic
921491960 1:215788250-215788272 CCATGTTCCCAGAGAGAAAAGGG - Intronic
921526060 1:216220224-216220246 CTGAGGCCCCATAGAGAGGAGGG - Intronic
922469761 1:225868826-225868848 CTGTGTCCCCAGAGATGGGGAGG + Intronic
922501397 1:226099354-226099376 CTGTGTCCTCAAAGAGAGAAAGG + Intergenic
923700289 1:236293722-236293744 ATGAGGACCCAGAGAGAAGATGG + Intergenic
923965004 1:239127630-239127652 CTGTGTCCTCACAGAGTGGAAGG - Intergenic
924127822 1:240874082-240874104 CTGTGTCCCCACATGGTAGAAGG - Intronic
1063170836 10:3508606-3508628 CTAGGTCCCCAGAAAGAAGGTGG + Intergenic
1064672170 10:17726737-17726759 CTATTTCTCCAGAGAAAAGAAGG + Intergenic
1066547068 10:36511184-36511206 GTGAGTCCCCAGCGGGAAGACGG + Intergenic
1066554509 10:36596555-36596577 CTGTGTCCCTTGGGAGCAGAGGG + Intergenic
1067126108 10:43516934-43516956 CTGTGTCCCTTTAGAGATGAAGG - Intergenic
1067133413 10:43586778-43586800 CTGTGTTAGCAGAGACAAGAAGG - Intergenic
1067280765 10:44870477-44870499 CTGTGTCCTCATACAGTAGAAGG + Intergenic
1067515584 10:46938783-46938805 CTGTGATCCCAGAGAGAAGGGGG - Intronic
1067646667 10:48113032-48113054 CTGTGATCCCAGAGAGAAGGGGG + Intergenic
1068037658 10:51781379-51781401 CTGTTTCCCCAAAGGCAAGAGGG + Intronic
1068385074 10:56316299-56316321 CTGTGTCCTCACATAGTAGAAGG + Intergenic
1068711661 10:60141518-60141540 CAGTGTACCCAGATGGAAGATGG - Intronic
1069313222 10:67065515-67065537 CTGTGGGCCCAGGAAGAAGATGG - Intronic
1069755607 10:70772829-70772851 CTGTTTCTCCAGAGACAGGAGGG - Intronic
1069860326 10:71467146-71467168 CAGAGACCCCAGAGGGAAGAGGG + Intronic
1070264263 10:74887053-74887075 CCCTGTCCCCAGAGAGACGGTGG - Intronic
1070845702 10:79521337-79521359 CTGTGTCATCAGGCAGAAGAAGG - Intergenic
1071009061 10:80915978-80916000 CTGTGTCCTCACATAGCAGAAGG + Intergenic
1072532288 10:96330806-96330828 CTCTGTCCCCAGAGTGATGCAGG - Intronic
1073902230 10:108235731-108235753 CTGTTTCCCAAGGAAGAAGATGG + Intergenic
1074386119 10:113018017-113018039 CTGGGTCCCCACAGTGGAGATGG + Intronic
1075217641 10:120552281-120552303 TTGTATCACCAGAGAGAATAAGG + Intronic
1075402938 10:122173848-122173870 CTGTGCCCCCAGAGAGGGGCTGG - Intronic
1075730563 10:124633075-124633097 CTGTGTCCACAGAGAGACAGAGG - Intronic
1075751287 10:124773570-124773592 CTGTGTCCCAAGAAAGAAGGAGG + Intronic
1076002562 10:126923860-126923882 CTGTGTCCTCACAGGGTAGAAGG - Intronic
1076340813 10:129743679-129743701 CTATGACCCCACAGGGAAGAAGG - Intronic
1076521668 10:131085111-131085133 CTGTGTCCCCACAGGGCAGAGGG - Intergenic
1078671336 11:13368460-13368482 CTGTGTCCCCACAGAACAAATGG - Intronic
1079441141 11:20516121-20516143 CTGTGTCCTCACACAGCAGAAGG + Intergenic
1079938218 11:26643871-26643893 CTGTGTCCTCACATAGCAGAAGG - Intronic
1079991631 11:27252669-27252691 CTGTGTCCTCACACAGTAGAGGG - Intergenic
1080751064 11:35150845-35150867 CTGTCTCCCCAGTTATAAGATGG + Intronic
1081508139 11:43739540-43739562 CTGTGTCCTCACAGAGCAGAAGG + Intronic
1081670998 11:44942721-44942743 ATGTGGCCCCACAGAGAAAATGG + Intronic
1082069042 11:47923864-47923886 CAGTGTCCACAGAGAGAGCAGGG - Intergenic
1082252963 11:50002134-50002156 TTGTGTTCCCAGAGAGATTATGG - Intergenic
1082990222 11:59201143-59201165 CTGTGTCCCCACATGGTAGAAGG + Intronic
1084377943 11:68791275-68791297 CAGTGTCCCCAAAGGGAAGTGGG - Intronic
1086448560 11:86893051-86893073 CTGTGTCCTTAGACAGAAAAGGG + Intronic
1087679334 11:101201946-101201968 GTGAGTCCTCAGAGAAAAGAAGG - Intergenic
1087978141 11:104575909-104575931 CTGTGTTCTCAGAGGGGAGAAGG - Intergenic
1088022620 11:105138088-105138110 CTCCCTCCACAGAGAGAAGATGG - Exonic
1088792097 11:113235201-113235223 CACTGCCCCCAGGGAGAAGAAGG - Intronic
1089131375 11:116214955-116214977 CTGAGGTCCCAGAGAGGAGAGGG - Intergenic
1089750600 11:120648563-120648585 CTGGCTGCCCAGAGAGAAGCTGG - Intronic
1090242988 11:125197124-125197146 CTCTGTCCCCTCAGAGAAGCAGG - Intronic
1090283585 11:125479688-125479710 CTGTGTCCCCACATGGTAGAAGG - Intronic
1090302936 11:125662277-125662299 CTGTGTCCCCACATAGTGGAAGG + Intronic
1090660369 11:128877932-128877954 CTCTGTCCCCAGCAAGCAGAGGG + Intergenic
1091569294 12:1670447-1670469 CTGAGTGCCCAGGGAGAAGGAGG - Intergenic
1091620751 12:2086896-2086918 CTGTGACCCCAGGAAGAAAAAGG + Intronic
1091862461 12:3798107-3798129 CTGTGTCCTCACATAGCAGAAGG + Intronic
1092766503 12:11857811-11857833 CTGTCTCCCCAGTTATAAGAAGG + Intronic
1096575270 12:52548863-52548885 CTGGGTTCCCTGAGTGAAGAAGG + Intronic
1097072417 12:56364865-56364887 CTGTGTCTCCAGAAAAAAAAAGG - Intergenic
1097625425 12:61994294-61994316 CAGTGTATCAAGAGAGAAGAAGG - Intronic
