ID: 1029489224

View in Genome Browser
Species Human (GRCh38)
Location 7:100861369-100861391
Sequence CTGCGGGCATGGAGGGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 757
Summary {0: 1, 1: 0, 2: 7, 3: 53, 4: 696}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029489224_1029489242 21 Left 1029489224 7:100861369-100861391 CCTCCTCCCCTCCATGCCCGCAG 0: 1
1: 0
2: 7
3: 53
4: 696
Right 1029489242 7:100861413-100861435 CTGGCACACCTGCCTGCTGGGGG 0: 1
1: 0
2: 4
3: 38
4: 291
1029489224_1029489239 19 Left 1029489224 7:100861369-100861391 CCTCCTCCCCTCCATGCCCGCAG 0: 1
1: 0
2: 7
3: 53
4: 696
Right 1029489239 7:100861411-100861433 TCCTGGCACACCTGCCTGCTGGG 0: 1
1: 0
2: 3
3: 34
4: 279
1029489224_1029489238 18 Left 1029489224 7:100861369-100861391 CCTCCTCCCCTCCATGCCCGCAG 0: 1
1: 0
2: 7
3: 53
4: 696
Right 1029489238 7:100861410-100861432 CTCCTGGCACACCTGCCTGCTGG 0: 1
1: 1
2: 5
3: 36
4: 386
1029489224_1029489241 20 Left 1029489224 7:100861369-100861391 CCTCCTCCCCTCCATGCCCGCAG 0: 1
1: 0
2: 7
3: 53
4: 696
Right 1029489241 7:100861412-100861434 CCTGGCACACCTGCCTGCTGGGG 0: 1
1: 0
2: 3
3: 55
4: 355
1029489224_1029489243 24 Left 1029489224 7:100861369-100861391 CCTCCTCCCCTCCATGCCCGCAG 0: 1
1: 0
2: 7
3: 53
4: 696
Right 1029489243 7:100861416-100861438 GCACACCTGCCTGCTGGGGGTGG 0: 1
1: 0
2: 2
3: 31
4: 334
1029489224_1029489235 2 Left 1029489224 7:100861369-100861391 CCTCCTCCCCTCCATGCCCGCAG 0: 1
1: 0
2: 7
3: 53
4: 696
Right 1029489235 7:100861394-100861416 CCACCTTCAGCCTGTTCTCCTGG 0: 1
1: 0
2: 2
3: 39
4: 347

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029489224 Original CRISPR CTGCGGGCATGGAGGGGAGG AGG (reversed) Intronic
900407352 1:2498500-2498522 CTGAGGGGATGCCGGGGAGGTGG - Intronic
900571692 1:3361795-3361817 CTGCGGTCCAGGAGGGCAGGTGG + Intronic
900571717 1:3361898-3361920 CTGCGGTCCAGGAGGGCAGGTGG + Intronic
900779983 1:4611818-4611840 CTGAGGGCAAGGCCGGGAGGGGG - Intergenic
900993068 1:6106808-6106830 ATGCAGGGATGGAGGGGTGGAGG + Intronic
901691498 1:10976257-10976279 CTGCGGGAGAGGAGGGAAGGGGG + Intronic
902377572 1:16037018-16037040 GTGGGGGCATTGAGGGGAGGGGG - Intergenic
902440861 1:16429053-16429075 GAGAGGGCCTGGAGGGGAGGAGG - Intronic
902514666 1:16983688-16983710 CTGCGGGCTGGGAGGAGATGAGG + Intergenic
902606804 1:17573563-17573585 CTGGGGGCTGGGAGGGAAGGAGG + Intronic
902873116 1:19326023-19326045 CTGAGGGCAGGGAGGTCAGGAGG - Intronic
903027744 1:20441780-20441802 CTACAGGCATGGTGAGGAGGTGG + Intergenic
903034250 1:20484594-20484616 ACGCAGGGATGGAGGGGAGGGGG - Intronic
903623606 1:24715460-24715482 TAGCAGGCATGGAGAGGAGGGGG - Intergenic
903693861 1:25193262-25193284 CTGGGGGCAAGGGAGGGAGGAGG + Intergenic
904028708 1:27520777-27520799 ATGCGGGCCTGCTGGGGAGGCGG + Intergenic
904354076 1:29927088-29927110 CTGGGGGCAGGGAGGTGAAGAGG + Intergenic
904355269 1:29934501-29934523 CTGTGGGCAGGGCTGGGAGGAGG + Intergenic
904389542 1:30172957-30172979 CTGCGGCCCTGGAAGGGTGGTGG - Intergenic
904591421 1:31617636-31617658 CTGCGGGGAGGGAGGGCCGGCGG - Intergenic
905203037 1:36326651-36326673 CTGTGGGCAAGAAGGGGAGCAGG + Intronic
905337495 1:37255573-37255595 CTGCTGGCGTGGAGGGGGCGGGG + Intergenic
905352529 1:37357448-37357470 CTGGGGGAATGGAGGGGCGGAGG - Intergenic
905858500 1:41330656-41330678 CTGAGGGCAGGGCAGGGAGGTGG - Intergenic
905874318 1:41422507-41422529 CTGGGGGCGTGGAGGTGTGGAGG + Intergenic
906153065 1:43598995-43599017 CTGAGGGCAGGCAGGGGAAGAGG - Intronic
906523416 1:46480098-46480120 TTAGGGGCAGGGAGGGGAGGGGG + Intergenic
909099051 1:71328022-71328044 GTGGGGGCATGGAAGGGAGGTGG - Intergenic
909393080 1:75136998-75137020 CAGGGGGAAGGGAGGGGAGGCGG + Intronic
910681551 1:89870674-89870696 CTGAGGGGAAGGTGGGGAGGGGG - Intronic
911871823 1:103108560-103108582 CTGGGAGCAGGGAGGGGAGTGGG - Intergenic
912106024 1:106276677-106276699 CAAGGGGCATGGATGGGAGGTGG - Intergenic
912451679 1:109771012-109771034 CCACGGGTATGGAGGGGAGAGGG + Intronic
912474425 1:109926611-109926633 CTGTGGGCTTGGGTGGGAGGGGG - Intronic
913966861 1:143383747-143383769 CTGAGGGACTGGATGGGAGGGGG + Intergenic
914061237 1:144209354-144209376 CTGAGGGACTGGATGGGAGGGGG + Intergenic
914117913 1:144757015-144757037 CTGAGGGACTGGATGGGAGGGGG - Intergenic
915106973 1:153540803-153540825 CAGCGGGCAGGGAGGGCAGGGGG + Intronic
915285041 1:154847094-154847116 GTGAGGGCAGGCAGGGGAGGGGG - Intronic
915461051 1:156070739-156070761 AGGAGAGCATGGAGGGGAGGGGG + Intergenic
915530136 1:156498599-156498621 CTGGGGGGAAGGGGGGGAGGGGG - Intronic
915595335 1:156893699-156893721 CTGCGGGAGCGGCGGGGAGGCGG - Exonic
916419857 1:164626809-164626831 CTGCAGGCATGATGGGGAGCAGG - Intronic
916827453 1:168456170-168456192 CTGAAGACATGGAGGGCAGGGGG + Intergenic
917739948 1:177952404-177952426 CTGTGGGCTTGGCGTGGAGGAGG - Intronic
918514435 1:185346924-185346946 CTCTGGGCAGGGAGGGGAGGTGG - Intergenic
918673931 1:187258099-187258121 GTGGGGGTTTGGAGGGGAGGTGG - Intergenic
919729079 1:200901494-200901516 CTGTGGGCCTGGAGGGCAGCGGG - Intronic
919765497 1:201124678-201124700 CTGCAGGGCTGGAGGGGAGACGG + Intronic
919793282 1:201305972-201305994 CTGGGGCCATGGAAGGGAGATGG + Intronic
919825818 1:201502400-201502422 CTGAGGGCAGAGAGAGGAGGGGG + Intronic
920348336 1:205321330-205321352 CCGCCGGCAGGGAGCGGAGGAGG - Intronic
920565025 1:206966122-206966144 CTGCAGGCCTTGAGGGGATGAGG + Intronic
920626842 1:207611065-207611087 GTGAGGGTAGGGAGGGGAGGTGG - Intronic
920732769 1:208503386-208503408 CTGGGAGCAAGGAGGGGAGTTGG + Intergenic
922741291 1:228015701-228015723 CGGCGGGGGTGGGGGGGAGGCGG - Intronic
922790523 1:228308482-228308504 CTGGGGGCCTGGCAGGGAGGTGG + Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
924328674 1:242921177-242921199 GGGAGGGAATGGAGGGGAGGAGG + Intergenic
1063260981 10:4389228-4389250 TTACGGGCGTGGTGGGGAGGTGG + Intergenic
1064327768 10:14366656-14366678 CTGCAGGCATGGATGCCAGGAGG - Intronic
1065794343 10:29292255-29292277 CTGCTGGCATTGTGGGGAGTGGG + Intronic
1065844664 10:29735361-29735383 CTGAGAGCATGGCGGGGAGGCGG - Intronic
1065948216 10:30626506-30626528 CTGCTGGCATTGTGGGGAGTGGG - Intronic
1066514108 10:36136735-36136757 GTGGGGGCTTGGAGGAGAGGTGG - Intergenic
1067049245 10:43002594-43002616 CTGTGGGCCTGGAGGGCAGATGG + Intergenic
1067061929 10:43082082-43082104 CTTGGGGAATGGAGGGGAGCGGG - Intronic
1067278478 10:44854104-44854126 CAGTGGGCATGCAGAGGAGGTGG - Intergenic
1067530208 10:47065523-47065545 TAGCAGGCATGGAGAGGAGGGGG + Intergenic
1067539634 10:47142238-47142260 GTGAGGACATGGTGGGGAGGAGG - Intergenic
1067582018 10:47452062-47452084 CTTCAGGCATGGTGGGGAGAGGG + Intergenic
1067756931 10:49012284-49012306 GTGCCGGCATGCAGGGGAGATGG + Intergenic
1067820082 10:49520764-49520786 CTGAGGACAGGGAGGGCAGGTGG - Intronic
1069625817 10:69867121-69867143 CTGCGGCCGTGGGAGGGAGGTGG + Intronic
