ID: 1029494172

View in Genome Browser
Species Human (GRCh38)
Location 7:100888308-100888330
Sequence CCCCGTATGGTGCTGGTCGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 40
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 33}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029494161_1029494172 -6 Left 1029494161 7:100888291-100888313 CCCTCCATACCCCCATGCCCCGT 0: 1
1: 0
2: 1
3: 12
4: 219
Right 1029494172 7:100888308-100888330 CCCCGTATGGTGCTGGTCGAGGG 0: 1
1: 0
2: 0
3: 6
4: 33
1029494158_1029494172 6 Left 1029494158 7:100888279-100888301 CCCCACAGGAGGCCCTCCATACC 0: 1
1: 0
2: 2
3: 28
4: 174
Right 1029494172 7:100888308-100888330 CCCCGTATGGTGCTGGTCGAGGG 0: 1
1: 0
2: 0
3: 6
4: 33
1029494160_1029494172 4 Left 1029494160 7:100888281-100888303 CCACAGGAGGCCCTCCATACCCC 0: 1
1: 0
2: 1
3: 23
4: 267
Right 1029494172 7:100888308-100888330 CCCCGTATGGTGCTGGTCGAGGG 0: 1
1: 0
2: 0
3: 6
4: 33
1029494163_1029494172 -10 Left 1029494163 7:100888295-100888317 CCATACCCCCATGCCCCGTATGG 0: 1
1: 0
2: 0
3: 7
4: 81
Right 1029494172 7:100888308-100888330 CCCCGTATGGTGCTGGTCGAGGG 0: 1
1: 0
2: 0
3: 6
4: 33
1029494162_1029494172 -7 Left 1029494162 7:100888292-100888314 CCTCCATACCCCCATGCCCCGTA 0: 1
1: 0
2: 0
3: 13
4: 153
Right 1029494172 7:100888308-100888330 CCCCGTATGGTGCTGGTCGAGGG 0: 1
1: 0
2: 0
3: 6
4: 33
1029494156_1029494172 15 Left 1029494156 7:100888270-100888292 CCCTGCAGTCCCCACAGGAGGCC 0: 1
1: 1
2: 6
3: 32
4: 321
Right 1029494172 7:100888308-100888330 CCCCGTATGGTGCTGGTCGAGGG 0: 1
1: 0
2: 0
3: 6
4: 33
1029494154_1029494172 18 Left 1029494154 7:100888267-100888289 CCGCCCTGCAGTCCCCACAGGAG 0: 1
1: 2
2: 7
3: 49
4: 376
Right 1029494172 7:100888308-100888330 CCCCGTATGGTGCTGGTCGAGGG 0: 1
1: 0
2: 0
3: 6
4: 33
1029494157_1029494172 14 Left 1029494157 7:100888271-100888293 CCTGCAGTCCCCACAGGAGGCCC 0: 1
1: 1
2: 4
3: 25
4: 338
Right 1029494172 7:100888308-100888330 CCCCGTATGGTGCTGGTCGAGGG 0: 1
1: 0
2: 0
3: 6
4: 33
1029494159_1029494172 5 Left 1029494159 7:100888280-100888302 CCCACAGGAGGCCCTCCATACCC 0: 1
1: 0
2: 5
3: 19
4: 210
Right 1029494172 7:100888308-100888330 CCCCGTATGGTGCTGGTCGAGGG 0: 1
1: 0
2: 0
3: 6
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029494172 Original CRISPR CCCCGTATGGTGCTGGTCGA GGG Exonic
900251863 1:1675101-1675123 GCCTGTGTGGTGCTGGCCGAAGG + Intronic
900262274 1:1737957-1737979 GCCTGTATGGTGCTGGCCGAAGG + Intronic
900745598 1:4358583-4358605 TCCTGCATGGTGCTGGTCCAGGG - Intergenic
903128985 1:21266160-21266182 CCCCGTATGCTGCTGGGATAGGG + Intronic