1097895130 12:64817679-64817701 ATGTGTCCCTAGACAGGAGAAGG - Intronic
1099844157 12:88007560-88007582 CTGTGTCCTCACACAGAAGAAGG + Intronic
1100806308 12:98287505-98287527 CTGTGTCCCCACATGGCAGAAGG - Intergenic
1100874916 12:98951669-98951691 CTGTAGGCCCAGAGGGAAGAGGG - Intronic
1101136133 12:101744819-101744841 CCGTGTCCTCACAGAGCAGAAGG - Intergenic
1101494564 12:105241443-105241465 CACTGTACCCAAAGAGAAGAAGG + Intronic
1102026324 12:109715843-109715865 CAGGGTCCCCAGAGAGATGTGGG + Intronic
1103379944 12:120486431-120486453 CTCTGTCCCCTGAGAGAACCAGG + Intronic
1103679430 12:122681511-122681533 CTGTGTCCCCACACAGCACAAGG - Intergenic
1103916299 12:124377364-124377386 CGGTTTCCCCATAGAGAAAACGG + Intronic
1104014453 12:124952760-124952782 CTTTGTCCCAAGGGAGAAGGAGG - Intronic
1104195355 12:126532067-126532089 CTGTGTCCTCACACAGCAGAAGG + Intergenic
1104460938 12:128955285-128955307 ATGTGTACACAGAGAGATGAGGG - Intronic
1104947688 12:132423919-132423941 CTGGATCCACAGAGAGAACATGG + Intergenic
1105415306 13:20206706-20206728 CTCCGTCCTAAGAGAGAAGATGG + Intergenic
1105529910 13:21209741-21209763 CTGTGTCCTCACATAGCAGAAGG - Intergenic
1105621650 13:22073319-22073341 CTGTATCCCCACAGATAAGTGGG - Intergenic
1107670215 13:42737952-42737974 CTGTGTCCCCATATGGTAGAAGG + Intergenic
1109528400 13:63606383-63606405 CTCTGTGCCCATAGACAAGAGGG - Intergenic
1110321755 13:74168239-74168261 TTGGGTCCCCTGTGAGAAGACGG - Intergenic
1110531406 13:76602867-76602889 CTGTGTCCCCTGACAGATGTGGG - Intergenic
1110603088 13:77399099-77399121 CTTTATGCCCAGAGAGAAAAAGG - Intergenic
1111072765 13:83189621-83189643 TTGTGTTGCCAGATAGAAGAAGG + Intergenic
1111658311 13:91178880-91178902 CTGTGTCCTCACAGATGAGAGGG + Intergenic
1112103726 13:96218177-96218199 CTGTGTCCCCAGAGAGAAGTGGG + Intronic
1113602798 13:111582652-111582674 CTGTGTCCCAGGAGTGTAGAGGG + Intergenic
1114285618 14:21239865-21239887 CTGGGTCTCAAGAGAGAAAAAGG + Intronic
1116034857 14:39615543-39615565 CTGTGTGCCCTGAGAGAGGATGG + Intergenic
1116139229 14:40968434-40968456 CTTTGTCCCCAGATAGAGGCGGG + Intergenic
1116525305 14:45896779-45896801 CTGTGTCTCCACAGAGTGGAAGG - Intergenic
1116769857 14:49114616-49114638 CTGTGTTCCAAAAGAGAACATGG + Intergenic
1117202518 14:53406777-53406799 CTGTGTCCTCAGATGGCAGAAGG - Intergenic
1118415826 14:65535630-65535652 CTGTGTTCCGAGAGAGTAGTTGG + Intronic
1119075454 14:71633701-71633723 CCCTGTCCCCAGAGACAAAATGG + Intronic
1120978293 14:90268658-90268680 CTGTGTCCCTAGAGTCCAGATGG - Exonic
1120989494 14:90362763-90362785 CTGTGTCCTCACATAGCAGAAGG + Intergenic
1121586223 14:95064800-95064822 AGATGTCACCAGAGAGAAGAAGG + Intergenic
1121728995 14:96173383-96173405 CTGTGTCCCCAGTGCCTAGAAGG - Intergenic
1121991178 14:98559196-98559218 CTGTGTGCTCAGAGAAAAGTGGG + Intergenic
1122008241 14:98723839-98723861 CTGTGACCCCTGAAAGAAGAGGG + Intergenic
1122056889 14:99105133-99105155 CAGAGTCCCCGGAGAGAAGAGGG + Intergenic
1202851395 14_GL000225v1_random:22734-22756 GCGAGACCCCAGAGAGAAGATGG - Intergenic
1124137953 15:27051580-27051602 CTGTGTCCCCACACAGAGGAAGG - Intronic
1124149986 15:27168691-27168713 CTGTGTCCCCACACAGTGGAAGG - Intronic
1125091921 15:35802878-35802900 CTGTGTCCTCACATAGCAGAAGG + Intergenic
1125298262 15:38226055-38226077 CTGTGTCCTCACATAGTAGAAGG - Intergenic
1125610563 15:40966515-40966537 CTGTGTCCCCAGGGAGCAAATGG + Intergenic
1125796691 15:42408871-42408893 ATGAGGCCCCAGATAGAAGAGGG - Intronic
1126117911 15:45225739-45225761 CTGTGTCCTCAAAGGGCAGAGGG + Intergenic
1126200343 15:45978678-45978700 CTGTGTCCTCACATGGAAGAAGG + Intergenic
1128443034 15:67731259-67731281 CTGTGTCACCAGCAGGAAGAGGG - Intronic
1128564302 15:68690239-68690261 CTGGGTCTCCAGAGAAAAAAAGG - Intronic
1128796785 15:70472219-70472241 CTGTGTCCTCACACAGCAGAAGG + Intergenic
1129497519 15:75999494-75999516 CTGTGTCCTCACATAGCAGAGGG - Intronic
1129987464 15:79930733-79930755 CTGAGTCACCAGAGAGGACAGGG - Intergenic
1130097630 15:80867756-80867778 CAGTATCCCTAGAGAGAAGAAGG - Intronic
1130220826 15:82018141-82018163 CTGTGTGTCCAGGGAGAAGTGGG + Intergenic
1131931452 15:97447130-97447152 CTGTGTCACAGGAAAGAAGATGG + Intergenic
1132240718 15:100255322-100255344 CTTTGGGCCCTGAGAGAAGATGG - Intronic
1132522961 16:399881-399903 CTGTGTGCCCTGGGAGAACACGG - Intronic
1132602178 16:778275-778297 CTGTGTCCCCAGTGAGGACGAGG - Intronic
1132968828 16:2674908-2674930 CTGTGTCTCCAGAGGGCAGAGGG - Intergenic
1132984558 16:2757766-2757788 CCGTGACCCTAGAGAAAAGAAGG - Exonic
1133071353 16:3248780-3248802 CTCTGTCCCCTGAGAGGAGGTGG + Intronic
