ID: 1029494924

View in Genome Browser
Species Human (GRCh38)
Location 7:100891335-100891357
Sequence ATCCCTGCGGAAGGAAGGGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 361
Summary {0: 1, 1: 0, 2: 5, 3: 31, 4: 324}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029494917_1029494924 2 Left 1029494917 7:100891310-100891332 CCTTGGGGTCTCGGGGCTCATTG 0: 1
1: 0
2: 0
3: 15
4: 124
Right 1029494924 7:100891335-100891357 ATCCCTGCGGAAGGAAGGGAAGG 0: 1
1: 0
2: 5
3: 31
4: 324
1029494905_1029494924 29 Left 1029494905 7:100891283-100891305 CCGCCGTGTACGGGGGCCATTGT 0: 1
1: 0
2: 0
3: 1
4: 23
Right 1029494924 7:100891335-100891357 ATCCCTGCGGAAGGAAGGGAAGG 0: 1
1: 0
2: 5
3: 31
4: 324
1029494907_1029494924 26 Left 1029494907 7:100891286-100891308 CCGTGTACGGGGGCCATTGTGGG 0: 1
1: 0
2: 0
3: 3
4: 40
Right 1029494924 7:100891335-100891357 ATCCCTGCGGAAGGAAGGGAAGG 0: 1
1: 0
2: 5
3: 31
4: 324
1029494913_1029494924 13 Left 1029494913 7:100891299-100891321 CCATTGTGGGGCCTTGGGGTCTC 0: 1
1: 0
2: 2
3: 20
4: 167
Right 1029494924 7:100891335-100891357 ATCCCTGCGGAAGGAAGGGAAGG 0: 1
1: 0
2: 5
3: 31
4: 324
1029494904_1029494924 30 Left 1029494904 7:100891282-100891304 CCCGCCGTGTACGGGGGCCATTG 0: 1
1: 0
2: 0
3: 2
4: 32
Right 1029494924 7:100891335-100891357 ATCCCTGCGGAAGGAAGGGAAGG 0: 1
1: 0
2: 5
3: 31
4: 324

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029494924 Original CRISPR ATCCCTGCGGAAGGAAGGGA AGG Exonic
901613558 1:10518823-10518845 ATCCTTGTGCCAGGAAGGGAAGG - Intronic
902512139 1:16972341-16972363 ACACCTGGGGAAGAAAGGGAAGG - Exonic
902532197 1:17097726-17097748 ACCCCAGGGGAAAGAAGGGAAGG + Intronic
904388316 1:30162031-30162053 ACACCTGTGGAAGGCAGGGAAGG - Intergenic
904794112 1:33045835-33045857 ATCCCTGAGGCAGGCAGGAAGGG - Intronic
904866962 1:33587030-33587052 AGGACTGGGGAAGGAAGGGAAGG - Intronic
905243575 1:36596910-36596932 ATCCCTGGAGTAGGCAGGGAGGG - Intergenic
905417402 1:37813419-37813441 ATCCTTGCTAAAGGCAGGGAGGG + Exonic
905519323 1:38586068-38586090 ATTCCTGAGGAAGGAGGGGAAGG - Intergenic
905800040 1:40837604-40837626 ATTCTTGTGGAAGGGAGGGACGG + Intronic
907420102 1:54341496-54341518 ATCCTTGTGGAATGAATGGATGG - Intronic
909397626 1:75188031-75188053 TTCCATGTAGAAGGAAGGGAAGG - Intergenic
910131468 1:83912320-83912342 ATGCCAGCTGAAGGAATGGAAGG + Intronic
912308521 1:108595611-108595633 ATGCCAAGGGAAGGAAGGGAGGG + Intronic
912308540 1:108595701-108595723 ATGCCAAGGGAAGGAAGGGAGGG + Intronic
913446058 1:118951848-118951870 ATCCCTGGGCAAGGGTGGGAGGG + Intronic
914853813 1:151335404-151335426 ATCCATGTGGAAGGAAATGAAGG - Intergenic
916120649 1:161525396-161525418 ATTCCGGCGGAAGCATGGGAAGG + Exonic
916130414 1:161607028-161607050 ATTCCGGCGGAAGCATGGGAAGG + Intronic
916894356 1:169146679-169146701 ATGGCTGTGGAAGGAAGGGAAGG - Intronic
