ID: 1029494372

View in Genome Browser
Species Human (GRCh38)
Location 7:100889283-100889305
Sequence TGGACTGGCCGCCGTACAGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 50}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029494372_1029494380 3 Left 1029494372 7:100889283-100889305 CCGCCTGTACGGCGGCCAGTCCA 0: 1
1: 0
2: 0
3: 2
4: 50
Right 1029494380 7:100889309-100889331 ACGCCCGCGGGCTGGCCCTCTGG 0: 1
1: 0
2: 0
3: 3
4: 88
1029494372_1029494378 -5 Left 1029494372 7:100889283-100889305 CCGCCTGTACGGCGGCCAGTCCA 0: 1
1: 0
2: 0
3: 2
4: 50
Right 1029494378 7:100889301-100889323 GTCCAGGTACGCCCGCGGGCTGG 0: 1
1: 0
2: 0
3: 3
4: 66
1029494372_1029494375 -10 Left 1029494372 7:100889283-100889305 CCGCCTGTACGGCGGCCAGTCCA 0: 1
1: 0
2: 0
3: 2
4: 50
Right 1029494375 7:100889296-100889318 GGCCAGTCCAGGTACGCCCGCGG 0: 1
1: 0
2: 0
3: 5
4: 62
1029494372_1029494376 -9 Left 1029494372 7:100889283-100889305 CCGCCTGTACGGCGGCCAGTCCA 0: 1
1: 0
2: 0
3: 2
4: 50
Right 1029494376 7:100889297-100889319 GCCAGTCCAGGTACGCCCGCGGG 0: 1
1: 0
2: 0
3: 9
4: 32

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029494372 Original CRISPR TGGACTGGCCGCCGTACAGG CGG (reversed) Exonic
906200549 1:43957413-43957435 TGGATTGGAAGCCGTAGAGGAGG - Exonic
915555190 1:156657330-156657352 GGGCCGGGCCGCCGTGCAGGGGG + Intronic
924847658 1:247789513-247789535 GGGCTTGGCTGCCGTACAGGGGG - Intergenic
1066615011 10:37285195-37285217 GGGACTGGCCGCCGTGGAGCAGG + Intronic
1067012874 10:42730888-42730910 TGGTCTGGCCTCCGAAGAGGTGG + Intergenic
1084298535 11:68229245-68229267 TGGACTGGCTGCTGGACTGGGGG - Intergenic
1091980186 12:4858328-4858350 TGGACTGGCCAGCTTGCAGGTGG + Intergenic
1096127686 12:49131509-49131531 CGGCCTGGCCGCCGCAGAGGCGG + Intergenic
1111556123 13:89883893-89883915 GGGACTGGCCGCCGTGGAGCAGG + Intergenic
1112518699 13:100077849-100077871 GGGACTGGGCGCCGTAGAGCAGG - Intergenic
1120439056 14:84512936-84512958 GGGACTGGGCGCCGTGCAGCAGG + Intergenic
1122172529 14:99888991-99889013 TGGATTGGGAGCCGGACAGGCGG + Intronic
1137870251 16:51943459-51943481 TGGACTGGCCTCCTTTCAGTTGG + Intergenic
1138459698 16:57140966-57140988 TGGCCTGGCACCCGAACAGGAGG - Intronic
1141831366 16:86511463-86511485 TGGAGAGGCTGCCGGACAGGGGG - Exonic
1150221224 17:63496950-63496972 TGGGCTGGCCGCAGTACAACTGG + Exonic
1152068488 17:78124086-78124108 TGCACTGGCTGCCATCCAGGGGG + Exonic
926084400 2:10011703-10011725 TGGACAGGCATGCGTACAGGCGG + Intergenic
926084406 2:10011732-10011754 TGGACAGGCGTGCGTACAGGCGG + Intergenic
926084412 2:10011761-10011783 TGGACAGGCGTGCGTACAGGCGG + Intergenic
945096404 2:206223467-206223489 TGGAGTGGCAGAGGTACAGGTGG + Intergenic
948460719 2:238128742-238128764 TGGCCTGGCCGCACTACAGCTGG + Exonic
1178327044 21:31654519-31654541 GGGACTGGGCGCCGTAGAGCAGG - Intergenic
1181130684 22:20729910-20729932 TGGACATGCCGCTGGACAGGGGG + Exonic
1182704685 22:32269768-32269790 TGGCCTGGGCGCAGTCCAGGGGG - Intergenic
1184059768 22:42074614-42074636 TGGCCTGGCCCCCCTACTGGTGG + Intronic
971377055 4:26063996-26064018 GGGACTGGGCGCCGTGCAGCAGG + Intergenic
973190259 4:47378069-47378091 GGGACTGGGCGCCGTAGAGCAGG + Intronic
974792715 4:66712443-66712465 GGGACTGGGCGCTGTACAGCAGG + Intergenic
975846991 4:78535323-78535345 TGGAATGGCCGCAGAACAGTAGG - Intronic
976812508 4:89111645-89111667 TGGTCTGGGCGCCGCGCAGGCGG + Intergenic
979082545 4:116361219-116361241 TGGACTGGCTGTTGTACATGGGG + Intergenic
981247537 4:142557499-142557521 TGGACTGCCAGCTGGACAGGTGG - Intronic
984317198 4:178142188-178142210 TGGACTGACTGCTGTACTGGGGG + Intergenic
985194396 4:187412563-187412585 TGGAATGGCCACTTTACAGGAGG + Intergenic
1002906974 6:1456996-1457018 GGGACTGGGCGCCGTAGAGCAGG + Intergenic
1003176911 6:3758452-3758474 GGGACTGGGCGCCGTAGAGCAGG - Intergenic
1004665479 6:17745333-17745355 TGGACTGGGCGCCGTGGAGCAGG + Intergenic
1009587702 6:65627876-65627898 GGGACTGGGCGCCGTAGAGCAGG - Intronic
1029494372 7:100889283-100889305 TGGACTGGCCGCCGTACAGGCGG - Exonic
1029746407 7:102517772-102517794 TGGACTGGGCGCCGCAGGGGGGG + Exonic
1030524500 7:110637095-110637117 TGGACTGGCTGCAATGCAGGAGG + Intergenic
1034097968 7:148426743-148426765 GGGACTGGGTGCCGTACAGCAGG - Intergenic
1035361774 7:158318168-158318190 TGGACAGGCCGCACCACAGGCGG + Intronic
1038778103 8:30549094-30549116 AGCACTGGCCACCGTACAGGAGG - Intronic
1044064475 8:87682674-87682696 TGGAGTGGCTGCCGCACATGTGG + Intergenic
1045743296 8:105387357-105387379 GGGACTGGGCGCCGTAGAGCAGG + Intronic
1053479767 9:38407473-38407495 TGGAATGGCAGGCTTACAGGCGG + Intergenic
1057076655 9:92141603-92141625 TGGGCTGTCCGCCATACCGGGGG + Intergenic
1060305329 9:122406225-122406247 GGGACTGGGCGCCGTAGAGCAGG + Intergenic
1061397050 9:130349007-130349029 GGGACTGGCCCTCGTCCAGGAGG - Intronic
1187904764 X:24055192-24055214 TGGACTGGCCTGGGTACAGGCGG - Intronic
1196775560 X:119333929-119333951 GGGACTGGCCGCAGTAGAGCAGG - Intergenic