ID: 1029494452

View in Genome Browser
Species Human (GRCh38)
Location 7:100889609-100889631
Sequence CAGTCTGCGCGCCGGTCCTG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 73}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029494452_1029494462 13 Left 1029494452 7:100889609-100889631 CCGCAGGACCGGCGCGCAGACTG 0: 1
1: 0
2: 0
3: 3
4: 73
Right 1029494462 7:100889645-100889667 CGGGCCTCGTTGATCACCGCAGG 0: 1
1: 0
2: 0
3: 0
4: 23
1029494452_1029494464 23 Left 1029494452 7:100889609-100889631 CCGCAGGACCGGCGCGCAGACTG 0: 1
1: 0
2: 0
3: 3
4: 73
Right 1029494464 7:100889655-100889677 TGATCACCGCAGGCCGCAATAGG 0: 1
1: 0
2: 0
3: 3
4: 50
1029494452_1029494458 -6 Left 1029494452 7:100889609-100889631 CCGCAGGACCGGCGCGCAGACTG 0: 1
1: 0
2: 0
3: 3
4: 73
Right 1029494458 7:100889626-100889648 AGACTGGGGACGCGCTCCCCGGG 0: 1
1: 0
2: 1
3: 6
4: 58
1029494452_1029494457 -7 Left 1029494452 7:100889609-100889631 CCGCAGGACCGGCGCGCAGACTG 0: 1
1: 0
2: 0
3: 3
4: 73
Right 1029494457 7:100889625-100889647 CAGACTGGGGACGCGCTCCCCGG 0: 1
1: 0
2: 0
3: 5
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029494452 Original CRISPR CAGTCTGCGCGCCGGTCCTG CGG (reversed) Exonic
900265114 1:1753401-1753423 CAGTCGGGGCACCCGTCCTGGGG - Intronic
902813521 1:18902863-18902885 CAATCAGCGGGGCGGTCCTGCGG + Intronic
905885812 1:41491266-41491288 CAGTCTGGGGGCTGGTTCTGTGG + Intergenic
913538267 1:119795045-119795067 CAGGCTGCTGGCCTGTCCTGCGG + Intronic
914928622 1:151909794-151909816 CAGTCGGCGCGCGGGTTCCGGGG - Exonic
915245298 1:154552026-154552048 CAGTCTGCCTGACAGTCCTGTGG - Intronic
919445855 1:197704188-197704210 CAGTCTGGGAGCCAGTCATGAGG + Intronic
1062829420 10:595689-595711 CAGGGTGGGCGCGGGTCCTGCGG - Intronic
1062909053 10:1200213-1200235 CCGTCTGCGGCCTGGTCCTGAGG + Intronic
1066220752 10:33335108-33335130 GAGTCTGCGCCCCGGTCGCGTGG + Intronic
1073863154 10:107770531-107770553 CAGTCTGCTGGCCTCTCCTGGGG + Intergenic
1083579117 11:63813638-63813660 AAGCCTGCGCGCCAGTCCTCCGG + Exonic
1084074447 11:66762242-66762264 CAGTTTGCGCGCGTGTTCTGCGG - Intronic
1106343258 13:28851759-28851781 CAGTTTCCGCCCCGGCCCTGTGG + Intronic
1107652038 13:42554742-42554764 CAGTCTGCCCACTTGTCCTGCGG + Intergenic
1107892616 13:44927523-44927545 CAGTCTGCGCCCCTCTCCTAAGG + Intergenic
1120814524 14:88841073-88841095 CACTCTGCGTGCTGGGCCTGAGG - Exonic
1123466326 15:20518841-20518863 CACTCTGCTCTCCTGTCCTGCGG + Intergenic
1123651788 15:22482197-22482219 CACTCTGCTCTCCTGTCCTGCGG - Intergenic
1123742207 15:23291056-23291078 CACTCTGCTCTCCTGTCCTGCGG - Intergenic
1123756883 15:23403791-23403813 CAGGCTGCCTGCCTGTCCTGTGG - Intergenic
1123761117 15:23433429-23433451 CACTCTGCTCTCCTGTCCTGCGG + Intergenic
1124277053 15:28334819-28334841 CACTCTGCTCTCCTGTCCTGTGG + Intergenic
1124305647 15:28576787-28576809 CACTCTGCTCTCCTGTCCTGTGG - Intergenic
1129844963 15:78763969-78763991 CCGCCTGCGCACCGGCCCTGCGG - Exonic
1130370781 15:83284264-83284286 CGGTCTCCGCGCCGGATCTGCGG - Intronic
1134169591 16:11957817-11957839 CAGTCTGCTGGCCTGCCCTGCGG + Intronic
1143045060 17:4071617-4071639 CAGTCAGCTTGCAGGTCCTGTGG - Intronic
1148751184 17:49946809-49946831 CAGACTGCGGGGCGGTCTTGAGG + Intergenic
1152245461 17:79182779-79182801 CAGACCGCGCGCCGGGCCTCCGG - Intronic