919142346 1:193588599-193588621 TTCCCTGCAGAGGGAAAGGAGGG - Intergenic
919665307 1:200285715-200285737 ATCCCCTCTCAAGGAAGGGAAGG + Intergenic
919773476 1:201178024-201178046 ATCCCTGCTGAAGACAGGGATGG + Intergenic
920498412 1:206471269-206471291 AGCCCTGAGGAGGGAGGGGAGGG + Intronic
921045730 1:211476712-211476734 ATGCCTGCGGCTCGAAGGGAAGG + Exonic
921101580 1:211933393-211933415 ATCCCTGGGGAAGTGAGAGAGGG - Intergenic
921341522 1:214138957-214138979 ATCCCTCAGGAAGGAGTGGAAGG + Intergenic
923617338 1:235548709-235548731 GTCCCTGCTGTAGGAAGGGAGGG + Exonic
1063787262 10:9400009-9400031 ACCCCTGCCAAAAGAAGGGAGGG - Intergenic
1063953076 10:11242416-11242438 GTCTCTGCTGTAGGAAGGGAGGG - Intronic
1064304312 10:14151730-14151752 TTCCCTGGGGAAGGGAGGGAGGG - Intronic
1065019456 10:21492370-21492392 ATGCCTACTGAAGGAAGGGTTGG - Intergenic
1066529992 10:36327108-36327130 ATCCCTGCAGAAAGAAGCAAGGG + Intergenic
1067203945 10:44197972-44197994 CTCCCAGGGGCAGGAAGGGAAGG - Intergenic
1067691996 10:48508030-48508052 ATCCCAGTGGAAGGCAGGGATGG - Intronic
1069828781 10:71270330-71270352 GACTCTGCGGAAGGGAGGGAGGG + Intronic
1070376464 10:75836138-75836160 ATGGCTGAGGAAGGATGGGAAGG + Intronic
1070958049 10:80477671-80477693 ATCACGGTGGAAGGAAAGGAAGG - Intronic
1071011313 10:80944102-80944124 ATTCCTGCTGAAGGCAGGGCAGG + Intergenic
1071251476 10:83823963-83823985 GAGCCTGGGGAAGGAAGGGAGGG - Intergenic
1071449390 10:85779946-85779968 ATGCCTGCCGGAGAAAGGGAAGG + Intronic
1071964972 10:90843196-90843218 TTGACTGCGGAAGGAAGGGAGGG - Intronic
1072711066 10:97715698-97715720 TTCCCTGGGGAAGAAAGAGAAGG - Exonic
1073511540 10:104045693-104045715 ATTTTTGTGGAAGGAAGGGATGG - Intronic
1073559273 10:104482980-104483002 ATCCCTTAGGAATGCAGGGATGG - Intergenic
1074266882 10:111913544-111913566 ATCTCTGCGGAATGCAGGGATGG - Intergenic
1075738530 10:124679135-124679157 AGCCCAGCGGAAGGAAGCGTGGG + Intronic
1076215086 10:128686974-128686996 GTGCCTGTGGAAGGAAGGGCAGG + Intergenic
1076426568 10:130371365-130371387 ATCCCTGGGGCATGAAGGGAAGG - Intergenic
1076838985 10:133036105-133036127 ATCCCTGCTGTAGGAAGCGAGGG + Intergenic
1076924439 10:133475302-133475324 ATCCATGTGGAAGGCAGGCATGG - Intergenic
1077711212 11:4538986-4539008 CTCCGTGAGGAAGGATGGGAGGG + Intergenic
1078728329 11:13953131-13953153 ATGCCTGCTGAAGGAAAGAATGG - Intergenic
1079614173 11:22470251-22470273 ATCATGGCGGAAGGCAGGGAAGG + Intergenic
1081764436 11:45599682-45599704 AACCCTGCGGAATAGAGGGAGGG - Intergenic
1084007263 11:66329974-66329996 ATCACTGGGGAGGGCAGGGAGGG + Intergenic
1085269624 11:75262649-75262671 ATTCCTGCGTCAGGCAGGGAAGG + Intergenic
1085448548 11:76617087-76617109 TGCCCTGGGAAAGGAAGGGAGGG - Intergenic
1087262502 11:96026513-96026535 ATCACCTCTGAAGGAAGGGAGGG - Intronic