1069696712 10:70391857-70391879 GAGAGGGCATGCAGGGGAGGGGG + Intergenic
1069927349 10:71859942-71859964 GTGGGGGCGGGGAGGGGAGGTGG + Intergenic
1070751263 10:78965318-78965340 CTGGGGGCAGGGCGGGGAGGAGG + Intergenic
1070814453 10:79313996-79314018 CTGCAGGCATGGGGGGGAGGGGG + Exonic
1070824120 10:79380979-79381001 CAGAGGGCATGGTGTGGAGGAGG + Intergenic
1070931452 10:80263972-80263994 CTCTGGGAATGGAGGGGAAGAGG + Intergenic
1071463621 10:85920753-85920775 CTGTGGGCGGGGAGGGAAGGGGG + Intronic
1071527518 10:86366839-86366861 AGGCGGGCAGGGAGGGGAGGGGG - Intergenic
1071856104 10:89626047-89626069 CTGTAGGCATGAAGGGGAGAAGG - Intronic
1072101223 10:92231267-92231289 CTGATGGCATGTAGTGGAGGGGG - Intronic
1072633221 10:97161202-97161224 GTGCTGGGAAGGAGGGGAGGAGG - Intronic
1072737911 10:97891583-97891605 CTGCCAGCCTGGAGGGCAGGGGG + Intronic
1072967169 10:99983628-99983650 CTGGGGGCACGCAGGGTAGGAGG - Intronic
1073031491 10:100529652-100529674 CTCCGGGTAGGGAGTGGAGGTGG - Intronic
1073073298 10:100808309-100808331 GTCCAGCCATGGAGGGGAGGGGG + Intronic
1074164777 10:110865499-110865521 CTGCAGACATAGAGGGGAGGGGG + Intergenic
1074439069 10:113459148-113459170 GGGAGGGCATGGAGGGAAGGAGG - Intergenic
1075075154 10:119345707-119345729 CTGCTGGCAGGGTGGGGTGGAGG - Intronic
1075079803 10:119375739-119375761 CTGTGGGCATGCCGGGGAGGTGG + Intronic
1075823531 10:125334313-125334335 CAGAGGGCATGCAGGGGAAGAGG + Intergenic
1075987029 10:126797083-126797105 CTGAGGGCATGAGGGAGAGGAGG + Intergenic
1076216306 10:128696271-128696293 CTGAGGGCATGGAGGGCTGTGGG - Intergenic
1076298705 10:129407282-129407304 TTCCGGGCCTGGAGGAGAGGTGG - Intergenic
1076312494 10:129518475-129518497 CAGGGGGAAGGGAGGGGAGGAGG - Intronic
1076312507 10:129518500-129518522 CAGGGGGAAGGGAGGGGAGGAGG - Intronic
1076429499 10:130391648-130391670 CAGGGCTCATGGAGGGGAGGGGG + Intergenic
1077101208 11:823424-823446 CTGCGGGTAGTGAAGGGAGGTGG + Intronic
1077101332 11:823864-823886 CTGGGGGACGGGAGGGGAGGAGG + Intronic
1077185774 11:1234750-1234772 CAGCGGGCAGGGAGGGCAGGGGG + Intronic
1077198490 11:1293401-1293423 GTGTGGGCAGAGAGGGGAGGAGG + Intronic
1077476510 11:2792884-2792906 CTGGGGGCAGGGAGGGGGCGAGG - Intronic
1077544179 11:3161954-3161976 CTGTGAGCAAGGAGGGGAGAGGG + Intronic
1078091803 11:8268616-8268638 CCGCGGGCAGGGAGCGCAGGAGG + Intronic
1078428271 11:11268631-11268653 CTGAGGGCAAGAAGGGGTGGTGG + Intergenic
1079034894 11:17013427-17013449 CTGCGGGGAGGGAGGGGGTGGGG - Intronic
1079165733 11:18041113-18041135 TTGTGGGCAAGGTGGGGAGGAGG - Exonic
1079536599 11:21522565-21522587 GTGCGGGGTGGGAGGGGAGGTGG + Intronic
1080017768 11:27525643-27525665 TTGCTAGCATGGAGGGTAGGAGG + Intergenic
1081574400 11:44310193-44310215 AGGCCGGCGTGGAGGGGAGGAGG - Intergenic
1081646476 11:44793823-44793845 CTGAGGCCCTGGAGAGGAGGAGG + Intronic
1082003610 11:47408239-47408261 CTGCGGCCCTGGACGGGAAGCGG + Intronic
1082050457 11:47766929-47766951 CTGCGGGCCTGCAGGCGGGGCGG - Intronic
1082824574 11:57568179-57568201 CTGGGCCCATGGAGGGAAGGCGG - Intronic
1083145554 11:60755765-60755787 CTGCTGGCATTAAGGGGTGGGGG - Intergenic
1083163354 11:60868974-60868996 CTGAGAGCAGAGAGGGGAGGGGG + Intronic
1083175989 11:60950939-60950961 CGGCGGGTGTGGAGGGAAGGAGG - Intronic
1083335600 11:61920006-61920028 CCTGGGGCATGGAGGGGAGGGGG - Intronic
1083714509 11:64567885-64567907 CTGGGGCCAGGGAGGGGATGTGG - Intronic
1083735186 11:64676122-64676144 CAGCGGGCAGAGAGGGCAGGGGG + Intronic
1084033741 11:66495540-66495562 CTGGGGGCGTGGAGGGTGGGTGG + Intronic
1084095166 11:66906603-66906625 CTGGGGGGATGGAGGTGACGTGG - Intronic
1084171044 11:67401296-67401318 CTGTGGGCAAGGAGGGGCCGAGG - Intronic
1084176557 11:67425351-67425373 ATGAGGGCAGGGAGGTGAGGGGG - Exonic
1084575186 11:69984615-69984637 CAGCAGGCCTGGTGGGGAGGAGG + Intergenic
1085021491 11:73213008-73213030 CTGTGGGCATGGAGGAAAGCTGG + Intergenic
1085027480 11:73244992-73245014 GAGTGGGCCTGGAGGGGAGGAGG + Intergenic
1085341536 11:75734669-75734691 GTGCATGTATGGAGGGGAGGAGG - Intergenic
1085447622 11:76611095-76611117 CTCCGGCCATGGAGAGGAGAGGG + Intergenic
1086049910 11:82577564-82577586 AAGCGGGGCTGGAGGGGAGGGGG + Intergenic
1086209187 11:84297721-84297743 CTGGGGGCATGGAAGGAAGTCGG - Intronic
1087007969 11:93487434-93487456 GTGGGTGTATGGAGGGGAGGAGG + Intronic
1087091852 11:94281703-94281725 CTGGGGGTGAGGAGGGGAGGTGG + Intergenic
1087670678 11:101102846-101102868 CTGGGGGCAGTGAGGGGTGGGGG + Intronic
1087795719 11:102453056-102453078 TTGCGGGCAGGGAGGGGACAGGG + Intronic
1088149399 11:106725918-106725940 CTGGGGGCAGGGAGAGGACGAGG + Intronic
1088230778 11:107671586-107671608 GAGCTGGCATGGAGAGGAGGAGG + Intergenic
1088815956 11:113421090-113421112 CTGGAGGTATGGAGGAGAGGTGG - Intronic
1088953469 11:114594033-114594055 GTGGGGGCATGGAGGAGAAGTGG + Intronic
1089359006 11:117874186-117874208 CTGGGGACATGAAGGTGAGGAGG - Intronic
1089564860 11:119365364-119365386 CTGCTGGCACACAGGGGAGGGGG - Intronic
1089573174 11:119423199-119423221 CACCGGGGATGGAGGAGAGGGGG + Exonic
1089625036 11:119745807-119745829 CTGCAAGGATGAAGGGGAGGTGG + Intergenic
1089693592 11:120201815-120201837 CTGGGGGCAGGGAGGGGGTGGGG - Intergenic
1090146346 11:124327426-124327448 TTGGGGGGATGGATGGGAGGGGG - Intergenic
1090266860 11:125358853-125358875 CTGCGGGCAGGCATGGGAGCTGG + Intronic
1090890059 11:130915661-130915683 CTCAGGGCATGGAGGACAGGTGG + Exonic
1091078254 11:132641326-132641348 CTCTGGGCAAGGAGAGGAGGTGG - Intronic
1091604616 12:1939456-1939478 CTGCGGGAGAGTAGGGGAGGTGG + Intergenic
1091682643 12:2537980-2538002 CTGCCGGGTTGGCGGGGAGGTGG - Intronic
1091714923 12:2770231-2770253 CTGCAGGCATGGAGGGCAGTGGG - Intergenic
1091973649 12:4809074-4809096 CTGCGGGGGTGGAGGGGGTGTGG + Intronic
1092088585 12:5785833-5785855 CTGCTGGCCTGGAGGGTAGATGG - Intronic
1092121034 12:6044135-6044157 ATGGGGGCATGGAGGAGGGGAGG - Intronic
1092226704 12:6752805-6752827 CTGCTCGCCTGGCGGGGAGGCGG - Intronic
1092968482 12:13668986-13669008 GAGAGGGAATGGAGGGGAGGTGG + Intronic
1093443812 12:19230737-19230759 CTGCTTGCAGGGAGGGGTGGAGG - Intronic
1095382112 12:41607407-41607429 CTGAATGAATGGAGGGGAGGGGG + Intergenic
1095811770 12:46379615-46379637 CTGAGGGAGTGGAGGGGAGGAGG - Intergenic
1095838332 12:46663438-46663460 CTGAGAGCAGGGAGTGGAGGAGG + Intergenic
1095995972 12:48085054-48085076 CTGCAGGGATGGCGGGGAGAAGG + Intronic
1096036239 12:48473565-48473587 GTGAGGGAAGGGAGGGGAGGAGG + Exonic
1096155133 12:49337301-49337323 GTGGGGGAGTGGAGGGGAGGCGG - Intergenic
1096656922 12:53097810-53097832 CTGCGGGCAAGGGGTGCAGGCGG + Exonic
1097245367 12:57604953-57604975 CCGCGCGCGGGGAGGGGAGGTGG - Intronic
1097462077 12:59874179-59874201 CTGGGGGCACGGAGGAGGGGTGG - Intergenic
1099438161 12:82668317-82668339 GTGGGGGGAAGGAGGGGAGGAGG - Intergenic
1101131799 12:101697789-101697811 CTGGGGGCAGGGAGAGGTGGAGG - Exonic