1133625168 16:7564221-7564243 CTGTGTTCTCAGATGGAAGAGGG - Intronic
1133837623 16:9380796-9380818 CTGTGTCCTCACATAGTAGAAGG + Intergenic
1134310229 16:13069848-13069870 CTGTGTCCTCACAGGGCAGAAGG - Intronic
1134395608 16:13860132-13860154 CTGAGTCCTGAGAGACAAGAAGG - Intergenic
1134847872 16:17456097-17456119 CTGTGTGCACAGAGTGAAGCTGG - Intronic
1135085907 16:19474308-19474330 CTATTTCCACAGAGAGAAGTGGG + Intronic
1135271050 16:21070187-21070209 CTGTCTGCCAAAAGAGAAGATGG - Intronic
1136010949 16:27363193-27363215 CTGTGTCCCCAGAGAAATGTGGG + Exonic
1136690953 16:32028641-32028663 CTGGATGTCCAGAGAGAAGATGG - Intergenic
1137372111 16:47917067-47917089 CTGTTTTCCCAGTGAGAAAATGG + Intergenic
1139446263 16:67000567-67000589 CAGGGTCCGCAGTGAGAAGACGG - Intronic
1139596395 16:67960782-67960804 CAGTCACCCCAAAGAGAAGAGGG + Intronic
1140700817 16:77580110-77580132 TTGTGACCCCAGAGAGCAGGAGG + Intergenic
1140961839 16:79921026-79921048 ATGTGACCCAGGAGAGAAGAAGG + Intergenic
1141335183 16:83147772-83147794 CTGTGACCCCAGAGACCAGTGGG - Intronic
1141425206 16:83940379-83940401 CTGTGTCCCCAGAGCCCAGCAGG - Intronic
1142422164 16:89978284-89978306 CTGTGTCTCCACAGAGTAGAAGG + Intergenic
1143048886 17:4105913-4105935 CAGTGTTCCCACAGAGAAGCTGG + Intronic
1143142704 17:4750933-4750955 CTGTGTCCCCTGAGAAATGGGGG - Intergenic
1143163255 17:4885066-4885088 CTGAGCCACCAGAGAGAAAAAGG - Intronic
1143329289 17:6121715-6121737 GTGGGACCCCAGAGAGAACAGGG - Exonic
1143454339 17:7056416-7056438 CTGTGTCCTCACAGGGCAGAAGG - Intergenic
1143573453 17:7775908-7775930 CTTTGTACCCAGAGAAAAGCGGG - Intronic
1143970138 17:10789481-10789503 TCCTGTGCCCAGAGAGAAGATGG + Intergenic
1144263674 17:13547553-13547575 CTGTGCACCCAGAGAGGACATGG + Intronic
1144263950 17:13550282-13550304 CTGTGTTCTCAGGAAGAAGAGGG - Intronic
1144372485 17:14605427-14605449 CTGAGTCCCCAAAGAGAAGTGGG - Intergenic
1144408283 17:14974134-14974156 CTGTGCACCCAAAGAGATGAAGG + Intergenic
1144678352 17:17176144-17176166 CTTGGTCCCCAGAGACAAGCAGG + Intronic
1144877052 17:18403636-18403658 CTCTGTCCCCAGAGAGGTGATGG + Intergenic
1145002373 17:19314357-19314379 TTGAGTCCCCAGGGAAAAGAAGG + Intronic
1145155178 17:20540772-20540794 CTCTGTCCCCAGAGAGGTGATGG - Intergenic
1146043994 17:29486884-29486906 CTGTTTAAGCAGAGAGAAGATGG + Intronic
1146884008 17:36458993-36459015 CAGTGTCCCCAGCTAGAAAAAGG - Intergenic
1147685964 17:42287136-42287158 CTGTGACCACACAGAGAAGGTGG + Intergenic
1147885188 17:43679553-43679575 CTGAGTCCACAGAGAGGAAAGGG + Intergenic
1148919622 17:51019103-51019125 CTGTGTCTTCACATAGAAGAAGG - Intronic
1148971937 17:51491261-51491283 CTGTGTCCTCACATGGAAGAAGG - Intergenic
1149030778 17:52079993-52080015 CTATTTCCAAAGAGAGAAGATGG + Intronic
1150523634 17:65897123-65897145 GTGTGTCACTAGGGAGAAGAGGG + Intronic
1151587183 17:75016688-75016710 CTGTGGCCCCGGAAAGAACAGGG + Intronic
1151950016 17:77346892-77346914 CTGTGTCCCCACATGGCAGAAGG - Intronic
1152416984 17:80169105-80169127 CAGTATTCCCACAGAGAAGATGG + Intergenic
1152666670 17:81574372-81574394 CTGTTTCCCCAGGGAGGAAAGGG - Intronic
1153265993 18:3269987-3270009 CTGTCTCTCCAAAGAAAAGAGGG + Intronic
1153820640 18:8828657-8828679 CCATCTGCCCAGAGAGAAGAAGG - Intronic
1154399551 18:14023532-14023554 CTGTGTCCAGAGACAGAGGAGGG + Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1155632569 18:27910493-27910515 CTGTGTCCTCACATAGCAGAAGG + Intergenic
1155731558 18:29166064-29166086 CTGTGAACACAGAGAGTAGAGGG - Intergenic
1157158605 18:45291561-45291583 CAGTGTCCTCAGAGGCAAGAGGG + Intronic
1158638182 18:59179607-59179629 CTGTGTCCTCACAGGGTAGAAGG + Intergenic
1158788205 18:60740989-60741011 CTGTGTCCCCACATGGCAGAGGG + Intergenic
1159579427 18:70218612-70218634 CTGAGGACACAGAGAGAAGATGG - Intergenic
1160005834 18:75068420-75068442 CTGTGCCCCACGAGAGAATAGGG - Intergenic
1160057686 18:75500049-75500071 CTGTTTCCACAGAGAAAGGAAGG - Intergenic
1160246357 18:77163328-77163350 CTGCGTCCCCAGAGCCGAGATGG - Intergenic
1160556875 18:79731133-79731155 ATGTGTCCCCAGGATGAAGAGGG - Intronic
1161374814 19:3933858-3933880 CGGTGTCCCCAGTGGGAAGGGGG + Intronic
1161513730 19:4685206-4685228 CTCTGTCCCCACAGAGGATACGG - Intronic
1163263120 19:16203352-16203374 CGGAGTCCCCAGAGCGAAGCAGG + Intronic
1164727515 19:30476184-30476206 CTGGGGCCACAGAGGGAAGAAGG - Intronic
1164817948 19:31220808-31220830 CTGTGTGCTCAGAAAGATGAAGG + Intergenic
1165040164 19:33063380-33063402 CTGTGTCACCTGGGAGAAGGAGG + Intronic
1165429996 19:35767094-35767116 CTGGGTCCCCAGAGAACTGAGGG - Intronic