905639191 1:39576829-39576851 CCCCGGGCGCTGCTGGTCGAAGG + Intergenic
906097806 1:43236031-43236053 CCCCGGAGGGTGCTGGGCCAGGG + Intronic
907914354 1:58854968-58854990 CTCAGTCTGGTGCTGGTTGATGG - Intergenic
914831975 1:151176832-151176854 CCCGGTATAGGGCTGGACGATGG + Exonic
915206490 1:154273916-154273938 CCCAGTCTGGTGCTGGTTGGGGG - Exonic
1067027104 10:42852788-42852810 CTCAGTATGGTGCTGGTGGAGGG - Intergenic
1091289527 11:134429999-134430021 CCAAGTATGGTGCTGGATGAAGG - Intergenic
1092178087 12:6424746-6424768 CCCTGTATGGTTCTGGGTGAGGG + Intergenic
1101866648 12:108525157-108525179 GCCCGTATGCTGCTGGTCACAGG + Intronic
1113504734 13:110807654-110807676 CCCCATATGGTGCTGGACAGTGG + Intergenic
1119378759 14:74215442-74215464 CCCTGGAAGGTGCTGGGCGATGG - Intergenic
1122740944 14:103871442-103871464 CCCAGGAAGGTGCAGGTCGATGG + Intergenic
1123426727 15:20177308-20177330 CTCAGTATGGTGCTGGTGGAGGG - Intergenic
1123535958 15:21183835-21183857 CTCAGTATGGTGCTGGTGGAGGG - Intergenic
1131566601 15:93491549-93491571 CCCAGAATGGTGCTGGGCGGGGG + Intergenic
1133401485 16:5490562-5490584 CCCTCCATGGTGCTGGCCGAGGG + Intergenic
1136857522 16:33672197-33672219 CTCAGTATGGTGCTGGTGGAGGG + Intergenic
1203119095 16_KI270728v1_random:1520682-1520704 CTCAGTATGGTGCTGGTGGAGGG + Intergenic
1144073513 17:11695781-11695803 CCCAATATGCTGCTGGTCTAGGG + Intronic
1160859764 19:1232842-1232864 CCCCGGATGGTGGTGTTCGTGGG - Intronic
929893265 2:45936565-45936587 CCCCGTGTGGCTCTGGTGGAAGG + Intronic
1170558017 20:17531129-17531151 CCCGGCATGGCGCTGCTCGAGGG + Exonic
1183278869 22:36921754-36921776 CCCCGTGGGCTGCTGGTCCACGG - Intronic
949454262 3:4222284-4222306 CACAGTATGGTGCTGGCCAAAGG - Intronic
956779587 3:72593602-72593624 CCCTGTCTGGTGTTGGTCCAGGG + Intergenic
967868795 3:194212680-194212702 CCCTGTATTGTGCTGGGGGAGGG - Intergenic
971760270 4:30756319-30756341 CCCCGTGTGGTGCTGTTGGGAGG - Intronic
979428944 4:120603442-120603464 CTCCATATGCTGCTGGTCCATGG - Intergenic
1022302686 7:29115854-29115876 CCCTGTGTGGTGCTGGTCTTGGG - Intronic
1023875211 7:44283020-44283042 CCCCGTATGGTGGGGTTCCATGG - Intronic
1024572149 7:50732221-50732243 GGCCCGATGGTGCTGGTCGAGGG - Intronic
1026964885 7:74433204-74433226 CCCCGAATGGTGCAGCTCCAGGG - Intergenic
1029494172 7:100888308-100888330 CCCCGTATGGTGCTGGTCGAGGG + Exonic
1032525356 7:132575698-132575720 CCGCGTATGTTGCTTGTCTAGGG - Intronic
1044096934 8:88078381-88078403 CCCCGTATGTTACTGCTCCATGG - Intronic
1199697195 X:150351262-150351284 ACCAGTATGGTGCTGGAGGAAGG + Intergenic