1101176339 12:102155582-102155604 CTGAGAGCATGGTGGGGGGGGGG + Intronic
1101249657 12:102919577-102919599 GTAGGGGCCTGGAGGGGAGGTGG - Intronic
1101513081 12:105410194-105410216 CCACGGACATTGAGGGGAGGGGG - Intergenic
1101996884 12:109532080-109532102 CTGCGAGCGGGGAGGGGCGGAGG - Intronic
1102518575 12:113465623-113465645 CAGCGCGCAGGGAGAGGAGGCGG + Intronic
1102587500 12:113933409-113933431 CTGCGTGCAGTGAGGGCAGGAGG + Intronic
1102626570 12:114239976-114239998 CAGGGGGCGTGAAGGGGAGGGGG - Intergenic
1103942334 12:124507914-124507936 CTGCGTGCATGGAGGAGAAGCGG - Intronic
1104649705 12:130522699-130522721 CTGTGCGCAGGGAGAGGAGGAGG + Intronic
1105334804 13:19457520-19457542 CTGTGGGGAGGGAGGGGATGGGG - Intronic
1105424402 13:20282622-20282644 CTGCAGGGATGGTGGGGGGGGGG - Intergenic
1105835081 13:24203127-24203149 CTGTGGGGAGGGAGGGGATGGGG - Intronic
1105860114 13:24401871-24401893 CTGTGGGGAGGGAGGGGATGGGG + Intergenic
1106149345 13:27083440-27083462 CTGCTGGCATGGGGGCAAGGGGG - Intronic
1106578578 13:30998870-30998892 CTGTGGGCAGGGAGGAGAGCAGG + Intergenic
1106597750 13:31161441-31161463 CTGCGAGGGTGGATGGGAGGAGG - Intronic
1106791039 13:33154985-33155007 CTACGGGCAGGCAGGGGAAGGGG - Intronic
1110410666 13:75201030-75201052 CTGCTGTCATGGAGTGGGGGTGG - Intergenic
1111197589 13:84894912-84894934 CTGCTGGCAGGGAGGTGTGGAGG - Intergenic
1111994804 13:95155142-95155164 CTACAGGAATTGAGGGGAGGAGG - Intronic
1112285962 13:98104625-98104647 CTGGGGGCAATTAGGGGAGGGGG + Intergenic
1112752543 13:102597190-102597212 CTCCGGGCATGCAGGTGAGGCGG + Exonic
1113522457 13:110950523-110950545 CTGAGGGCATGGTGGGCATGAGG - Intergenic
1113523158 13:110954645-110954667 CTTCGGGCATGGAGTGGACTGGG - Intergenic
1113702206 13:112396164-112396186 CTTCGGGCATGGAGTGGACTGGG + Intronic
1113768253 13:112894106-112894128 CCTCGGGCACGGCGGGGAGGAGG + Intergenic
1113868231 13:113543094-113543116 CTGGGGGCAGGGGGAGGAGGTGG - Intronic
1113868297 13:113543259-113543281 GTGGGGGCAGGGAGAGGAGGTGG - Intronic
1113882248 13:113633762-113633784 CTGAGGGCATGTTGGGGTGGCGG + Intronic
1114233434 14:20803484-20803506 CTGGGGGCATCGAGAGGATGGGG + Intergenic
1114630276 14:24155127-24155149 GTGAGGGGTTGGAGGGGAGGGGG - Intronic
1116192631 14:41679983-41680005 CTGAGGGCCTGGAGTGGTGGCGG + Intronic
1116652189 14:47607608-47607630 TTGAGGGCATAGAGGGCAGGGGG + Intronic
1117252045 14:53947938-53947960 CTGGGGGGTTGGAGGGGTGGGGG + Intergenic
1117457441 14:55912279-55912301 CAGAGGGCATGGTGGGGAGGGGG + Intergenic
1118379946 14:65209301-65209323 CTGCGGCCAATGAGGGGAAGAGG + Intergenic
1118450999 14:65902037-65902059 CTGAGGGCTTGGTGAGGAGGAGG + Intergenic
1118768897 14:68928797-68928819 CTGGGGGCAGGGAGAGGATGTGG - Intronic
1119562595 14:75603056-75603078 ATGTGGAGATGGAGGGGAGGTGG - Intronic
1120835707 14:89036891-89036913 GTGGGGGCAGGCAGGGGAGGGGG - Intergenic
1121485699 14:94312781-94312803 GTGCGGGATGGGAGGGGAGGTGG + Intronic
1121523138 14:94599878-94599900 CTGGGGGCCCTGAGGGGAGGTGG + Intronic
1121690788 14:95876225-95876247 GGGCGGGGAGGGAGGGGAGGGGG - Intergenic
1121840281 14:97128444-97128466 TTGCAGACAGGGAGGGGAGGGGG + Intergenic
1122418759 14:101562720-101562742 CTGAGGGCACGCTGGGGAGGGGG - Exonic
1122887228 14:104715507-104715529 CTGCGGAGAGGGAGGGGATGGGG - Intronic
1122975351 14:105168604-105168626 CGGCGGGCGTGCAGGGGCGGCGG + Exonic
1123004333 14:105314288-105314310 CTCGGGGCATGGCGGGGTGGAGG + Exonic
1124843529 15:33267381-33267403 GTGCGGGCCTGGCAGGGAGGTGG - Intergenic
1126142297 15:45448435-45448457 CTGCTGGGATGTAGAGGAGGGGG + Intronic
1126540516 15:49817293-49817315 CTGAGGTCAAGGAGGGGAGAGGG + Intergenic
1126663352 15:51053585-51053607 CTGAGGGCAAGGTGGGGAGAAGG - Intergenic
1128220296 15:65964161-65964183 AAGCGGGCAGGGAGGGGAGCTGG + Intronic
1128278013 15:66370467-66370489 GTGGGGGGCTGGAGGGGAGGAGG + Intronic
1128804779 15:70522464-70522486 CTGCGGGCAGGGAGAGGATAAGG + Intergenic
1128968653 15:72086662-72086684 CTGTGGGCAGGGAGGGGTTGGGG + Intronic
1129163000 15:73757660-73757682 CTGTGGCCATGGAGGGGAAGTGG + Intergenic
1129225984 15:74170758-74170780 CTGCAGGCAGGAAGGGGAGCAGG + Intergenic
1129468727 15:75738540-75738562 CTGGGGGCACGGCGGGGAGTCGG + Intergenic
1129717082 15:77858807-77858829 CTGTGGGCATGGATGAGGGGAGG - Intergenic
1130539494 15:84811941-84811963 CTGTGGGGAAGGAGGGAAGGAGG + Intergenic
1131382382 15:91974595-91974617 CTGTGGGCAGGGCAGGGAGGCGG + Intronic
1131473269 15:92714600-92714622 CCGCGGGAAGGGAGAGGAGGAGG - Intronic
1131615450 15:94012766-94012788 ATGCTGGCAGGGAGGGGAAGAGG + Intergenic
1131650166 15:94389315-94389337 GGGTGGGCATGGAGGGGAAGTGG + Intronic
1132202419 15:99964119-99964141 CTGGTGGCCAGGAGGGGAGGTGG - Intergenic
1132456476 16:26423-26445 CTGCAGGCATGCAGGGTGGGAGG + Intergenic
1132570459 16:641896-641918 CTGCGGGCGCCGCGGGGAGGGGG - Exonic
1132744936 16:1432647-1432669 CTGAGGGCAGGAAGGGGTGGTGG - Intergenic
1132753587 16:1470912-1470934 CAGGGGGCAGTGAGGGGAGGTGG - Intronic
1132866113 16:2093473-2093495 CTGCGTGCATGGGTGGGAGGTGG + Intronic
1132885431 16:2180190-2180212 CATCGGGCCTGGCGGGGAGGTGG - Exonic
1132977781 16:2719263-2719285 CTGGGGGCATGGGGTGGGGGAGG + Intronic
1132978424 16:2721586-2721608 CTGGGGGTCTGGAGGGAAGGAGG + Intergenic
1134073275 16:11273614-11273636 CTCTGGGCAAGGAGGTGAGGCGG + Intronic
1134841561 16:17405828-17405850 CTGAGGGCAGGGAGGGGAAATGG - Intronic
1135304193 16:21354724-21354746 CTGTGGGCATGGGGGTGGGGAGG - Intergenic
1135320243 16:21490946-21490968 ATTGGGGCATGGAGGTGAGGGGG - Intergenic
1135373078 16:21922436-21922458 ATTGGGGCATGGAGGTGAGGGGG - Intergenic
1135438711 16:22448266-22448288 ATTGGGGCATGGAGGTGAGGGGG + Intergenic
1136153015 16:28364620-28364642 CTGCGGGAACGGAGAGGCGGCGG + Intergenic
1136190017 16:28609951-28609973 CTGCGGGCGAGGAGGGCACGAGG - Exonic
1136210068 16:28750653-28750675 CTGCGGGAACGGAGAGGCGGCGG - Intergenic
1136300934 16:29333861-29333883 CTGTGGGCATGGGGGTGGGGAGG - Intergenic
1136330468 16:29572644-29572666 ATTGGGGCATGGAGGTGAGGGGG - Intergenic
1136445098 16:30312364-30312386 ATTGGGGCATGGAGGTGAGGGGG - Intergenic
1138128655 16:54459670-54459692 CGGCGGGCGTTGAGGGGTGGTGG - Intergenic
1138536551 16:57663429-57663451 CTGCGGGCAGTGAGGGCACGGGG - Intronic
1138562105 16:57807416-57807438 CAGTGGGCATGGAGAGGTGGTGG + Intronic
1139374416 16:66487835-66487857 GTGCAGGCAGGGAGGGGAGGTGG - Intronic
1139493050 16:67297313-67297335 TTGTGGGCTTGGAGGTGAGGAGG + Intronic
1140357399 16:74318238-74318260 CTGGGGTCTGGGAGGGGAGGTGG + Intergenic
1140869943 16:79096935-79096957 CTGTGGGCATATTGGGGAGGGGG + Intronic
1141081978 16:81060793-81060815 CGGCCAGCATGGAGGGAAGGAGG + Intronic
1141113075 16:81286357-81286379 CTTGGGGTATGGAGGGGTGGAGG - Intronic
1141604383 16:85144574-85144596 CTGGGGGTAGGGAAGGGAGGAGG + Intergenic
1141749217 16:85946995-85947017 CTGGGGTCTTGGAGGGGAGCAGG - Intergenic