1165819130 19:38663493-38663515 CTGTGTCCCGGGAGAGGAAAGGG + Intronic
1165901800 19:39172736-39172758 CTGTGTCCCCAGGGAGGGGAGGG + Intronic
1166785051 19:45362675-45362697 CTGTGTCCCCAGCATGAAGCAGG + Intronic
1167422737 19:49413640-49413662 CTGCGTCACCAGAGAAAGGAGGG + Intronic
1167958888 19:53090281-53090303 CTGGGTCTCCAGAGAGATGAAGG - Intronic
1168036247 19:53721939-53721961 TTTTGTCCCCAAAGAGAAAAAGG - Intergenic
1168122028 19:54256910-54256932 CCTTGTCCCCAGTGAGAAGAAGG + Intronic
1168134101 19:54338815-54338837 CCTTGTCCCCAGAGAGGAGGAGG + Intronic
1168144994 19:54415728-54415750 CTGGGTCCCGAGGGAGAAGGGGG + Intronic
1168413180 19:56152761-56152783 CTGTGTCCTCACAGGGCAGAAGG + Intronic
1168456331 19:56511716-56511738 CAGTGGCCCCTGAGAGAAGTGGG - Intronic
925038481 2:710697-710719 CTGTGTCCTCACACAGCAGAAGG - Intergenic
925584495 2:5450741-5450763 CTGTGTCCTCATAGGGTAGAAGG + Intergenic
925710186 2:6731544-6731566 CTCTGTTCCCTGTGAGAAGAAGG - Intergenic
926259237 2:11242000-11242022 CTGTGTCCTCACACAGTAGAAGG - Intronic
926348099 2:11967983-11968005 CTGTGTCACCAGGTATAAGAAGG + Intergenic
926369839 2:12168663-12168685 CAGGGGGCCCAGAGAGAAGAAGG + Intergenic
927088742 2:19694600-19694622 CTGTGACCCCACAAATAAGAGGG + Intergenic
927219557 2:20694673-20694695 CTGTGCCTGCAGAGAGAAGCAGG - Intronic
927715913 2:25352734-25352756 CTGCTTCTCCAGAGGGAAGAGGG + Intergenic
928310368 2:30204737-30204759 CTCAGTCCCCAGATGGAAGAAGG + Intergenic
929565563 2:42981944-42981966 CTGTGTCCTCAGACAGTGGAAGG + Intergenic
930298106 2:49580286-49580308 CTGTGTCCTCACATAGCAGAAGG - Intergenic
930833185 2:55767475-55767497 CTGTGTGCCCATATAGAATATGG + Intergenic
932584815 2:73021058-73021080 TTCTCTCCCCAGAGAGAAGTGGG - Intronic
933895783 2:86808648-86808670 CTGGGCCCCCAGATGGAAGACGG - Intergenic
934945103 2:98535051-98535073 CTGGATCTCCAGAGAGAAAAAGG + Intronic
935708585 2:105877555-105877577 CTGTGTCTCCAGATGGAAGAGGG - Intronic
935715160 2:105932958-105932980 CTGTCTCCAAAGAGAGAATAGGG - Intergenic
936157372 2:110057215-110057237 ATGTATCTGCAGAGAGAAGAAGG - Intergenic
936187320 2:110314229-110314251 ATGTATCTGCAGAGAGAAGAAGG + Intergenic
936474201 2:112825272-112825294 CTGTGTACCTGGAGAGGAGAAGG - Intergenic
936896372 2:117432506-117432528 CTGTGTCCTCAGATAGTGGAAGG + Intergenic
937103060 2:119286466-119286488 TGGTGTGCCCAGAGAGAACAGGG + Intergenic
937496565 2:122426410-122426432 CTGTGTCCTCACAGGCAAGAAGG - Intergenic
937797287 2:126038752-126038774 CTGTGTCCTCACATAGCAGAAGG + Intergenic
938117690 2:128613009-128613031 CTGGGTCCCCAGGCAGAAGGGGG + Intergenic
938119703 2:128624930-128624952 CTTTGTCACCAAAGAGCAGAGGG - Intergenic
938597283 2:132800942-132800964 CCGTGCCCCCAGAAAGAAGAGGG - Intronic
939070464 2:137534436-137534458 CTGTCTCCTCAGAGAAAAAATGG - Intronic
939477470 2:142704421-142704443 CTTTGTCCCCAGAGACAATGTGG - Intergenic
939903394 2:147879305-147879327 CTGTGTCCTCACAGGGCAGAGGG + Intronic
939988457 2:148855183-148855205 CTGTGTCCCCACATGGCAGAAGG - Intergenic
941200653 2:162504868-162504890 GTGTGTACCCAGAGAGCAAATGG + Intronic
941873746 2:170412448-170412470 CTGAGTCTTCAGACAGAAGAAGG - Intronic
942287368 2:174433683-174433705 CTGTGTCCCCACATGGTAGATGG - Exonic
942447154 2:176085657-176085679 GTGTGTCGGCAGAAAGAAGAGGG - Intergenic
942458664 2:176154633-176154655 CTGTGTCTCCTGAGAGCTGAGGG + Intronic
942659681 2:178251136-178251158 GTGTGGTCCCAGAGAGCAGAAGG + Intronic
944157461 2:196622316-196622338 CTGTGTCCCCAGAGTTAAATGGG - Intergenic
944524953 2:200609461-200609483 CTGCCTCCCCAGAGAGAAAAAGG - Intronic
944783734 2:203046656-203046678 CTGTGTCCTCACACAGAGGAAGG + Intronic
945765349 2:213969557-213969579 CTGTGTCCTCACACAGCAGAAGG - Intronic
945920416 2:215749680-215749702 CTGTGTCACTATGGAGAAGAAGG - Intergenic
946081658 2:217125319-217125341 CTGTTTACTCAGAGAGAGGAAGG + Intergenic
946285845 2:218701900-218701922 CTGATTCCCCAGAGAGAGCAAGG - Exonic
947179004 2:227395578-227395600 CTGTGTGCCCAGAGGGAGGCTGG - Intergenic
947795500 2:232891477-232891499 CTGTGTCCCCAGCCAGGAGAAGG - Exonic
948134252 2:235624369-235624391 CTGTGTCCTTAGACAGTAGATGG + Intronic
948222664 2:236285339-236285361 CTGTGTCCTCACATAGCAGAAGG - Intergenic
948365597 2:237452540-237452562 GTGTGTCCTCTGAGAGGAGACGG + Intergenic
948940052 2:241190995-241191017 CTGTGCCCCCACACAGCAGAGGG + Intronic
1168844023 20:930103-930125 CTCTGTCCCAAAAAAGAAGAAGG - Intergenic
1170290703 20:14765262-14765284 GTGTGTCCTCAGAGAGAGTAAGG - Intronic
1170521643 20:17192076-17192098 CAGTGACCCCTGAGAGATGAGGG + Intergenic