1088174830 11:107040692-107040714 ATCCCTGCTCCAGGATGGGATGG - Intergenic
1088804478 11:113339559-113339581 ATATTTGTGGAAGGAAGGGAGGG - Intronic
1088851763 11:113709230-113709252 AACCCTGAGGAAGGGAGAGAAGG + Intergenic
1088907040 11:114162782-114162804 ACCCATGCGGACCGAAGGGAGGG - Intronic
1089257506 11:117201645-117201667 AGCCCTGAGAAAGGAAGGGCAGG + Intronic
1089419319 11:118319364-118319386 ATCCTTGGGGCAGGAAGGGCAGG - Intergenic
1090074944 11:123574496-123574518 GGCCCTGGGGAAGGAAGGGAAGG + Intronic
1090905464 11:131070742-131070764 ATCCCTTAGGAAGGAAAAGACGG - Intergenic
1091173867 11:133542600-133542622 AGCCCTGCAGAAGGCAGAGATGG + Intergenic
1091353076 11:134913328-134913350 ATCCATGAGGAGGGAGGGGAGGG - Intergenic
1091607935 12:1972820-1972842 ATCAGTGAGGAAGGGAGGGAGGG + Intronic
1091727542 12:2856347-2856369 ATCCCTGGGGATGGATAGGAGGG - Intronic
1096148333 12:49294239-49294261 ATTCCTGAGGTAGGAAGGGGAGG - Exonic
1096570954 12:52522834-52522856 TTCACTGTGGCAGGAAGGGAGGG + Intergenic
1096580385 12:52581153-52581175 CACCCTGCGGGTGGAAGGGATGG + Intergenic
1096633998 12:52947169-52947191 ATCCCTGCTGAATGAAGTGTTGG - Intronic
1096973438 12:55685005-55685027 ATCTCTGGGGAAGGGATGGAGGG + Exonic
1097991100 12:65834642-65834664 ATACTTGTTGAAGGAAGGGAAGG - Intronic
1098115617 12:67173274-67173296 ATACCTGTGGCAAGAAGGGAAGG + Intergenic
1099844719 12:88015130-88015152 CTCTCTGGGGAAGGAAGAGAGGG - Intronic
1103933678 12:124463894-124463916 ATTCAGGCGGCAGGAAGGGAGGG - Intronic
1103983398 12:124751234-124751256 ATTCCAGCAGAAGCAAGGGAAGG - Intergenic
1104551614 12:129762232-129762254 ATCCTAGCTGAGGGAAGGGATGG + Intronic
1105525812 13:21176893-21176915 GTGCCTGCGGAAGAGAGGGACGG - Exonic
1105724917 13:23154105-23154127 AACCCTGGGGATGGAGGGGAAGG - Intergenic
1106118633 13:26838711-26838733 GTCCCTGCGGACGGAAGTGTTGG + Intergenic
1106235019 13:27854053-27854075 ATCACTGTGGAAGGAAAGGAGGG - Intergenic
1107028614 13:35828736-35828758 ATCACTTCGGAGGGAAGGGGAGG - Intronic
1107662340 13:42651536-42651558 CTACCTGCAGAAGGAGGGGAAGG - Intergenic
1111382911 13:87482527-87482549 ATGCCTTAGGAAGGAAAGGAGGG - Intergenic
1111964290 13:94845646-94845668 ATCCCTGCGGGTGGGAGGGCTGG + Intergenic
1112837422 13:103533176-103533198 ATCCCTCAGGAAGGAACAGAAGG + Intergenic
1113379400 13:109787679-109787701 GCCCCTGTGGAAGGAAGGGGGGG - Intergenic
1113452201 13:110419117-110419139 CACACTGCGGAAGGGAGGGAGGG + Intronic
1113619168 13:111701339-111701361 GTCCCTGAGGACGGAAGGCAGGG + Intergenic
1113624697 13:111786600-111786622 GTCCCTGAGGACGGAAGGCAGGG + Intergenic
1114528619 14:23381458-23381480 ACCCCTGGGGAAGACAGGGAGGG + Intergenic
1117478185 14:56118344-56118366 AGCCCCGCGGGAGGGAGGGAAGG - Intronic
1121095597 14:91216087-91216109 ATCCCAGCGGGAGGAATGGGGGG + Intronic