1141774780 16:86116000-86116022 CTGAGGCCAGGGTGGGGAGGGGG - Intergenic
1142062634 16:88040590-88040612 CTGTGGGCATGGGGGTGGGGAGG - Intronic
1142147829 16:88499877-88499899 CTGCTGGCATGGGGCCGAGGAGG - Intronic
1142252095 16:88996674-88996696 CTGCGGTGCTGGAGGGGTGGGGG + Intergenic
1142253999 16:89005373-89005395 CTGCGGGGAAGGAGGTGAGCTGG + Intergenic
1142323909 16:89401943-89401965 CTGCGGTGCTGGAGGGGTGGGGG - Intronic
1142434597 16:90048049-90048071 ATGGGGGGATGGAGGGGATGGGG + Intergenic
1142484473 17:237582-237604 CTAAGGGCATGGACGTGAGGAGG + Intronic
1142587094 17:980245-980267 CTTCGTGCAGGGAGAGGAGGAGG - Intergenic
1142683255 17:1562384-1562406 CAGCGGGGATGGAGGGGATCCGG - Intronic
1142719469 17:1766744-1766766 CTGGGGGCCTGGAGGGGTGAGGG + Intronic
1143107890 17:4538495-4538517 GTGTGTGCATGGATGGGAGGTGG - Exonic
1143163622 17:4886715-4886737 CTGGGGCCAAGGAGGGGAGCAGG - Intronic
1143272110 17:5683474-5683496 CTGGGGCCGTGGAGGGCAGGGGG + Intergenic
1143314739 17:6023754-6023776 CGGAAGGCATGGAGGGGAAGAGG + Intronic
1143950235 17:10626625-10626647 CTCCGACCATGGAGAGGAGGAGG - Intergenic
1143963157 17:10737308-10737330 GTGCGGGCATGGAACGAAGGAGG + Intergenic
1144466702 17:15502934-15502956 CTTTGGGCCTGGAGGGGAGGTGG - Exonic
1144576823 17:16434827-16434849 CTCCGGGGTGGGAGGGGAGGCGG + Intronic
1144624814 17:16839237-16839259 GTGGGGCCATGGAGGGCAGGAGG - Intergenic
1144881616 17:18433484-18433506 GTGGGGCCATGGAGGGCAGGAGG + Intergenic
1145094116 17:20009699-20009721 CCTCGGGCCCGGAGGGGAGGAGG - Intronic
1145150617 17:20510902-20510924 GTGGGGCCATGGAGGGCAGGAGG - Intergenic
1145974676 17:28977338-28977360 CTGAAGTCATGGAGGGGAGGCGG - Intronic
1146821170 17:35984524-35984546 CTGAGGGCATGGAGGAGGGAAGG + Intronic
1146850051 17:36214133-36214155 CTGCGGGCACTGAGAGAAGGAGG + Intronic
1146937915 17:36824058-36824080 GTGCAGGGATGGAGGGCAGGTGG + Intergenic
1147661650 17:42120134-42120156 AAGGGGGCATAGAGGGGAGGGGG + Intronic
1147907824 17:43834046-43834068 CTGCTGGGATTGAGGGAAGGGGG - Intergenic
1148205774 17:45778982-45779004 CTGGGGGGCTGCAGGGGAGGGGG - Intergenic
1148340063 17:46867974-46867996 CTGGGGGCAGCAAGGGGAGGAGG + Intronic
1148443106 17:47721829-47721851 TGGCTGGCATGGAGGGGATGAGG + Intergenic
1148475903 17:47928299-47928321 CTGGGCACATGGAGTGGAGGTGG - Exonic
1148737824 17:49874663-49874685 AGGTGGGCGTGGAGGGGAGGGGG - Intergenic
1148789592 17:50165981-50166003 CAGGGGGCAGGGAGGAGAGGAGG - Intronic
1149610575 17:57955473-57955495 CTGCGGGCGGGGCGGGGCGGGGG + Intergenic
1150120728 17:62599540-62599562 TTGCGGGGAGGGAGAGGAGGTGG - Intronic
1150286857 17:63959528-63959550 CTGCGGGGGCGGAGGGGAAGGGG + Intronic
1150288222 17:63966043-63966065 CTGCAGGGATGGAGGGGGAGTGG + Intronic
1150640082 17:66943722-66943744 ATGGTGGCAAGGAGGGGAGGAGG - Intergenic
1151370869 17:73645319-73645341 CTGCGCGCCGGGAGGGGCGGCGG + Intergenic
1151537467 17:74747048-74747070 CTGCCGGCCTGGAGGGGGAGAGG + Exonic
1152035278 17:77868418-77868440 CAGCGGTGAGGGAGGGGAGGTGG - Intergenic
1152371604 17:79891914-79891936 GTGGGGGCTTGGAGGGGAGGTGG - Intergenic
1152550811 17:81029032-81029054 CTGGGGGGATGGGGGGGTGGCGG - Intergenic
1152586879 17:81193168-81193190 CCACGGGCATGGAGGGCGGGAGG + Intronic
1152636277 17:81431779-81431801 CAGAGGGCAGGGAGGGGATGAGG - Intronic
1152686613 17:81696820-81696842 CTGCGGGCATGGCCTGGAGCTGG - Exonic
1152856055 17:82664917-82664939 CTGCAGGCTTGGGGAGGAGGTGG - Intronic
1153002969 18:473183-473205 CTGTGGGCTTGCGGGGGAGGTGG - Intronic
1155323018 18:24637435-24637457 CTGTGGACAAGGAGGGGATGGGG + Intergenic
1155507696 18:26548707-26548729 CGCAGGGGATGGAGGGGAGGGGG + Intronic
1155541036 18:26868522-26868544 CTGAGGGCAAGGATGGGAGAAGG - Intergenic
1159241105 18:65744971-65744993 CAGTGGGCATGGAGTGGAGGGGG + Intergenic
1160491315 18:79338400-79338422 CTGGGAGCATGGTGGGGATGGGG - Intronic
1160568865 18:79803243-79803265 CTGGGGGCCTGGAGATGAGGGGG - Intergenic
1160659523 19:291568-291590 CTAGGGGCGGGGAGGGGAGGGGG + Intergenic
1160768710 19:821172-821194 CTGGGGGCCTGGAGGGGGCGGGG - Intronic
1160894147 19:1394973-1394995 CTGGGCGGAGGGAGGGGAGGTGG - Intronic
1160932614 19:1577846-1577868 CAGCGGGCATGGGGAGGAGCTGG + Exonic
1161003728 19:1924316-1924338 CAGCAGGAATGAAGGGGAGGAGG - Exonic
1161035521 19:2082333-2082355 CTCCTGGCAGGGAGGGGCGGCGG - Intronic
1161075275 19:2282281-2282303 CTGCGGGCGGGCAGGGGAGGCGG - Intronic
1161398876 19:4058977-4058999 CTGGGAGCAGGGAGGGTAGGAGG + Intronic
1161605359 19:5211921-5211943 CTGTGGGCGGGGTGGGGAGGAGG - Intronic
1161849396 19:6730903-6730925 CTACGGGCAGGGTGGGCAGGGGG - Intronic
1162034509 19:7931902-7931924 CTTCGGGCAGGGCTGGGAGGTGG - Intronic
1162094540 19:8302716-8302738 CTCCGGGGATTCAGGGGAGGTGG - Intronic
1162263012 19:9547800-9547822 CTGCTTGCAGGGAGGTGAGGAGG + Intergenic
1162486296 19:10962367-10962389 CTGCAGTCTTGGAGGGGAGCGGG + Intronic
1162848417 19:13412097-13412119 CTGTGGTCATGGAGGTGGGGAGG - Intronic
1163012236 19:14433434-14433456 CCCCGGGCGTGGCGGGGAGGGGG - Intronic
1163021210 19:14481886-14481908 CTGTGGGGATAGATGGGAGGGGG - Intronic
1163329500 19:16627745-16627767 CAGCGGCCCTCGAGGGGAGGTGG + Intronic
1163383748 19:16986249-16986271 CTCAGGGCATGGAGGGAAGATGG - Intronic
1163593011 19:18204798-18204820 CGGGGCGCAGGGAGGGGAGGGGG - Intergenic
1163669692 19:18620385-18620407 CTGCAGGAAGAGAGGGGAGGAGG - Intronic
1163674087 19:18646709-18646731 ATGCGGGCATGGCGGGCAGAAGG - Intronic
1164531485 19:29051656-29051678 TTGAGGGTGTGGAGGGGAGGAGG - Intergenic
1164574963 19:29400662-29400684 CTGAGGGCATACTGGGGAGGTGG + Intergenic
1164725370 19:30462245-30462267 CTGCTGTGATGGATGGGAGGAGG + Intronic
1164743563 19:30594679-30594701 CTGCAGCCAGGGAGGGGAGCAGG - Intronic
1165340681 19:35209628-35209650 CTTTGGGGATGGAGTGGAGGTGG + Intergenic
1165362342 19:35344704-35344726 CTGCACGCATGCAGGGGAGAAGG + Intronic
1166198335 19:41220621-41220643 CTGCGTGCCTGGAGGGGAGATGG - Exonic
1166219041 19:41353675-41353697 CTGCGGGGAGGAGGGGGAGGAGG - Exonic
1166283813 19:41811362-41811384 CTGGGGGCAGGGAGGGATGGGGG + Exonic
1166306954 19:41940538-41940560 CTCAGGGCATGGAGGGGAAGGGG + Intergenic
1166328328 19:42064903-42064925 CCCCAGGCATGGAGGGCAGGAGG - Intronic
1166719298 19:44988238-44988260 ATGTGGGGAGGGAGGGGAGGAGG - Intronic
1167175860 19:47863937-47863959 CTGGGGGCATGGGGGAGAGGTGG + Intergenic
1167272015 19:48511299-48511321 CTGGGGGCTGGGTGGGGAGGGGG - Intronic
1167374442 19:49103509-49103531 CTGGGGGCCTGGCGAGGAGGCGG - Intronic
1167560230 19:50222625-50222647 CGCCAGGCATGGAGGGGAGTGGG - Intronic
1167591395 19:50406317-50406339 CTGCAGGTATGGGCGGGAGGTGG + Exonic
1167638719 19:50668799-50668821 CTGCGAGGCTGGAGGGGCGGCGG - Exonic
1167642423 19:50688987-50689009 CGGCGGGGTCGGAGGGGAGGGGG + Intronic
1167672583 19:50861992-50862014 GTGAGGGAAAGGAGGGGAGGAGG + Intronic