1172299860 20:33841732-33841754 CTAAGTCCCCAGATAGAAGGGGG - Intronic
1172602409 20:36193026-36193048 CTGTCTACCCAAGGAGAAGAAGG - Intronic
1172832219 20:37845682-37845704 CTGCAACCTCAGAGAGAAGACGG - Intronic
1173485692 20:43439375-43439397 CTATGTTTCCACAGAGAAGAGGG - Intergenic
1173495079 20:43513047-43513069 CTGAATCCCCAGAGGGAGGAGGG + Intronic
1173860039 20:46277372-46277394 CTGTGTCCACAGAGAGGACAAGG - Intronic
1174301722 20:49587154-49587176 CTTTGTGCCGATAGAGAAGATGG + Intergenic
1174536000 20:51251851-51251873 CTGTGGCCCCAGAGAGACCCAGG - Intergenic
1174872305 20:54194439-54194461 GAGTGCCCCCAGAGAGAATAAGG + Intergenic
1175201976 20:57284268-57284290 TTGTGCCCCCACAGAGAACATGG + Intergenic
1175566839 20:59986520-59986542 GTGTGTCCCAGGAAAGAAGAGGG - Intronic
1175916760 20:62429595-62429617 CTGGGTCCCCAGGGAGAAGGTGG + Intergenic
1176149379 20:63581510-63581532 CTGTATGTCCAGGGAGAAGAGGG - Intergenic
1178279329 21:31267249-31267271 GTCTCTGCCCAGAGAGAAGATGG + Intronic
1178482726 21:32993691-32993713 CTGTGTCCTCAGACAGTAGAAGG + Intergenic
1178773455 21:35527231-35527253 CTGTGCCCCCACAGGGTAGAAGG - Intronic
1178799484 21:35779151-35779173 CTCTGTCACCTGAGAGGAGAAGG + Intronic
1179032426 21:37732195-37732217 CGTTGCCCTCAGAGAGAAGATGG + Intronic
1179278798 21:39916158-39916180 CCATGTGCTCAGAGAGAAGAAGG + Intronic
1180057189 21:45365068-45365090 CTGGGACCCCAGAGAGTAGGAGG - Intergenic
1180160856 21:45998109-45998131 CTGCTCCCCCAGGGAGAAGACGG + Exonic
1180162051 21:46002463-46002485 CCTTGTCCCCAGAAAGACGAGGG + Intronic
1180187075 21:46145340-46145362 CTGGGGCCCCAGTGAGAAGCGGG - Intronic
1180928571 22:19573482-19573504 CTGTGTCCCCATGGGGCAGAAGG + Intergenic
1181081695 22:20419789-20419811 ATTTGTCCCCAGTGGGAAGATGG - Intergenic
1181535075 22:23537620-23537642 CTGGGGACCCAGAGAGAAGGAGG + Intergenic
1181931941 22:26408858-26408880 CTGTGTCTCAAGAAAGAAAAAGG - Intergenic
1182497940 22:30723794-30723816 CTGTGTCGGGAGAGAGTAGATGG - Intronic
1182540222 22:31035938-31035960 CTGTGAGCCCAGAGAGGATAAGG - Intergenic
1182795666 22:32989880-32989902 CTGTGTCTTTAGAGAGGAGAGGG - Intronic
1183000817 22:34857168-34857190 CTGTTTACACAGAGAGAAGTAGG + Intergenic
1184368777 22:44069351-44069373 CTGCGGCCCCAGAGGGATGAGGG + Intronic
1184414479 22:44344281-44344303 CTGGGTCCTCAGAGATAAAAAGG - Intergenic
1185274008 22:49942154-49942176 CTGTGTCCCAGGAAAGAAGAGGG + Intergenic
949694646 3:6680662-6680684 CTGTGGCCAGAGAGAGAAAATGG + Intergenic
949806032 3:7956823-7956845 CTGTGTCCTCACATAGAGGATGG + Intergenic
950285457 3:11741299-11741321 CTGCGTCCCCACACAGCAGAAGG + Intergenic
950728452 3:14935172-14935194 CTCTGTGCCCAGTGAGCAGAGGG - Intergenic
951196108 3:19825540-19825562 CTGTGTCCCAGGTGGGAAGAGGG - Intergenic
951462180 3:22963252-22963274 CTGTGTCCTCACACAGCAGAAGG - Intergenic
951647657 3:24911175-24911197 CTTTCTTCCGAGAGAGAAGATGG - Intergenic
953082071 3:39630118-39630140 ATGTGCTTCCAGAGAGAAGAGGG - Intergenic
953468472 3:43146314-43146336 TTTTGTTCCCTGAGAGAAGAAGG + Intergenic
954215534 3:49122362-49122384 CTGTGTCCCTATAGAGGAGGGGG - Exonic
954317045 3:49806841-49806863 CTTTGTCCACAGAGTGAAGCAGG - Intronic
954436990 3:50501508-50501530 CTCTGTCCCCAGCCAGAAGATGG - Intronic
954608146 3:51929540-51929562 CAGTGTCCCCAGAAAGAGGTGGG + Intergenic
956448826 3:69352838-69352860 CTTTGCCTCCAGAAAGAAGAAGG - Intronic
956657539 3:71566917-71566939 CTGAGAGCCCAGGGAGAAGATGG - Intronic
956747786 3:72323289-72323311 CTGTGTCCTCACAGAGTGGAAGG + Intergenic
957291685 3:78285247-78285269 CTGTGTCCTCACATAGCAGAAGG + Intergenic
957347386 3:78979682-78979704 ATCTGTCCCCAGAGTGCAGAGGG + Intronic
957689277 3:83546327-83546349 CTGTGTCCACACATAGCAGAGGG - Intergenic
957690519 3:83559913-83559935 CTGTGTCCTCACACAGAAAAAGG + Intergenic
959470382 3:106742740-106742762 ATGTGTCCTCAGATGGAAGAAGG + Intergenic
959812889 3:110639679-110639701 CTGTGTTCCCAGAGAGCAAGTGG - Intergenic
959965323 3:112347479-112347501 CAGTCTCCTCAGAGAGATGAAGG - Intronic
960323175 3:116262941-116262963 CTGAGTGCTCAGTGAGAAGAAGG + Intronic
960727020 3:120680864-120680886 CTGAGTCTTCAGAGAGAAGTTGG - Intronic
962344640 3:134610260-134610282 CTGTGTACCTGGAGGGAAGATGG - Exonic
962751947 3:138440106-138440128 ATGTGTCACCAGAGAAAAGCAGG - Intronic
963716556 3:148810699-148810721 CTGTGTCCCCTCTGAGAAGAGGG + Intronic
963847379 3:150172859-150172881 CTGTGTCCTCACAGGGCAGAAGG - Intergenic
964447401 3:156774460-156774482 CTGTGTACTCAAAGAGAAGCTGG + Intergenic
964760788 3:160133439-160133461 CTGAGTCCCCATAGAGGGGATGG + Intergenic