1121412457 14:93757343-93757365 TTCCCTTCGGAGGGATGGGAGGG + Intronic
1122140020 14:99657490-99657512 ACCCCTGCTGGAAGAAGGGAAGG + Intronic
1122256832 14:100484512-100484534 ATGCTTGCGAGAGGAAGGGAGGG + Intronic
1122324799 14:100875663-100875685 CTCCCTCCTGCAGGAAGGGAGGG - Intergenic
1122677893 14:103432432-103432454 AGGCCAGTGGAAGGAAGGGAGGG - Intronic
1122856570 14:104563045-104563067 CTCCCTGAGGGAGGGAGGGAGGG + Intronic
1123168476 14:106349014-106349036 ATCCTTGTGGTAGGAAAGGAAGG - Intergenic
1124483984 15:30100128-30100150 GTCCCTGGGGGAGGAAAGGAGGG + Intergenic
1124519596 15:30397096-30397118 GTCCCTGGGGGAGGAAAGGAGGG - Intergenic
1124539057 15:30569125-30569147 GTCCCTGGGGGAGGAAAGGAGGG + Intergenic
1124614864 15:31234261-31234283 ACCCCAGCGGAGGAAAGGGAAGG - Intergenic
1124759593 15:32438447-32438469 GTCCCTGGGGGAGGAAAGGAGGG - Intergenic
1127672237 15:61206235-61206257 ATTATTGCAGAAGGAAGGGAGGG + Intronic
1128087096 15:64894061-64894083 CTACCTGCGGAAGGCAGGGCGGG - Intronic
1128370910 15:67038510-67038532 ATCCATGCTGAAGGCAGGGCAGG - Intergenic
1128692590 15:69736428-69736450 AACACTGCAGAAGGAAGGGCAGG + Intergenic
1128713184 15:69887359-69887381 ATAGATGTGGAAGGAAGGGAGGG - Intergenic
1129154708 15:73710558-73710580 ACCCCCGCAGAAGGAAGGGCAGG + Intronic
1129727542 15:77909257-77909279 GACCCTGGGGAAGGCAGGGAGGG - Intergenic
1129840341 15:78739708-78739730 GACCCTGGGGAAGGCAGGGAGGG + Intergenic
1130258558 15:82337283-82337305 GACCCTGGGGAAGGCAGGGAGGG - Intergenic
1130270123 15:82441799-82441821 GACCCTGGGGAAGGCAGGGAGGG + Intergenic
1130275848 15:82476042-82476064 GACCCTGGGGAAGGCAGGGAGGG - Intergenic
1130462462 15:84169120-84169142 AACCCTGGGGAAGGCAGGGAGGG + Intergenic
1130468207 15:84203434-84203456 GACCCTGGGGAAGGCAGGGAGGG - Intergenic
1130490213 15:84425673-84425695 GACCCTGGGGAAGGCAGGGAGGG - Intergenic
1130496057 15:84470108-84470130 GACCCTGGGGAAGGCAGGGAGGG + Intergenic
1130501802 15:84504423-84504445 AACCCTGGGGAAGGCAGGGAGGG - Intergenic
1130590500 15:85208032-85208054 GACCCTGGGGAAGGCAGGGAGGG - Intergenic
1130596365 15:85252677-85252699 GACCCTGGGGAAGGCAGGGAGGG + Intergenic
1130636168 15:85622384-85622406 GGCCCTGAGGAAGGAAGGAATGG + Intronic
1131143904 15:89999903-89999925 AGCCGGGAGGAAGGAAGGGAAGG + Intergenic
1133551085 16:6855234-6855256 ATGCATGAGGAAGGGAGGGAGGG + Intronic
1133765016 16:8831922-8831944 TTCCCTGGAGAAGGGAGGGAAGG - Intronic
1134515169 16:14881365-14881387 ATCCCTCCGGCAGGAAGGTGTGG + Intronic
1134702844 16:16280010-16280032 ATCCCTCCGGCAGGAAGGTGTGG + Intronic
1134964699 16:18432105-18432127 ATCCCTCCGGCAGGAAGGTGTGG - Intronic
1134968986 16:18514640-18514662 ATCCCTCCGGCAGGAAGGTGTGG - Intronic
1135950969 16:26913771-26913793 AGCCGTGCAGCAGGAAGGGACGG - Intergenic
1136186598 16:28592137-28592159 ATGCCTGGGGGAGGAAGGCAGGG + Exonic