1168276883 19:55283893-55283915 CTGGAGGGATGGAGAGGAGGTGG - Intronic
1202700645 1_KI270712v1_random:161242-161264 CTGAGGGACTGGATGGGAGGGGG + Intergenic
925060359 2:885758-885780 CTGGGGGCTTGGAGGGGAACTGG + Intergenic
925291765 2:2752593-2752615 CTGTGGGCAGGGAGGGAGGGAGG + Intergenic
926098058 2:10095413-10095435 GTGCGGGATGGGAGGGGAGGTGG + Intergenic
926301930 2:11611035-11611057 CTGTGCGCAGGGAGGGGCGGAGG + Intronic
927195366 2:20542844-20542866 CTGGGGGCACAGATGGGAGGTGG + Intergenic
927339541 2:21966651-21966673 CTGGGAGCATGGCAGGGAGGTGG + Intergenic
928228540 2:29476193-29476215 CTGCAGGCATGGGGAGGAGAGGG - Intronic
929133702 2:38602890-38602912 CTCCGGGCAGGGAGCGGAGACGG - Exonic
929713858 2:44291636-44291658 CTGGGGGTAAGGTGGGGAGGAGG - Intronic
929755535 2:44761088-44761110 TTGGGGGCAGGGAGTGGAGGTGG + Intronic
929835999 2:45400250-45400272 CTGGGGGCAGGAAGGGCAGGAGG + Intronic
930108490 2:47658335-47658357 CTCCAGGTCTGGAGGGGAGGCGG - Intergenic
933356676 2:81218994-81219016 GTGTGGGGCTGGAGGGGAGGTGG - Intergenic
933629442 2:84639142-84639164 CTGTGGGCATGGTGGGGTGGGGG + Intronic
933726520 2:85430493-85430515 CAGCAGGAATGGAGGGGAGAGGG - Intronic
933727463 2:85434966-85434988 CTGCGGGGGTGGGGGGTAGGAGG - Exonic
933990251 2:87628679-87628701 CTGTGGACAGTGAGGGGAGGAGG + Intergenic
934281881 2:91619032-91619054 CTGAGGGACTGGATGGGAGGGGG + Intergenic
934708981 2:96503093-96503115 CTGGGGGCAAGGAGGGGTGGAGG + Intronic
934926892 2:98388448-98388470 CTTCGGCCCTGGAGGGGAGAGGG + Intronic
935225269 2:101047249-101047271 CTGGGAGCAGGGAGGGTAGGGGG - Intronic
935461979 2:103347446-103347468 CTGCCGACGTGGAGGGGTGGTGG - Intergenic
935698314 2:105789027-105789049 CTGCGGGCATCGGGAGGAGGGGG - Intronic
936303595 2:111322145-111322167 CTGTGGACAGTGAGGGGAGGAGG - Intergenic
936558780 2:113518577-113518599 TAGTGGGCATGGAAGGGAGGGGG + Intergenic
936562358 2:113552096-113552118 GGGTGGGCATGGAGGGGAGAGGG - Intergenic
936978403 2:118241656-118241678 CTGGGGCCATGGAGGGTGGGTGG + Intergenic
937339164 2:121079968-121079990 CTGAGGGTCTGGAGGGTAGGAGG + Intergenic
937513997 2:122631463-122631485 AGCCTGGCATGGAGGGGAGGTGG - Intergenic
937880372 2:126859863-126859885 CTGTATGCATGGAGGGGAGGTGG + Intergenic
937907745 2:127060641-127060663 CTGTGGGGACGGACGGGAGGTGG + Intronic
938763803 2:134447209-134447231 CTGCTGACACGGAGGGGATGAGG - Intronic
939613015 2:144332540-144332562 CCGCGGGCCGGGAGGGGCGGCGG - Intronic
942044071 2:172088818-172088840 CTGGGGGCATTGGAGGGAGGGGG + Exonic
942251087 2:174048442-174048464 CTGCGGGCCTGGCGGGGAGCCGG - Intergenic
944333939 2:198506417-198506439 GTGGGGGACTGGAGGGGAGGTGG + Intronic
946007191 2:216535464-216535486 CTCCAGGCATGGATGGGAGTAGG + Intronic
946168695 2:217880890-217880912 ATGACGGCATGGAGGGTAGGTGG - Exonic
946299655 2:218814783-218814805 GTGTGGGCAGGGAGGGGTGGAGG + Intronic
946312714 2:218891867-218891889 CTGAGGGAAAGGAGGGGATGTGG + Intronic
946862209 2:224011031-224011053 CTGTGGGAATGGAGGGGGAGGGG + Intronic
947418650 2:229922274-229922296 CTGCTACCACGGAGGGGAGGGGG - Intronic
947860455 2:233354377-233354399 CTGCGCGCATGGCCGGCAGGGGG + Intergenic
947963918 2:234262866-234262888 CTGGGGGCAAGGAGTGGAGGCGG + Intergenic
948179171 2:235966255-235966277 CTCTGGGGATGGAGGAGAGGGGG + Intronic
948249118 2:236511485-236511507 CTGCAGGAGTGGAGGAGAGGAGG + Intergenic
948280172 2:236740832-236740854 CTGGGGGCTTGCTGGGGAGGTGG + Intergenic
948585866 2:239019204-239019226 GTGGGGGCAGGGAGGGGTGGGGG + Intergenic
948608645 2:239152757-239152779 CTGTAGGCATGGAGGCAAGGAGG + Intronic
948716038 2:239864486-239864508 CTGCAGCTATGGAGGGTAGGGGG + Intergenic
948869256 2:240790087-240790109 CTGGGGGCAAGGATGGAAGGTGG - Intronic
948896393 2:240929901-240929923 CTGCGTGCATGGAGGTGGGAGGG - Intronic
948991915 2:241559736-241559758 CTGCGGCCCAGCAGGGGAGGAGG - Intronic
949032071 2:241802040-241802062 CCGCGGGCCTGCTGGGGAGGAGG + Intronic
1169074278 20:2751828-2751850 CTGTGGGCAAGGGGGTGAGGAGG + Intronic
1170150613 20:13222164-13222186 GTGCGGGGTTGGTGGGGAGGTGG + Intronic
1170688924 20:18594538-18594560 CCGTGGTAATGGAGGGGAGGAGG - Intronic
1170756694 20:19212143-19212165 TGGCCGGCATGGCGGGGAGGGGG - Intergenic
1171041794 20:21770867-21770889 GTGAGGGCATGGAGATGAGGTGG + Intergenic
1171385082 20:24764438-24764460 CTGTGGGCTTGGAGGTCAGGCGG + Intergenic
1171411988 20:24953671-24953693 ATGCGGGGTGGGAGGGGAGGTGG - Intronic
1171869562 20:30514231-30514253 CTGTGGGGCTGCAGGGGAGGGGG + Intergenic
1171934107 20:31257347-31257369 CTGTGAGAATGTAGGGGAGGGGG + Intergenic
1171978025 20:31607656-31607678 CTGCGGGTCTGGAGTGAAGGTGG + Intergenic
1172007342 20:31826533-31826555 GTGCGGGTATGGAGGGTGGGTGG + Intronic
1172042046 20:32052587-32052609 CTGGGGGCAGCGAGGGGAGACGG + Intronic
1172300016 20:33842824-33842846 ATTCAGGCATGGAGGGAAGGAGG - Intronic
1172435830 20:34928396-34928418 CTTCGTGCATAGAGGGGAGGCGG - Intergenic
1172771384 20:37384438-37384460 CTGGGGCCACGGCGGGGAGGCGG + Intronic
1172936252 20:38622680-38622702 CTGCAGGCATGGAGGGATGTGGG - Intronic
1173251660 20:41366837-41366859 CTGGGGCCGCGGAGGGGAGGCGG + Intergenic
1173609401 20:44355758-44355780 CTGGGGGCATGGAGGAGCAGGGG - Intronic
1173642788 20:44615511-44615533 CTGGGGGAATGGAGGGGGTGGGG - Intronic
1174149899 20:48478554-48478576 CTGAGGCCGGGGAGGGGAGGGGG - Intergenic
1174399817 20:50269983-50270005 CTGCGGGCAGGGAAGAGGGGAGG - Intergenic
1174421418 20:50401417-50401439 CTTCAGGAATCGAGGGGAGGAGG - Intergenic
1174466941 20:50725006-50725028 CTAGAGGCACGGAGGGGAGGAGG - Intergenic
1174511655 20:51057968-51057990 GAGCGGGCAAGGAGAGGAGGGGG + Intergenic
1174658303 20:52190542-52190564 CTGGGGGACTGGCGGGGAGGGGG - Intronic
1174804484 20:53593846-53593868 GAGCGGGCGCGGAGGGGAGGGGG + Intronic
1174967873 20:55239802-55239824 CTGGGGGAAAGGAGGGGAAGGGG - Intergenic
1175216891 20:57395902-57395924 CTGAGGGCATGGAGGGAGGTGGG + Intronic
1175961032 20:62636438-62636460 GTGCGGGTAGGGAGGGGAGGTGG + Intergenic
1176199158 20:63852481-63852503 CTGCCATCCTGGAGGGGAGGTGG - Intergenic
1176234825 20:64049352-64049374 CTGCGGGCTGGGCGGCGAGGCGG + Exonic
1177871094 21:26573283-26573305 CTGCGGGCAGGGGGCGGGGGTGG + Exonic
1178517038 21:33256876-33256898 ATGCGGGAAAGGAGGTGAGGGGG + Intronic
1179522375 21:41953742-41953764 CTGGGGGCGTGGAGGGGGCGCGG + Exonic
1179780723 21:43699168-43699190 GTGCTGGCACGGAGGGGAGCGGG - Intergenic
1180246887 21:46554482-46554504 CTGCGAGAGAGGAGGGGAGGTGG - Intronic
1180560387 22:16610248-16610270 GAGCGGGCGCGGAGGGGAGGGGG + Intergenic
1181234961 22:21443157-21443179 AGGCGGGCAGGGAGTGGAGGAGG + Intronic
1181717573 22:24743663-24743685 CTGCGGGGAAGGATGGGAGGGGG + Intronic
1181740305 22:24916208-24916230 CTGGGGAGATGGAGGGGATGGGG - Intronic
1182122267 22:27795888-27795910 CTCCAGGCCTGGTGGGGAGGGGG + Intronic