965211433 3:165794540-165794562 CTGTGTCCTCACATAGTAGAAGG + Intronic
967015393 3:185477063-185477085 CTTTGTCCTCAGAGAGGTGATGG - Intronic
968497259 4:925713-925735 CTGTGTCCTCACAGGGCAGAAGG - Intronic
968790990 4:2661740-2661762 CTGTGTGCCCAGGCTGAAGATGG + Intronic
968817245 4:2828443-2828465 CTGGGACCCCAGAGGGAAGGAGG - Intronic
969292834 4:6251790-6251812 TTCTGTCTCCAGAGATAAGATGG + Intergenic
969585107 4:8087155-8087177 GGGTGTCCCCAGACAGAGGAGGG - Intronic
970579103 4:17458040-17458062 CTGTGTCCTCAGACAGCAGAGGG - Intergenic
970732065 4:19117456-19117478 CTGTGTCCTCACATAGCAGAAGG + Intergenic
971606250 4:28661618-28661640 CTGTATCCCCAGAGGGGAGTAGG - Intergenic
972371367 4:38426590-38426612 CTGTGTCCTCATATAGCAGAAGG - Intergenic
974345657 4:60677850-60677872 TTGTATCCCCAAAGAGAAGATGG + Intergenic
975974777 4:80082195-80082217 CTGTGTCCTCAGATGGCAGAAGG + Intronic
976131882 4:81893179-81893201 ATGGGTCACCAGAGAGAAGCCGG + Intronic
976167643 4:82272290-82272312 CTCTGTCCCCAGGGAGATGGGGG - Intergenic
977279505 4:95022100-95022122 CTTTGTCCGCAGAAACAAGAAGG + Intronic
977285796 4:95105267-95105289 GTGTGTGCCAAGAGAGAAGTGGG + Intronic
978233916 4:106434144-106434166 CTGAATCCCAAGAGAGTAGAAGG - Intergenic
978676092 4:111317918-111317940 GAGTGTCCCAAGAGATAAGATGG - Intergenic
979266913 4:118714432-118714454 TTGTCACCACAGAGAGAAGAGGG + Exonic
980610157 4:135150338-135150360 CTGTGTTCCCAGAAAGATGATGG - Intergenic
980639644 4:135560572-135560594 GTGTGTACCCAGAGAGAAGGAGG - Intergenic
984305414 4:177983193-177983215 CTGTGTCCTCACAGGGCAGAAGG - Intronic
985303565 4:188514764-188514786 CTGTTTCCCCAGAGAGGAACTGG - Intergenic
985585316 5:729371-729393 CTGTGTGCCCAGAGAGCACGGGG + Intronic
985598828 5:813698-813720 CTGTGTGCCCAGAGAGCACGGGG + Intronic
986011336 5:3718602-3718624 CTGAAGACCCAGAGAGAAGATGG + Intergenic
986135026 5:4968802-4968824 CTCTGTCTCCACAGAGAAAAAGG - Intergenic
986285853 5:6358536-6358558 CTGTGTCCCCATAGGAAAGCAGG + Intergenic
986374669 5:7117826-7117848 CTGTGTCCTCAGATAGCAGAAGG - Intergenic
987084671 5:14457517-14457539 CTGAGCCCACAGAGAGAAGCTGG + Intronic
988673297 5:33405444-33405466 CTGTGTCCTCAGATAGTAGAAGG - Intergenic
988885063 5:35547735-35547757 CAGTGCCCACACAGAGAAGAGGG - Intergenic
989466254 5:41758934-41758956 CTGTGTGCCCAGATAAAACAGGG + Intronic
990334779 5:54761846-54761868 CTGTGTCTTCAGGGGGAAGAAGG + Intergenic
992914630 5:81435405-81435427 CTATGTCCCCATAGTGCAGAAGG + Intronic
993907222 5:93636490-93636512 CTGTGTCTTCACAGGGAAGAAGG - Intronic
993980700 5:94540124-94540146 CAGTTTGCCCAGAGAGAAAAAGG - Intronic
994849979 5:105042206-105042228 CTGTGTCCTCACATAGCAGAAGG - Intergenic
995514096 5:112937120-112937142 CTGTGTCCCCACATGGCAGAAGG - Intergenic
995543946 5:113211212-113211234 CTGTGTCCTCACATAGTAGAAGG - Intronic
995597384 5:113762662-113762684 CTGTGTCCTCAAATAGAGGAAGG + Intergenic
996492301 5:124111943-124111965 CTTTGTTCCCAGAAGGAAGAAGG - Intergenic
996837536 5:127810482-127810504 CTGTATACCCAGAAAGGAGAGGG + Intergenic
997691648 5:135831399-135831421 CTGTGAGCCCACTGAGAAGAGGG - Intergenic
998041398 5:138952984-138953006 GTGAGGCCCCAGAGAAAAGAGGG + Intronic
998386305 5:141758957-141758979 CTGTGACCCCGGAGAGGAGGAGG + Intergenic
999148550 5:149411896-149411918 CTGTGTGCCCAGAGGGATAATGG - Intergenic
1000240701 5:159405683-159405705 GCCTGTCCCCAGAGACAAGAAGG + Intergenic
1000577196 5:162988922-162988944 CTGTGTCCTCGCAGAGTAGAAGG + Intergenic
1001302322 5:170543023-170543045 CTATGTCCTCACATAGAAGAAGG + Intronic
1001517176 5:172364180-172364202 CAGAGACCCCAGAGAGAAGCGGG + Intronic
1001905147 5:175465907-175465929 CTATGCCCTCAGAGAGAACAAGG - Intergenic
1002359377 5:178658588-178658610 CTGTGTGCACACAGGGAAGATGG + Intergenic
1003214327 6:4095221-4095243 CTGTGGCCACAGAGAAAAGAGGG - Intronic
1003692060 6:8364731-8364753 CTGTGTCCTCATATGGAAGAAGG - Intergenic
1003692068 6:8364779-8364801 CTGTGTCCTCATATGGAAGAAGG - Intergenic
1003692074 6:8364814-8364836 CTGTGTCCTCATACGGAAGAAGG - Intergenic
1004602016 6:17159289-17159311 CTGTGTCCTCAGAGCCAAGGAGG + Intergenic
1004826314 6:19425321-19425343 CTGTGTCCTCACATGGAAGAAGG + Intergenic
1005131431 6:22513026-22513048 CAGTGAGCCAAGAGAGAAGATGG + Intergenic
1005825565 6:29629741-29629763 CTGCATCCCAGGAGAGAAGATGG + Intronic
1006054063 6:31367524-31367546 CTGGGTGCTCAGAGGGAAGATGG + Intergenic
1007322520 6:41038008-41038030 CTTTCTCCCCACAGTGAAGATGG + Intronic
1007707323 6:43798846-43798868 CTGGGTCCCCTGTGAGCAGATGG + Intergenic
1008036778 6:46753549-46753571 CTGAGTCCCTGGTGAGAAGAGGG + Intronic