1152427931 17:80228725-80228747 CAGTCTACTGGCAGGTCCTGGGG + Intronic
1161571484 19:5033067-5033089 CAGCCTGCGCCGCGGGCCTGCGG + Intronic
1163265389 19:16217632-16217654 CAGTCTGCTGGCCTCTCCTGGGG - Intronic
1166703546 19:44895896-44895918 CAGAGTGTGCGTCGGTCCTGGGG - Intronic
1166996875 19:46723620-46723642 CAGGCTGCGTGCCGCTCCTGGGG - Intronic
1168122043 19:54256961-54256983 CTGCCTGCACGCAGGTCCTGGGG + Exonic
1168125488 19:54280264-54280286 CTGTCTGCACGCGGGTCCTGGGG + Exonic
1168126912 19:54289248-54289270 CAGTCTTCTCACCAGTCCTGGGG + Intergenic
1168173543 19:54607212-54607234 CAGTCTTCTCACCAGTCCTGGGG - Intronic
1168173679 19:54607883-54607905 CTGCCTGCACGCAGGTCCTGAGG - Intronic
925061023 2:890419-890441 CAGTGTGAGCTCCAGTCCTGGGG - Intergenic
925061044 2:890503-890525 CAGTGTGAGCTCCAGTCCTGGGG - Intergenic
938262761 2:129907050-129907072 CAGCCTGCGGGCCCCTCCTGCGG - Intergenic
944436516 2:199695950-199695972 CTGTCTGCTGGCCTGTCCTGGGG + Intergenic
1175822424 20:61917548-61917570 CACTCTGCGCCCCTGTCTTGGGG - Intronic
1181696010 22:24593080-24593102 CTGTCTGCGCCCCGCTCCCGGGG + Intronic
1182419380 22:30241535-30241557 CAGTGTGCAGGCAGGTCCTGAGG - Exonic
1183545991 22:38455143-38455165 CGGTCTGCGCGTGGGTCTTGGGG + Exonic
949948169 3:9206873-9206895 CAGTCTGCCTCCCGCTCCTGAGG + Intronic
950702026 3:14757421-14757443 CAGACTGCCCGCTGGTGCTGCGG + Exonic
952978807 3:38718868-38718890 CAGTCTGGGCCCCAGTGCTGTGG - Intronic
961369874 3:126422745-126422767 CAGTCTTGGCCCCTGTCCTGGGG - Intronic
961537093 3:127576885-127576907 CACTCTGCGTGCAGATCCTGTGG - Exonic
965040259 3:163499045-163499067 CAGGCTGCGCGCTGCGCCTGCGG + Intergenic
975148395 4:70994130-70994152 CAGACTGGGCGCCAGGCCTGCGG + Intronic
978596138 4:110379420-110379442 CAGTCTGCTGGCCTCTCCTGAGG + Intronic
978749693 4:112232335-112232357 CAGTCTGGGGTCCGGTCTTGGGG + Intronic
991300514 5:65125014-65125036 CAGTCTATGGGACGGTCCTGTGG - Intergenic
992699729 5:79329847-79329869 GAGTCTGCGCACAGGTCCTAAGG - Intergenic
993756335 5:91734921-91734943 CAGTCTGCGGGCAGGGGCTGGGG - Intergenic
996900859 5:128539224-128539246 CAGCCGGCGCCGCGGTCCTGGGG + Intronic
999337589 5:150735509-150735531 CAGTCTCCGAGCTGGTACTGGGG - Intronic
1002784491 6:391580-391602 CAGCCTTCACGCCGGCCCTGAGG + Intergenic
1004445172 6:15691418-15691440 CAGCCTGAGGTCCGGTCCTGAGG + Intergenic
1021101961 7:16594510-16594532 CAGTCTGCCAGCCTGTTCTGTGG - Intergenic
1025241745 7:57282379-57282401 CAGGCTGCTGGCCTGTCCTGTGG + Intergenic
1026166518 7:67914933-67914955 CAGGCTGCTGGCCTGTCCTGTGG + Intergenic
1026471140 7:70694691-70694713 CTGTCTCCCCGCCGCTCCTGCGG - Intronic
1029494452 7:100889609-100889631 CAGTCTGCGCGCCGGTCCTGCGG - Exonic
1043738278 8:83774951-83774973 CTGTCTGCTGGCCTGTCCTGGGG + Intergenic
1053542995 9:38993923-38993945 CAGTCTGCTCGCCCCTCCTGGGG - Intergenic
1053807438 9:41817440-41817462 CAGTCTGCTCACCCCTCCTGGGG - Intergenic
1054623154 9:67369987-67370009 CAGTCTGCTCACCCCTCCTGGGG + Intergenic
1186144270 X:6609521-6609543 CAGTCTGCCCACCGGAGCTGTGG - Intergenic
1189082680 X:37991470-37991492 CAGTGAGGGCGCCGGCCCTGTGG + Intronic
1191252353 X:58265603-58265625 CAGTTCCCGCGCCGGTCCCGCGG - Intergenic
1199136994 X:144265685-144265707 CAGTCTGCTGGCCCATCCTGGGG + Intergenic