1182296259 22:29312410-29312432 CTGCGGGTCCGGAGGGGCGGCGG - Exonic
1182474522 22:30569378-30569400 CAGCAGGTATGGAGGAGAGGAGG + Intronic
1182586500 22:31346703-31346725 CCGCGGGCGGGGTGGGGAGGCGG - Intergenic
1183021605 22:35031505-35031527 CTGCTGGCATTGCTGGGAGGAGG - Intergenic
1183064181 22:35352421-35352443 CAGGGGGCAGGGAGTGGAGGCGG - Intergenic
1183359582 22:37376527-37376549 CTTTGGGCATGGAGGAAAGGAGG - Intronic
1183364485 22:37399834-37399856 AGGCGGCCATGGCGGGGAGGTGG - Intronic
1183427336 22:37746740-37746762 CTAGGGGGCTGGAGGGGAGGTGG - Intronic
1183535509 22:38398528-38398550 GAGCGGGCGCGGAGGGGAGGGGG + Intergenic
1183718284 22:39547085-39547107 CTGTGGGCATGGAGAGGGAGAGG + Intergenic
1183967126 22:41448444-41448466 CAGCGGGCATGTGCGGGAGGGGG - Intergenic
1184039645 22:41935270-41935292 ATGCGGGCATGGGGGGGAGGGGG + Intergenic
1184109043 22:42384490-42384512 CTGGGGGCATGGAGCAGAGAGGG - Exonic
1184120104 22:42444530-42444552 CTGAGGGATTGGTGGGGAGGGGG + Intergenic
1184443818 22:44535589-44535611 CATCGGGCCTGGAGAGGAGGCGG + Intergenic
1184594103 22:45503646-45503668 CTGGGAGGATGGAGGGGATGCGG + Intronic
1184640421 22:45867361-45867383 CTGGGCGCGTGGAGCGGAGGTGG - Intergenic
1184741385 22:46430744-46430766 GTGGGGGCCTGGAGGGGTGGCGG - Intronic
1184786172 22:46673015-46673037 CTGCGGGGATGGGGGGATGGGGG + Intronic
1184889086 22:47368615-47368637 TGGCGGGCATGGAGGGAAAGGGG - Intergenic
1184981196 22:48097081-48097103 CTGCAGGCATGGAGGGGCAGGGG - Intergenic
1185195079 22:49464351-49464373 CTGGGGGCAGGGTGGGGAGTGGG - Intronic
1185208391 22:49553210-49553232 CTGTGGGCAGGGAGGGGAGGAGG + Intronic
950193478 3:10993272-10993294 CCCAGGGCATGGAGGGGACGCGG + Intronic
950447738 3:13047933-13047955 CTGCCGGCATGGAGGCTGGGTGG - Intronic
950484394 3:13264535-13264557 CTGGAGGGAGGGAGGGGAGGAGG - Intergenic
950487654 3:13282623-13282645 CTCGGGGCTTGGCGGGGAGGTGG - Intergenic
950532653 3:13561484-13561506 CAGCCGGCATGCAGGGAAGGAGG - Intronic
952211446 3:31232443-31232465 CCGAGGGCATGCAGGGGAGCTGG - Intergenic
952301364 3:32106860-32106882 CTGCGCGCAGGGAGGCGGGGTGG + Intronic
952744456 3:36764237-36764259 CTGCGGGGCTGGAGTGGCGGCGG + Intergenic
952744461 3:36764254-36764276 CGGCGGGCATGGCGCGGCGGCGG + Intergenic
953038750 3:39236558-39236580 CTGGGGACAGGGATGGGAGGAGG - Intergenic
953535794 3:43775727-43775749 CAGCTGGCCTGGTGGGGAGGTGG + Intergenic
953742808 3:45551821-45551843 ATGAGGCCCTGGAGGGGAGGTGG + Intergenic
954619137 3:51985829-51985851 CTGGGGGCAGGGATGGGAAGAGG - Intronic
954659806 3:52221037-52221059 CTGGAGGCATGGACAGGAGGAGG - Intergenic
954702293 3:52456566-52456588 CTGCGGGAACAAAGGGGAGGAGG - Intronic
955025064 3:55159763-55159785 CTACTGGCATGGTGGGGAGGTGG - Intergenic
955695584 3:61632805-61632827 CCATGGGCAGGGAGGGGAGGGGG - Intronic
955871505 3:63443141-63443163 CTGCCTGCTTGGTGGGGAGGTGG - Intronic
956189592 3:66596045-66596067 ATGGGTGCCTGGAGGGGAGGTGG + Intergenic
956195610 3:66651098-66651120 CAGCGGGGATGGCGGGGGGGGGG + Intergenic
956491592 3:69778053-69778075 CTGTGGAGATGGAGAGGAGGTGG + Intronic
957424446 3:80020142-80020164 GTGAGGGCATAGAGAGGAGGTGG - Intergenic
959256846 3:104025832-104025854 CAGGGGGCAGGGAGGGAAGGAGG + Intergenic
960046157 3:113200422-113200444 CTGAGGTCATGGAGTGGGGGTGG - Intergenic
960120855 3:113947835-113947857 CCGCGGGCACCGCGGGGAGGCGG + Intergenic
961123920 3:124398876-124398898 CAGGGGGCCAGGAGGGGAGGTGG + Intronic
961404903 3:126672138-126672160 CTGCGCCTTTGGAGGGGAGGGGG + Intergenic
962263468 3:133929261-133929283 CTGCAGGCAAGGAGGAGATGGGG - Exonic
962388980 3:134956077-134956099 CTGCAGGGAGGAAGGGGAGGAGG + Intronic
962448247 3:135488237-135488259 TGGAGGGCAAGGAGGGGAGGTGG + Intergenic
962609463 3:137062024-137062046 CTGGGGGCGGGGAGGGGATGGGG + Intergenic
962738901 3:138348778-138348800 GGGCGGCCTTGGAGGGGAGGGGG + Intronic
962828352 3:139119143-139119165 CTGTGGCCATGGAGGTCAGGTGG + Intronic
963038721 3:141052953-141052975 CTGCCGGCAGGAAGGAGAGGAGG + Intronic
966398834 3:179527136-179527158 CTGCTGGCAGGAAGGGGTGGAGG + Intergenic
966811986 3:183855135-183855157 CTGAGGGGAAGGAGGGAAGGAGG + Intronic
967875781 3:194267695-194267717 CTGCGGACAGAGAGAGGAGGTGG - Intergenic
968045974 3:195624162-195624184 CTGCAGGAACGGAGGGGGGGCGG - Intergenic
968106815 3:196007134-196007156 ATGGGGGCATGCTGGGGAGGGGG - Intergenic
968308680 3:197665925-197665947 CTGCAGGAACGGAGGGGGGGCGG + Intergenic
968500726 4:948602-948624 CTGCAGGCCTGGAGGTGAGCGGG + Intronic
968529198 4:1081322-1081344 CTGGGGGCTTGGAGAGGGGGTGG + Intronic
968647958 4:1749348-1749370 GAGGGGGCATGGTGGGGAGGGGG - Intergenic
968657557 4:1785260-1785282 CTGGGAGCAGGGAGGGGAGCTGG + Intergenic
968957540 4:3726897-3726919 CAGCTGGCGTGGAGGGGTGGGGG + Intergenic
969269599 4:6090254-6090276 CTGCAGACATGCAGGGGAGAAGG + Intronic
969278482 4:6153086-6153108 CTTCAGGCAGGTAGGGGAGGGGG - Intronic
969342389 4:6550309-6550331 CTGAGGGCACTGTGGGGAGGGGG - Intronic
969344684 4:6563479-6563501 CTGCGGGGCTGGGGGTGAGGCGG + Intronic
969718909 4:8882311-8882333 CGGCGGGGAGGGCGGGGAGGCGG + Intergenic
970141644 4:12989332-12989354 CGGCGGGGATGGGGGGCAGGGGG + Intergenic
970215442 4:13754536-13754558 CTGGGGGGAAGGATGGGAGGAGG - Intergenic
970869427 4:20798686-20798708 CTGAGGGGATGGAGTGGCGGAGG - Intronic
972340631 4:38149560-38149582 CTGAGAGCAAGGAGGGGTGGGGG - Intergenic
972578901 4:40377752-40377774 CTGCGGGATTGGAGTAGAGGAGG - Intergenic
975599659 4:76086062-76086084 CTGCGGGGAGGGAGCGGGGGGGG - Intronic
976246485 4:83010839-83010861 GGGCGGGCGGGGAGGGGAGGAGG - Intronic
977586391 4:98779762-98779784 CTGCACAAATGGAGGGGAGGAGG - Intergenic
980370594 4:131864469-131864491 CTTGGGGCATGGAGGGAAAGGGG + Intergenic
980934252 4:139211389-139211411 CTGAGAGCATGGGTGGGAGGAGG - Intergenic
981375775 4:144013766-144013788 CTGTGGGGTTGGGGGGGAGGGGG + Intronic
982054684 4:151536444-151536466 ATGGGGGCAGGGAGGGCAGGAGG - Intronic
982468894 4:155762227-155762249 CAGAGGGTAGGGAGGGGAGGAGG - Intronic
983077784 4:163345930-163345952 CTGGAGGCAGGGAGGGGGGGTGG - Intronic
983831963 4:172338951-172338973 GTCCAGGCATGGAGGGGAGAGGG + Intronic
984862440 4:184252918-184252940 CTGCTGGCAGGGAGGTGTGGAGG + Intergenic
985588203 5:751543-751565 GTGGGGGCATGCAGGGCAGGTGG + Intronic
985595210 5:784823-784845 CTCCGGGCCTGGTGGGGCGGCGG - Intergenic
985663624 5:1169855-1169877 CAGCAGGGAAGGAGGGGAGGAGG + Intergenic
985700389 5:1368271-1368293 CTGCTGCCTGGGAGGGGAGGTGG + Intergenic
985805371 5:2039143-2039165 CTGGGGGGATGGAGGGGGGCTGG + Intergenic
986347191 5:6846253-6846275 CTTCGGGGGTGGAGGGGAGGGGG - Intergenic
987097435 5:14562183-14562205 CTGGGGGGATGGAGGGGAGATGG + Intergenic
988066212 5:26230595-26230617 ATGGGGGCATGCAGGTGAGGAGG - Intergenic
988703550 5:33700530-33700552 ATGAGGGCATGGTAGGGAGGTGG + Intronic
988992597 5:36686042-36686064 CTGCAGGCAGGGTGGGGAGGAGG - Intronic