1136189219 16:28605930-28605952 ATGCCTGGGGGAGGAAGGCAGGG + Exonic
1136251501 16:29008521-29008543 ATCCCTGAGAAAGACAGGGAGGG + Intergenic
1136317813 16:29464444-29464466 ATGCCTGGGGGAGGAAGGCAGGG - Exonic
1136432388 16:30203789-30203811 ATGCCTGGGGGAGGAAGGCAGGG - Exonic
1136622752 16:31441248-31441270 ACCCCTGAGGAAGGTAGGTAGGG - Intronic
1138202541 16:55100917-55100939 ATTTCTGTGGAAGGAAGAGAGGG + Intergenic
1140761126 16:78109705-78109727 ATCCCTGGGTCAGGAAGGGAAGG - Intronic
1140829778 16:78740441-78740463 CTGGCTGCGGAAGGGAGGGAAGG + Intronic
1141895708 16:86957517-86957539 GTCCCTCCGGAGGGGAGGGAAGG - Intergenic
1142351951 16:89584595-89584617 ATCCCTGGGGGCGGGAGGGAGGG + Intronic
1142482985 17:229915-229937 GTCCCTGAGGGAGGGAGGGAGGG - Intronic
1143015369 17:3888722-3888744 ATCCAGGCGGGAGGGAGGGATGG - Intronic
1143074377 17:4327945-4327967 GTTCCTGCAGAAGGAAGAGAAGG - Intronic
1144166907 17:12621294-12621316 ATACCTGTTGAATGAAGGGATGG + Intergenic
1144213745 17:13036479-13036501 ATACCTGTGGAAGGAAGGGAAGG + Intergenic
1144265349 17:13563135-13563157 ATCCCTGGAGAAGGCAGGGCTGG - Intronic
1144343054 17:14326389-14326411 ATGTCTGTGGAAGCAAGGGATGG + Intronic
1144622166 17:16824504-16824526 ATCCCTGCAGAAGAAGGAGACGG - Intergenic
1144884258 17:18448209-18448231 ATCCCTGCAGAAGAAGGAGACGG + Intergenic
1145147973 17:20496168-20496190 ATCCCTGCAGAAGAAGGAGACGG - Intergenic
1145274155 17:21420130-21420152 ATCCTTGCAGAAGGAAGGGAAGG - Intergenic
1145312017 17:21706029-21706051 ATCCTTGCAGAAGGAAGGGAAGG - Intergenic
1145815762 17:27793851-27793873 ATCGCCGGGGAAGGCAGGGAAGG - Intronic
1145868834 17:28257309-28257331 ATGCCTGGGGAGGGAAGGGGAGG + Intergenic
1147543944 17:41383973-41383995 TTCCCTGCGGAACAAAGGCAAGG - Intronic
1147566270 17:41538134-41538156 ATGCCTGCTGAGGGAGGGGAAGG + Intergenic
1148606159 17:48930588-48930610 ACACCTGCTGAAGGAAGGGTTGG - Exonic
1149098050 17:52868931-52868953 ATCACTGCGGCAGGAAAGAATGG + Intronic
1149682477 17:58515771-58515793 ATGTCTATGGAAGGAAGGGAGGG + Intronic
1149682766 17:58517542-58517564 AGCCCCAGGGAAGGAAGGGAGGG + Intronic
1151158324 17:72142997-72143019 ATGGATGCTGAAGGAAGGGATGG + Intergenic
1151236638 17:72724958-72724980 ATCTCTGTGGATTGAAGGGATGG + Intronic
1152232508 17:79121159-79121181 ATCCCTGGGGACAGAAGGGAGGG - Intronic
1152408269 17:80109560-80109582 CTGCCTGCAGAAGGCAGGGATGG - Intergenic
1152709941 17:81866397-81866419 CTCCCTGCGGAATCAAGGGCTGG + Intergenic
1203160245 17_GL000205v2_random:42632-42654 ATTTCTGATGAAGGAAGGGATGG - Intergenic
1153224128 18:2884945-2884967 ATACCTGTGGACAGAAGGGATGG - Exonic
1153522761 18:5967815-5967837 CTCCCTGGGGCAGGAGGGGACGG + Intronic
1155165920 18:23232426-23232448 ATACCTGCGGTGGGCAGGGAGGG - Intronic
1155373008 18:25123609-25123631 TTCCTTGCAGAGGGAAGGGAGGG + Intronic