1008510626 6:52272441-52272463 GTGTGGCTCCAGGGAGAAGATGG - Exonic
1008946363 6:57101374-57101396 CTGTGTCCCATGAAGGAAGAAGG - Intronic
1009878707 6:69538570-69538592 CTGTGTCCTCACAAAGCAGAAGG + Intergenic
1009929807 6:70163912-70163934 CTGTGTCCTCACATAGTAGAAGG + Intronic
1010751568 6:79621401-79621423 CTGTGTCCTCACAGGGTAGAAGG - Intergenic
1011558228 6:88590486-88590508 CTCTGTCCCCAGGGATAAGAAGG + Intergenic
1012352062 6:98264153-98264175 CTGTGTCCTCACATAGCAGAAGG + Intergenic
1013268853 6:108527250-108527272 CTTGGTCCCCAGGGAGGAGAGGG - Intergenic
1014352045 6:120357763-120357785 TTGCCTCCCCAGAGAGAAGGTGG - Intergenic
1015510124 6:134030232-134030254 CTGTGGCCCAGGAGATAAGAGGG - Intronic
1018141659 6:160843765-160843787 CAGTGTACCCAGAGAATAGATGG - Intergenic
1018142450 6:160852731-160852753 CGGTGAACCCAGAGAAAAGATGG - Intergenic
1018142576 6:160853931-160853953 CAGTGAACCCAGAGAAAAGATGG - Intergenic
1018830120 6:167435615-167435637 ATGTGTCCGCAGAGAGAATCCGG + Intergenic
1018940907 6:168308445-168308467 CTGTGTCCTCAGGGAGACCATGG - Exonic
1020092626 7:5350021-5350043 CTGAGACCCCACAGAGAAGCAGG - Intronic
1020255337 7:6500057-6500079 GGAGGTCCCCAGAGAGAAGATGG - Intronic
1021655183 7:22867661-22867683 CTGTGGCCTCAGAGATGAGAAGG + Intergenic
1021882132 7:25105246-25105268 ATGGGTCCCCAGAGAGAATGTGG - Intergenic
1022050382 7:26662812-26662834 CTGGGTTCCCAGAAAGCAGAGGG + Intergenic
1022363413 7:29685220-29685242 CTGTGCCCCGAGAGCCAAGAAGG + Intergenic
1022647104 7:32241821-32241843 CTGTATCCACAGAGAGGAGATGG + Intronic
1022697962 7:32728518-32728540 CTGTGCCCCGAGAGCCAAGAGGG - Intergenic
1023529905 7:41141859-41141881 CAGTGTCCCAAAAGAGAATATGG - Intergenic
1024326707 7:48114692-48114714 CTGTGTCCTCAGTGAGAAGGAGG - Intergenic
1024557477 7:50615773-50615795 ATGTATCCCCAGTGAGAAGAAGG - Intronic
1025113061 7:56235598-56235620 GTCTGTCCCCACAGAGAGGAGGG - Intergenic
1025711607 7:63915568-63915590 CTGTGTCCTCACACAGCAGAAGG + Intergenic
1025832973 7:65070288-65070310 ATGTGTGCAAAGAGAGAAGAGGG - Intergenic
1025902739 7:65759802-65759824 ATGTGTGCAAAGAGAGAAGAGGG - Intergenic
1027654722 7:80916402-80916424 CTGTGTACTCACAGAGGAGATGG - Intronic
1029172425 7:98640458-98640480 AAGTTTCCGCAGAGAGAAGACGG - Intergenic
1029290263 7:99496980-99497002 ACGTGTCCCCACAGAGAAGAGGG - Intronic
1029489203 7:100861278-100861300 CTGTGTCCCCAGAGAGAAGAAGG + Intronic
1030068430 7:105678341-105678363 CTGTGTGCCCAGAGAAATAAAGG - Intronic
1030087552 7:105829995-105830017 GTGTGTCCCCAGTGACAAGGAGG - Intronic
1031228233 7:119069709-119069731 CAGTGTGCCCAGAGAGAATTTGG - Intergenic
1032802780 7:135329741-135329763 CTGTGTCCCCACAAAGAAGAGGG - Intergenic
1032876857 7:136047104-136047126 CTGTGTCCTCACAGGGCAGAAGG + Intergenic
1033004768 7:137549471-137549493 GTGTGTTCCCAGTAAGAAGAAGG - Intronic
1033358595 7:140621647-140621669 CTCTGTTCCCTGAGAGAAGCAGG - Intronic
1033579721 7:142721065-142721087 CAGTGTCTCTAGAGAGAAGAAGG + Intergenic
1033865414 7:145685716-145685738 TTGTGTCCCCAGTGGGAAGAAGG + Intergenic
1034284955 7:149878544-149878566 CTGTGTTCCCAGGGTGAAGAAGG - Intronic
1034285049 7:149878908-149878930 CTGTGTTCCCAGGGTGACGAAGG + Intronic
1035415383 7:158679606-158679628 CTCTGACCCCAGAGAGCAGGGGG + Intronic
1035475716 7:159143119-159143141 TTGTGGCCCCACAGAGAAGAGGG + Intronic
1035969632 8:4233544-4233566 CTGTGTCCTCAGACAGTGGAAGG - Intronic
1036407300 8:8466618-8466640 CTGTGTCCCCAGTAAAATGAGGG - Intergenic
1036911754 8:12763376-12763398 CTGTATCCCCACATGGAAGAAGG + Intergenic
1037626799 8:20615255-20615277 CTGTGTCCTCACAGAGTGGAAGG + Intergenic
1038521178 8:28233445-28233467 CAAACTCCCCAGAGAGAAGATGG - Intergenic
1039045907 8:33449200-33449222 CTGTGGGCACTGAGAGAAGAAGG + Intronic
1041257623 8:55992785-55992807 CTGTGTCCTCACATGGAAGAAGG + Intronic
1042076984 8:65007209-65007231 CTGTGTCCTCAGATGGCAGAAGG + Intergenic
1042200863 8:66278550-66278572 CTGTGTCCTCACACAGCAGACGG + Intergenic
1043380980 8:79701896-79701918 CTGTGTCCTTACAGGGAAGAAGG + Intergenic
1044823774 8:96177521-96177543 CTGTGTCACTAGAGAGAAAAAGG - Intergenic
1044882242 8:96735570-96735592 CTGTGTCCCCAAACAAAAGCTGG + Intronic
1045490655 8:102666521-102666543 CTGTGCCCTCAGACAGTAGAAGG + Intergenic
1046264051 8:111807789-111807811 CTGTGTCCTCACAGAGTGGAAGG + Intergenic
1046358204 8:113115943-113115965 CTGTGTCCTCACATAGAGGAAGG - Intronic
1047183705 8:122613464-122613486 CAGAGTTTCCAGAGAGAAGATGG - Intergenic
1047211252 8:122842266-122842288 CTGGGGGCCCTGAGAGAAGAAGG - Intronic
1047953308 8:129953615-129953637 CTGTATCCCCAGTGAGAGCACGG + Intronic