990039194 5:51358389-51358411 CCGCTGTCATGGAGGTGAGGTGG - Intergenic
990363691 5:55047554-55047576 GTGCTGGCATGGTGAGGAGGAGG + Intergenic
990446189 5:55896589-55896611 GTGGGGGAAGGGAGGGGAGGGGG - Intronic
990493080 5:56321035-56321057 CTGCTGGCTTGGATGGGAGTGGG - Intergenic
991557369 5:67910804-67910826 CAGGGGGCATGGAGGGGAGGAGG - Intergenic
992390460 5:76326579-76326601 CTGCGGGCCAGGTGGGGTGGGGG - Exonic
993852885 5:93033330-93033352 CTGGGGGGATGGAGGGGTGGAGG - Intergenic
993900544 5:93581493-93581515 CTGCCTGCGGGGAGGGGAGGAGG + Intergenic
994367041 5:98928539-98928561 CGGCGGGCTTGGCGGGGCGGAGG + Exonic
995501873 5:112816111-112816133 ATGCAGGCAAGGAAGGGAGGGGG - Intronic
996959077 5:129222461-129222483 CTCAGGGCAGGGCGGGGAGGGGG - Intergenic
997202786 5:132022814-132022836 CTCTGGGAATGGAGGTGAGGGGG + Intergenic
997379252 5:133423576-133423598 CTGTGGTCATCGAGGGGTGGTGG + Intronic
998038400 5:138935626-138935648 CTGGGGGCGTGGCGGGGAGGAGG + Intergenic
998106382 5:139471748-139471770 CTGGGGTCCTGGAGGAGAGGGGG - Intergenic
999323116 5:150626760-150626782 CTGGGGCCAAGGAGGGGAAGAGG + Intronic
1000064714 5:157684566-157684588 CTGTGGCCCTGGAGAGGAGGAGG - Intergenic
1000205169 5:159051408-159051430 CTGCGGGAGCGGGGGGGAGGGGG - Intronic
1000241546 5:159413094-159413116 CTGCTGGCAAGGATGGCAGGCGG - Intergenic
1001106071 5:168855713-168855735 CTGGGGGCAGGGAGGGAATGGGG + Intronic
1001234775 5:170020168-170020190 CTGCGGGGATGGTGGAGAAGAGG - Intronic
1001286342 5:170426827-170426849 CTGCAGGCTGGTAGGGGAGGCGG - Intronic
1001366220 5:171143352-171143374 GTTGGGGCAGGGAGGGGAGGAGG + Intronic
1002320886 5:178375257-178375279 CTGGGGGAGAGGAGGGGAGGTGG + Intronic
1002419797 5:179139597-179139619 CCACGGGCATGGAGGAGAGGAGG - Intronic
1002900558 6:1406623-1406645 CGGGGTGCATGGAGAGGAGGAGG + Intergenic
1002929116 6:1621115-1621137 CGGGTGGCATGGAGGGGTGGTGG - Intergenic
1003869431 6:10390379-10390401 GAGCGGGCAGGGAGGGGAGTAGG + Intergenic
1004510269 6:16278974-16278996 CTGTGGGCATGGGAGGGAGCTGG + Intronic
1004620509 6:17326703-17326725 CTGAGGGCCTGGAGGCCAGGAGG + Intergenic
1005049145 6:21667275-21667297 ATGCAGGGATGGAGGGGATGGGG + Intergenic
1005327762 6:24719797-24719819 CTGCGGGGGTGGAAGGCAGGTGG - Exonic
1005495597 6:26385108-26385130 CTGAGGACATGGAGGTGCGGTGG + Exonic
1005500255 6:26423026-26423048 CTGAGGACATGGAGGTGCGGTGG + Intergenic
1005504721 6:26459574-26459596 CTGAGGACATGGAGGTGCGGTGG + Exonic
1005829529 6:29659412-29659434 CTACAGGCATGGAGGTGGGGTGG + Exonic
1006824097 6:36921447-36921469 CTGTGGAGATGGAGGGGAGAGGG + Intronic
1007556204 6:42768661-42768683 CACTGGGCATGGAGGGGAGAAGG - Intronic
1009593707 6:65708688-65708710 CAGAGGGCAAGGAGAGGAGGGGG - Intergenic
1010007453 6:71011068-71011090 CTGTGGGGATGGAGTGGTGGAGG + Intergenic
1010676096 6:78745436-78745458 CTGGGGGCAGGGATGGCAGGTGG + Intergenic
1011737872 6:90330979-90331001 GAGCGGGCTTGGTGGGGAGGAGG + Intergenic
1011914750 6:92489273-92489295 GTGGGGGCATGGGGGGCAGGTGG + Intergenic
1012314333 6:97767201-97767223 CAGGGGGCAGGGTGGGGAGGGGG - Intergenic
1013070269 6:106723005-106723027 GTGCGGGGTTGGTGGGGAGGTGG - Intergenic
1014693836 6:124594767-124594789 ATCCAGGCATGGAGGAGAGGAGG + Intronic
1014918769 6:127187102-127187124 CAGCGGGCATGGTGGTGAGATGG + Intronic
1015089003 6:129331384-129331406 CTGAGGGTAAGGATGGGAGGGGG - Intronic
1015245247 6:131067278-131067300 CTGCAGGCATGTAGTGGAGTGGG - Intergenic
1017318612 6:153062267-153062289 CTGGGGGTAGGGAGGAGAGGTGG - Intronic
1018063178 6:160106216-160106238 AGGCGGGCATGGCGTGGAGGAGG + Exonic
1018537472 6:164836701-164836723 CTGGAGGCATGGACAGGAGGTGG - Intergenic
1018675953 6:166222597-166222619 CTACGGGGATTGAGGGAAGGCGG + Intergenic
1018795220 6:167180071-167180093 CTGGGGGCCTGAAGAGGAGGGGG - Intronic
1018821100 6:167374991-167375013 CTGGGGGCCTGAAGAGGAGGGGG + Intronic
1018972429 6:168538396-168538418 CTGCTGGCATGTAGGGGAGTGGG + Intronic
1019381694 7:727409-727431 GTGCGGGCGTGGAGGGGGGCGGG - Intronic
1019406148 7:885300-885322 CAGCAGGCGTGGAGGGCAGGAGG - Intronic
1019411425 7:908427-908449 CTCCGGGCAGTGAGGGGAGCAGG - Intronic
1019498486 7:1352523-1352545 CTGGGGGCATGGTGTGGAGCTGG - Intergenic
1019732231 7:2634560-2634582 GCGGGGGGATGGAGGGGAGGTGG + Intronic
1020087924 7:5321419-5321441 CTGGGGCCAGGCAGGGGAGGGGG - Intronic
1021420926 7:20443761-20443783 ATGGAGGCATGGATGGGAGGAGG + Intergenic
1022282763 7:28927556-28927578 CCGGGGGCCGGGAGGGGAGGAGG + Intergenic
1022404824 7:30078892-30078914 CTGGGGGGATGGACAGGAGGTGG + Exonic
1022466962 7:30658428-30658450 CTGGGGGCCTGGAGGGGTTGGGG + Intronic
1023582703 7:41699810-41699832 CGGAGGGCAGGCAGGGGAGGGGG - Intronic
1023869310 7:44254336-44254358 CCTTGGGCGTGGAGGGGAGGTGG + Intronic
1024883662 7:54117065-54117087 CTGCAGCCAAGGAAGGGAGGAGG + Intergenic
1026273100 7:68853386-68853408 ATGTGGGGGTGGAGGGGAGGGGG - Intergenic
1026566874 7:71496554-71496576 CTTCGGGGAAGGAGGGCAGGTGG - Intronic
1027130247 7:75585568-75585590 CTGAGAGTGTGGAGGGGAGGGGG - Intronic
1029438608 7:100575547-100575569 CAGGGGGCATGCAGGGCAGGGGG + Intronic
1029488462 7:100857269-100857291 CAGAGGGAATGGAGGGCAGGAGG + Intronic
1029489224 7:100861369-100861391 CTGCGGGCATGGAGGGGAGGAGG - Intronic
1029577195 7:101411417-101411439 CTGCAGGCTGGGAGGGCAGGAGG + Intronic
1030260909 7:107563535-107563557 CTGGAGGCATGGGGGGGGGGGGG + Intronic
1031484449 7:122310754-122310776 CTGCGGGAATGCAGAGGAGAAGG - Intergenic
1032166953 7:129552999-129553021 GTGTGGGGATGGAGAGGAGGTGG - Intergenic
1032174319 7:129611584-129611606 CTGCGGGCAGGCAGCGGAGAGGG - Intergenic
1032324497 7:130914447-130914469 GTGCCTGCATGGTGGGGAGGGGG + Intergenic
1033220117 7:139522244-139522266 CTGCGGGTGTGGAGGGGGAGGGG + Intergenic
1033236016 7:139638322-139638344 AAGCGGGCAGGGAGGGGAGCAGG - Intronic
1033659100 7:143391536-143391558 CTGTGGGCAAGGAAGGGTGGGGG + Intronic
1034071241 7:148187962-148187984 ATGCGGGGATGGTGGGGTGGTGG - Intronic
1034222814 7:149459584-149459606 CTGCGGGCCTGGACGGGGAGGGG - Intronic
1034526878 7:151670211-151670233 CTGGGGGTATGGAGCAGAGGAGG - Intronic
1034829344 7:154295664-154295686 CTGAGGGTAGGGAGGGGAAGGGG - Intronic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1034988152 7:155530420-155530442 CAGGGGTCATGGAGGGGAGAGGG - Intronic
1035038085 7:155908372-155908394 CTGAGGGCAGGGAGGAGAGGGGG - Intergenic
1035061151 7:156070633-156070655 CTGCAGGAAGGGAGGGGAGGCGG - Intergenic
1035061525 7:156073024-156073046 CTGCTGGCACAGAGGGCAGGCGG + Intergenic
1035121628 7:156573163-156573185 CTGCGGCAATGGAGGGCAGAGGG + Intergenic
1035259788 7:157653969-157653991 CGGCGGGCATGGTGTGGAGTCGG - Intronic
1035259825 7:157654083-157654105 CGGCGGGCATGGTGTGGAGTCGG - Intronic
1035553099 8:544915-544937 GGGCGGGCCTGGTGGGGAGGGGG - Intronic
1035693093 8:1572586-1572608 CTGCTGGTATGGAGAGGAGAGGG + Intronic