1157573296 18:48727628-48727650 AGCCCAGCGGAGAGAAGGGATGG - Intronic
1158462128 18:57655702-57655724 CACCCTGTGGATGGAAGGGATGG - Intronic
1159646154 18:70920990-70921012 CTCCCTGCTGGAGCAAGGGATGG + Intergenic
1160298535 18:77658577-77658599 ACCCCGGGGGAAGGGAGGGAAGG + Intergenic
1160442469 18:78902974-78902996 CTCCCTCCGCGAGGAAGGGAGGG + Intergenic
1160629767 18:80238777-80238799 AGCCCTGAGGCAGGAAGGCAAGG + Intronic
1160683798 19:424261-424283 ATCCACGGGGAAGGAAGGAACGG + Intronic
1160713795 19:565781-565803 CTCCATCAGGAAGGAAGGGAGGG - Intergenic
1160793075 19:931919-931941 CTCCCTGTGGAGGGAAGGGGAGG + Intronic
1161350604 19:3789313-3789335 TTCCCTGCTGAACGAAGAGAAGG - Exonic
1162788978 19:13053467-13053489 CTCCAGGCGGAAGGGAGGGAAGG - Intronic
1162821668 19:13226859-13226881 ACTCCAGGGGAAGGAAGGGAGGG + Intronic
1163220355 19:15914191-15914213 ACTCCTGAGGAAGGGAGGGAAGG + Intronic
1163993439 19:21020996-21021018 GTCACTGCGCAAGGAAGAGACGG - Intronic
1165826719 19:38709830-38709852 ATGCCTGCTGCAGGTAGGGAGGG - Intronic
1167651128 19:50729643-50729665 ATCTCTATGGAAGGAAGGGAGGG + Intergenic
1168326330 19:55540604-55540626 GTCCTTGAGGGAGGAAGGGATGG + Intergenic
925215356 2:2090033-2090055 ATACCTGCAGAGGGATGGGATGG - Intronic
926240525 2:11081255-11081277 CTCCTTCAGGAAGGAAGGGAGGG - Intergenic
926578780 2:14612055-14612077 ATCCCTGTGGAAGGGCAGGAAGG + Intergenic
927810898 2:26179728-26179750 ATTACTGCGGGAGGAAGGAAGGG - Intronic
929643636 2:43606505-43606527 ATCCCTGGGACAGGAAGAGATGG + Intergenic
930805361 2:55484280-55484302 ATACCTGTAGAAGGAAGGGAAGG - Intergenic
931681403 2:64752017-64752039 ATCCGTGCGGGAGGGAGGGTTGG - Intergenic
935430708 2:102972926-102972948 CTCCCAGCTGAAGGAAAGGATGG - Intergenic
935796016 2:106642248-106642270 ATCCCTGCAGGAGGAAGGCTTGG - Intergenic
936519092 2:113200582-113200604 ATCATTGCGGAAGGGAGGGCTGG - Intronic
936913343 2:117615053-117615075 ACACCTGTGGAAGGAAGAGAAGG + Intergenic
937913406 2:127087303-127087325 ATCTCTGCAGCTGGAAGGGAAGG + Intronic
937992649 2:127673088-127673110 ATCCCTGTGTATGGAAGGCAGGG + Intronic
942047079 2:172106041-172106063 ACCCCTGCGCCAGGCAGGGATGG + Intergenic
945239048 2:207659868-207659890 ATGTCTTCTGAAGGAAGGGAGGG - Intergenic
945431610 2:209771871-209771893 ATGGCTGCGGGAGGAGGGGAGGG - Intergenic
947670540 2:231932909-231932931 ATCCCTGAGGGAAGAAGGCAAGG - Intergenic
947993668 2:234508706-234508728 ATCCCTGAGCAAGGATGGGGTGG + Intergenic
1168981388 20:2006913-2006935 CGCCCTGCGGAGGCAAGGGAAGG - Intergenic
1169472249 20:5896697-5896719 ATCCCTGAAGGAGGGAGGGAAGG + Intergenic
1172288472 20:33758027-33758049 ATCATTGTGGAAGGAAGGAAGGG - Intronic
1172629450 20:36368128-36368150 ATAGCTGTGGAAGGAAGGAAAGG + Intronic
1172807928 20:37626266-37626288 ATACCTGCGGATGAGAGGGAAGG + Intergenic