1048320361 8:133395072-133395094 CTGTGTCCTCACAGAGTGGAAGG - Intergenic
1048405568 8:134116683-134116705 ATGGGTCCCCTGAGTGAAGACGG + Intergenic
1048565920 8:135597181-135597203 CAGTGTCCCCACAGGGCAGAAGG + Intronic
1048577873 8:135707066-135707088 CTGTGTCCTCACAGAGCAGAAGG - Intergenic
1049235643 8:141510929-141510951 CTGTGGCCCCAGGCAGGAGAAGG + Intergenic
1049470568 8:142773431-142773453 GTGACTCCCCAGAGGGAAGATGG - Intronic
1049647377 8:143741575-143741597 CTGTGTCCCTTGAGAGCAGCAGG + Intergenic
1049747506 8:144269231-144269253 CAGTGGGCACAGAGAGAAGAAGG + Intronic
1050651105 9:7777864-7777886 CTGCTTCCCCAGAAAGAAGTGGG - Intergenic
1051250799 9:15157060-15157082 GTGTCTCCCCCCAGAGAAGAAGG + Intergenic
1051890977 9:21942607-21942629 CTGTGTCCCCACATAGCAGAAGG - Intronic
1051910707 9:22152197-22152219 CTGTGTCCTCACATAGTAGAAGG - Intergenic
1052034000 9:23659760-23659782 TTGTGTACCCTGAGAGTAGAGGG - Intergenic
1052603420 9:30669984-30670006 TTGTGGCTCTAGAGAGAAGAGGG + Intergenic
1052884785 9:33634208-33634230 CGGTGTCTCCCGAGAGGAGAAGG + Intergenic
1053044248 9:34900837-34900859 CTGTGTCCTCACATGGAAGAAGG - Intergenic
1053105475 9:35404567-35404589 CTGTGGCTCCAGTGAGAACAAGG + Exonic
1055394631 9:75861032-75861054 ACATGTCCACAGAGAGAAGAGGG - Intergenic
1055599601 9:77901894-77901916 CTGTGTCCTCACTGAGTAGAAGG + Intronic
1055845238 9:80554636-80554658 TTGTGGTCACAGAGAGAAGATGG + Intergenic
1055893851 9:81152864-81152886 CTGTGTCCTCACATAGCAGAAGG + Intergenic
1055941008 9:81649752-81649774 CTGTCTCCCCAGAGGGGAGGAGG - Intronic
1056280947 9:85040790-85040812 CTGTGTCCCAAGAGGGCAGCGGG - Intergenic
1057064725 9:92038135-92038157 CTTTGCCCTGAGAGAGAAGAGGG - Intronic
1057135046 9:92681696-92681718 CTGTGTCCCCACATAGTGGAAGG + Intergenic
1057707037 9:97402275-97402297 CTGTGTCCTCAGATGGCAGAAGG + Intergenic
1058355664 9:104081251-104081273 CTGGATCCCCAAAGAAAAGAGGG + Intergenic
1058938476 9:109791414-109791436 CTGGGTCCACAGAGAAAAGCAGG + Intronic
1059011310 9:110464623-110464645 CTGTGTAGCCTGAGAGAAGTAGG + Intronic
1059044849 9:110855354-110855376 CTAGGTCCCCAGAGAGAGTAGGG - Intergenic
1059362147 9:113753269-113753291 TTTTATCCCCAGAGAGAGGATGG - Intergenic
1059411868 9:114137669-114137691 TTGTGTGCTCAGTGAGAAGATGG + Intergenic
1059846921 9:118290236-118290258 CTGTGTCCTCACACAGCAGAAGG + Intergenic
1060048307 9:120358573-120358595 TTGTGTCCACTGAGAGAGGAAGG - Intergenic
1060246521 9:121951006-121951028 GAGTGTGCCCAGAAAGAAGATGG - Intronic
1061382748 9:130268239-130268261 CTCAGTGCCCAGAGAGGAGAGGG - Intergenic
1061405949 9:130393189-130393211 CTGAATCCCCCGAGAGGAGAGGG - Intronic
1061419001 9:130463270-130463292 CTCTGTCCCCAGAGAGAAAATGG - Intronic
1062451217 9:136616584-136616606 CCTTGTCCCCAGGTAGAAGAAGG + Intergenic
1062453228 9:136624168-136624190 CTCGGTCCCCAGAGAGGACAGGG + Intergenic
1185746123 X:2574859-2574881 GTGTGTACACAGGGAGAAGATGG + Intergenic
1185843033 X:3410905-3410927 GTGAGGGCCCAGAGAGAAGACGG - Intergenic
1186381888 X:9069593-9069615 CTGAGGCCCCACAGAGAAGTTGG - Intronic
1186417289 X:9394743-9394765 GTGTGTTTCCAGAGAGAAGGGGG + Intergenic
1186462188 X:9757243-9757265 CTGTGTCCCCACATGGTAGAAGG + Intronic
1187437241 X:19283824-19283846 CTGTGTCATCAAAGAGAAAATGG + Intergenic
1189142895 X:38625336-38625358 CTGTGTGCCTAGGAAGAAGATGG - Intronic
1189963634 X:46349834-46349856 CTGTATCCTCACAGAGCAGAAGG + Intergenic
1190477239 X:50840198-50840220 CTGTGCCTGCAGAGAGAGGAAGG - Intergenic
1192405799 X:70885110-70885132 TTCTCTCCCCAGAGAGAAGCTGG - Intronic
1192522620 X:71815342-71815364 CTCTGCCCCCAGAGAGGAGCTGG + Intergenic
1194083927 X:89502633-89502655 CTGTGTCCCCAAAGGGAAGAAGG - Intergenic
1195227123 X:102808384-102808406 CTGAGTCCAGAGTGAGAAGATGG - Intergenic
1195866720 X:109440243-109440265 CTGTGTCCTCCCAGAGCAGAAGG + Intronic
1196286462 X:113886707-113886729 CTGTGTCCTCACATGGAAGAAGG + Intergenic
1197775770 X:130117867-130117889 ATGTGTCCTCAGAGTGAAGCTGG + Intergenic
1197827890 X:130610201-130610223 CTGTGTCCTCACAAAGCAGAAGG - Intergenic
1198891797 X:141404626-141404648 GTGTGTCCTCACAGAGCAGAAGG + Intergenic
1199234977 X:145481226-145481248 CTGTGTCCCCACATGGCAGAAGG + Intergenic
1199549611 X:149044356-149044378 CTGTGTCTCCTGAGGGAAGGAGG + Intergenic
1199575133 X:149306634-149306656 CTGTGTCACCAGAGGGCACATGG + Intergenic
1200436574 Y:3158513-3158535 CTGTGTCCCCAAAGGGAAGAAGG - Intergenic
1201232162 Y:11875670-11875692 GTGAGGGCCCAGAGAGAAGACGG + Intergenic
1201338167 Y:12903083-12903105 CAGTGTTCCCAGAGTGAAGTTGG - Intergenic