1035732064 8:1860329-1860351 TCGGGGGCATGGAGAGGAGGAGG - Intronic
1035732086 8:1860396-1860418 TCGGGGGCATGGAGAGGAGGAGG - Intronic
1035889583 8:3329049-3329071 CTGTTGGCATGGAATGGAGGTGG + Intronic
1036950398 8:13133794-13133816 TTGCGGGAACGGAGGGGAAGCGG + Intronic
1037709223 8:21342346-21342368 CTGGAGGGATGGAGGGGTGGAGG + Intergenic
1037859070 8:22391986-22392008 TTGCAGGCAGGGAGGAGAGGAGG + Intronic
1037910257 8:22739896-22739918 CTGGGGGGATGGAGGGGGAGGGG + Intronic
1038296191 8:26292159-26292181 CGGGGGGCAAGGTGGGGAGGTGG - Intronic
1038400576 8:27281093-27281115 CTCCAGGCATGGCTGGGAGGAGG + Intergenic
1040546763 8:48404053-48404075 CTACGGGCCTGGAGGGCAGAGGG - Intergenic
1040879380 8:52189116-52189138 TTGGGGGCAAGGAGGGGAGATGG - Intronic
1040981790 8:53251813-53251835 CTGCGGGGCTGGAGGGGACGCGG - Intergenic
1041009625 8:53529269-53529291 CTGCAGGTGGGGAGGGGAGGAGG + Intergenic
1041423242 8:57692819-57692841 CAGAGGTCATGGAGGGGAGAGGG + Intergenic
1042816477 8:72882986-72883008 CCCCGGGAATGGAGGGGAAGTGG - Intronic
1043214981 8:77574355-77574377 CTGTGGGCCTGGGGTGGAGGTGG + Intergenic
1044115512 8:88328695-88328717 CTGCAGGCAAGAGGGGGAGGCGG + Intergenic
1044803773 8:95983755-95983777 GAGAGGGAATGGAGGGGAGGGGG + Intergenic
1044930257 8:97245291-97245313 CTGGGGGAATGAAGGGAAGGGGG - Intergenic
1048353611 8:133635488-133635510 CTGAGGGCAGAGAGGTGAGGGGG + Intergenic
1048361624 8:133701989-133702011 CTGAGGTGATGGTGGGGAGGGGG + Intergenic
1048484415 8:134833256-134833278 TTGCGGGGATGGGAGGGAGGTGG - Intergenic
1049036279 8:140078785-140078807 CTGGGGGCAGGGAGGGGAGGTGG - Intronic
1049270966 8:141696082-141696104 CTGAGGCCAGGGAGGTGAGGGGG + Intergenic
1049452634 8:142670189-142670211 GCGCGGGCAGGGAGGGGAGAGGG + Intronic
1049541329 8:143210504-143210526 CTGTGGGCAGGGAGCGGGGGTGG + Intergenic
1049595948 8:143483426-143483448 CTGGGGCAATGCAGGGGAGGTGG + Intronic
1049627904 8:143634482-143634504 CTCCGGGCCTGGATGAGAGGTGG + Intergenic
1049890326 9:63236-63258 GGGTGGGCATGGAGGGGAGAGGG + Intergenic
1049894070 9:97604-97626 TAGTGGGCATGGAAGGGAGGGGG - Intergenic
1053314601 9:37040929-37040951 CAGCTGGCGTGGAGGGGAGAGGG + Intergenic
1053354946 9:37437659-37437681 CTGGGGGCAGGGAGGGGCTGGGG - Intergenic
1053731791 9:41064421-41064443 GGGTGGGCATGGAGGGGAGAGGG + Intergenic
1053735296 9:41097688-41097710 TAGTGGGCATGGAAGGGAGGGGG - Intergenic
1054693083 9:68333709-68333731 TAGTGGGCATGGAAGGGAGGGGG + Intronic
1055767624 9:79681732-79681754 CTGGAGGCAGGGAGGGAAGGAGG + Intronic
1056493396 9:87130840-87130862 CTTCTTGCAAGGAGGGGAGGAGG - Intergenic
1056601934 9:88053389-88053411 CTCTGCGCAAGGAGGGGAGGAGG - Intergenic
1056666383 9:88584025-88584047 GTGCAGGCATGGAGAGAAGGTGG - Intronic
1056730990 9:89166569-89166591 CTGCGGGGAGGGAGGTCAGGCGG + Intronic
1056770853 9:89477021-89477043 CTGGAGGCATGGAGGAGAGTGGG + Intronic
1057307008 9:93918314-93918336 CAACGGTCATTGAGGGGAGGAGG - Intergenic
1057414244 9:94847213-94847235 CTGCAGGCATGGTGGGAGGGTGG - Intronic
1057837403 9:98456107-98456129 CAGCGGGCATGGAGTGTGGGCGG - Intronic
1058699587 9:107589414-107589436 CTGCTGGCATGCAGGGGTGAGGG + Intergenic
1059277057 9:113106333-113106355 CTGTGTGCAGGGAGGGGAGAGGG + Intergenic
1059279194 9:113118218-113118240 CTGTGTGCAGGGAGGGGAGAGGG - Intergenic
1060229630 9:121817270-121817292 ATGTGGGAATGAAGGGGAGGTGG + Intergenic
1060527515 9:124328800-124328822 CAGCGGGGCTGGCGGGGAGGGGG + Intronic
1060824121 9:126677786-126677808 CTCAGGGCATTGCGGGGAGGAGG + Intronic
1060868835 9:127022722-127022744 CTGCAGGTATCTAGGGGAGGAGG - Intronic
1060966932 9:127716748-127716770 CTGCAGGGAGGGAGGAGAGGCGG - Exonic
1061108710 9:128552237-128552259 CTGCGGGGAGGGAGGTGAGGCGG + Intergenic
1061375292 9:130220411-130220433 CTGCAGGCAAGGAGGAGAGAGGG + Intronic
1061433045 9:130543307-130543329 CTGGGGACATGCAGAGGAGGGGG - Intergenic
1061582439 9:131546058-131546080 CTGCGGGCAAGCCAGGGAGGGGG + Intergenic
1061681776 9:132246041-132246063 CTGGAGGCATGGAGGTGGGGGGG - Intergenic
1062013029 9:134276974-134276996 CTGGGGGCCTGTAGGGGATGGGG + Intergenic
1062085097 9:134644229-134644251 ATGCAGGCGTGGCGGGGAGGGGG + Intronic
1062085173 9:134644463-134644485 ATGCAGGCGTGGCGGGGAGGGGG + Intronic
1062085198 9:134644541-134644563 ATGCAGGCGTGGCGGGGAGGGGG + Intronic
1062107519 9:134764014-134764036 CTGGGGGCATTGTGGGGAGTCGG + Intronic
1062279954 9:135747403-135747425 CCGCCGGCAGTGAGGGGAGGAGG + Intronic
1062326812 9:136016493-136016515 CAGGGAGCATGGAGGGCAGGCGG - Intronic
1062398076 9:136360544-136360566 CTGCGGGGAGGGAAGGGCGGAGG + Intronic
1062447305 9:136600314-136600336 CTGGGGGCAGGGAGGGCCGGGGG + Intergenic
1062501740 9:136854739-136854761 CTGCGGGAAAGGACGGGAGTGGG - Intronic
1062527941 9:136985777-136985799 TTGGGGGCAGGGAGGGGTGGCGG + Intronic
1062558477 9:137128251-137128273 CACCGGGCAGGGTGGGGAGGGGG - Intergenic
1186081043 X:5932136-5932158 CTGGGGGTGTGGAGGGGAAGGGG - Intronic
1186730407 X:12403539-12403561 CGGCGGGCAGGGAGAGGAGTGGG - Intronic
1186753039 X:12641389-12641411 CTGAGAGCATGGAGGGGAGGGGG - Intronic
1187279725 X:17848704-17848726 GTAGGGGCATGGAGGGGTGGGGG + Intronic
1187699632 X:21952862-21952884 TTGCGGGGCGGGAGGGGAGGGGG - Intronic
1188963041 X:36516933-36516955 TTGTGGGACTGGAGGGGAGGTGG + Intergenic
1190303196 X:49067978-49068000 CAGCGGGCATGGAGGAAGGGTGG - Exonic
1190679253 X:52811024-52811046 GTAAGGGCATAGAGGGGAGGAGG + Intergenic
1192213666 X:69143217-69143239 TGGGGGGCATGGCGGGGAGGGGG + Intergenic
1192320514 X:70086808-70086830 CTGGGCGCATGGAGGGGTGGTGG + Intergenic
1192624660 X:72714698-72714720 CTGCGGGCTTGGGAGGGAGGAGG + Intergenic
1192683575 X:73280359-73280381 CTGGGGGGAAGGTGGGGAGGGGG + Intergenic
1192917281 X:75666224-75666246 CTCTGGGCATGGAGTGGAGAGGG + Intergenic
1193644263 X:84047597-84047619 CAGTGGGCTTGGAGGGGAGTGGG - Intergenic
1193746465 X:85288440-85288462 CAGTGGGCACTGAGGGGAGGTGG - Intronic
1193962210 X:87939929-87939951 CTGCTGGCAGGGAGGTGTGGAGG - Intergenic
1197728276 X:129790921-129790943 CTGCCTGCAGGGAGGGTAGGCGG - Exonic
1197749793 X:129956816-129956838 TTGCGGGGGTGGGGGGGAGGTGG - Intergenic
1197782362 X:130171399-130171421 CTGCGGGGATGGGGTGGGGGCGG - Intergenic
1199864111 X:151827636-151827658 CTGTGGGCCTGGAAGGAAGGAGG - Intergenic
1199881011 X:151974401-151974423 CGGCGCGCATCGAGGGGACGCGG + Intronic
1200080833 X:153575577-153575599 CTAAGGGCATGGAGGGGTGGGGG + Intronic
1200243668 X:154511397-154511419 CTGCCGGCCTGGAGTGAAGGGGG + Intronic
1200399886 X:156013300-156013322 CTGCAGGCATGCAGGGTGGGAGG - Intergenic
1200562170 Y:4718525-4718547 TTGGGGGAATGTAGGGGAGGGGG - Intergenic
1201424610 Y:13834334-13834356 GAGCCGGCATGGAGGGGAAGGGG - Intergenic
1201514135 Y:14799018-14799040 CTGGGGGCATGGAGGGGAAGGGG + Intronic
1202196676 Y:22305379-22305401 CTCAGGGCATGGAAGGGAGCCGG + Intergenic