1173669256 20:44786369-44786391 CTGCCTGGGGAAGGATGGGATGG - Intronic
1175125771 20:56750592-56750614 ATCGCCGTGGAAGGCAGGGAGGG + Intergenic
1175298001 20:57922614-57922636 ATCCCAGCGCATGGAAGGGCTGG + Intergenic
1175785210 20:61707928-61707950 ATGCCTGCGGATGACAGGGAGGG + Intronic
1176197635 20:63844687-63844709 TTTCCTGAGGAAGGAAGGGTGGG + Intergenic
1176212912 20:63933935-63933957 CTCCCTGCGGAAGGTGGGGTAGG + Exonic
1177689141 21:24481272-24481294 ATGGCTGGGGAAGGAAGGGCAGG - Intergenic
1178889973 21:36513135-36513157 ATCACTGCAGAGGGATGGGATGG - Intronic
1178948812 21:36969094-36969116 ATGCCTGGGGAAGGAATAGAGGG + Intronic
1179434732 21:41352407-41352429 TTCCCTGAGAAAGAAAGGGAAGG + Intronic
1179803848 21:43825100-43825122 ATCCCTGGGGCAGGAAGCCAAGG + Intergenic
1180073470 21:45450176-45450198 GTCCCTGGGGAAGGAGGGGAGGG + Intronic
1180610128 22:17090830-17090852 ATCTCTGGGGCAGGAGGGGAGGG - Intronic
1181363900 22:22358871-22358893 AGCACTGGGGAAGGGAGGGAGGG - Intergenic
1181965752 22:26655782-26655804 AGCCCTGGGGAAAGAAAGGAAGG - Intergenic
1183253374 22:36745514-36745536 TGCCCTGCACAAGGAAGGGAGGG + Intergenic
1183432889 22:37776145-37776167 AGCCCTGAGGAGGGATGGGAGGG - Exonic
1184755730 22:46514835-46514857 ATCCCTGGGGTGGGAAGGGGTGG - Intronic
1184978901 22:48082158-48082180 TCCCCTGCGGGAGGAAGGGGCGG - Intergenic
1185417898 22:50720165-50720187 TCCCCTGCGGACGGAAGGGCCGG - Intergenic
950456036 3:13093316-13093338 ATCCCTGCAGCAGGCAGGGCTGG - Intergenic
950658461 3:14451983-14452005 ACTCCTGCTGAAGGAAAGGACGG - Intronic
950673406 3:14540365-14540387 CTCCCTGGGGAGGGGAGGGAGGG - Exonic
952840703 3:37642999-37643021 GTCTCTGCAGAAGGAATGGAAGG + Intronic
954007021 3:47599514-47599536 ATCCCTGTGGAAGAAAGGGAAGG + Intronic
954081583 3:48215347-48215369 ATCCCTGGAGAAGGAGTGGAGGG - Intergenic
954677573 3:52324293-52324315 ATCCCTGCTGAAGGAGGAAAGGG + Intronic
954804265 3:53206846-53206868 ATCACTGAAGGAGGAAGGGATGG + Intergenic
954852448 3:53615213-53615235 ACCCCTGAGGAAGGAAGGTTTGG - Intronic
956121226 3:65967819-65967841 CTCCCAGGGGATGGAAGGGAAGG + Intronic
956756528 3:72393399-72393421 CTCCCCACAGAAGGAAGGGAGGG + Intronic
956770642 3:72522953-72522975 ATCCCGGGAGAAGGGAGGGAGGG + Intergenic
959530313 3:107429074-107429096 ATACCTTTGGAAGGGAGGGAAGG - Intergenic
961033933 3:123629329-123629351 TTCCCTGAGGAAGGGAGGGTGGG - Intronic
961862534 3:129928090-129928112 ATGCTTGTGGAAGGAAGGAAGGG + Intergenic
962076799 3:132090688-132090710 ATATATGCAGAAGGAAGGGAAGG + Intronic
962844155 3:139260600-139260622 ATACTTGTGGAAGGAAGGGAGGG + Intronic
964297044 3:155245363-155245385 GTCCCAGCTCAAGGAAGGGAGGG - Intergenic
967876345 3:194270775-194270797 AGGCCTGCGGTTGGAAGGGAAGG - Intergenic
968600971 4:1509175-1509197 CTCCCTGAGGAAGGGAGGGAGGG - Intergenic
969346789 4:6575190-6575212 ATCCCTGCGGCAGGCCGGGAAGG - Exonic
969647564 4:8441204-8441226 GGCCATGCTGAAGGAAGGGAGGG + Exonic
970607342 4:17693000-17693022 AACCCTGGGGAAGGAAAGGCAGG + Intronic
972327036 4:38026481-38026503 ATCACTACGGATGGCAGGGAGGG - Intronic
974653448 4:64785966-64785988 ATTCCTGCGGAAACAAGGAAAGG + Intergenic
978725334 4:111962807-111962829 AGACCTGAGGAAGCAAGGGAGGG - Intergenic
978814827 4:112892178-112892200 TTCCAGGGGGAAGGAAGGGATGG + Intronic
980952359 4:139394166-139394188 ATCACTGGGGAAGGGAGGAAAGG - Intronic
981967538 4:150623026-150623048 AGCCCAGCAGAAGTAAGGGAAGG - Intronic
983911649 4:173246474-173246496 ACCCCTGCAGAAGGAAAGGCAGG + Intronic
985509277 5:303052-303074 CTCCCTGAGGAAGGAAAGGAAGG + Intronic
985738996 5:1603840-1603862 CTCCCTGAGGAAGGAAAGGAAGG - Intergenic
986284578 5:6349769-6349791 ACCCCTGCGGCAGGAAGGCGAGG + Intergenic
986705317 5:10449786-10449808 AGCCCTGGGGAGGGAAGGCAGGG - Intronic
986720372 5:10556804-10556826 ATCCTTGGGGAAGCCAGGGATGG + Intergenic
988732707 5:33989213-33989235 ATCCCTTTTGAAAGAAGGGATGG + Exonic
989464298 5:41737254-41737276 ATCCCTGTGAAAAGAAGAGATGG + Intronic
991715444 5:69447237-69447259 GACTCTGCAGAAGGAAGGGAAGG + Intergenic
993375151 5:87142038-87142060 ATTACAGTGGAAGGAAGGGAAGG + Intergenic
993512428 5:88788072-88788094 ATGCCTGCTGCAGGAATGGAAGG + Intronic
994038088 5:95225677-95225699 AACCCTGAGGAAAGACGGGAAGG - Intronic
996331576 5:122335625-122335647 ACACCTGTGGAAGGAAGGGAAGG + Intronic
997791446 5:136766016-136766038 ACACCTGTGGAAGGAAGGGGAGG - Intergenic
997977937 5:138451143-138451165 ACCCCTGAGGCAGCAAGGGATGG + Intergenic
998815051 5:146005547-146005569 ATCAGTGTTGAAGGAAGGGATGG + Intronic
999492210 5:152062066-152062088 ATCCCTGCGGTGGGATGAGAAGG - Intergenic
1001546970 5:172576265-172576287 ATGTCTGTGGAAGGGAGGGAGGG - Intergenic
1004127174 6:12885153-12885175 ATCCCTGCGGAATGCAGGGAAGG + Intronic
1004356526 6:14933972-14933994 GTCCCTTCGGCAGGATGGGAGGG + Intergenic
1004513926 6:16306063-16306085 ATCCCCGGGGAAGAAAGGAACGG - Exonic
1005500732 6:26426885-26426907 ATCCCCTGGGCAGGAAGGGATGG - Intergenic
1006424421 6:33955383-33955405 ATGGCAGTGGAAGGAAGGGAAGG + Intergenic
1006592678 6:35169881-35169903 CTCCCAGGGGAAGGGAGGGAGGG - Intergenic
1006677721 6:35776477-35776499 ACGCCTGCGGAAGGGAAGGAGGG - Intergenic
1007164468 6:39819244-39819266 AGGCCTGTGGAAGGCAGGGACGG + Intronic
1007212906 6:40211187-40211209 AGCACTGCAGGAGGAAGGGAAGG + Intergenic
1007929234 6:45675814-45675836 ATCCCTCAGGAAGTAAGAGACGG - Intergenic
1007943533 6:45804412-45804434 ATCCCTCTTGAAGGAAGTGAAGG - Intergenic
1008818762 6:55605309-55605331 ATACCTGTGAAAGGAAGGGAAGG - Intergenic
1010208884 6:73347555-73347577 ATCTCTGCTGCAGAAAGGGAAGG - Intergenic
1010507471 6:76677988-76678010 ATCCTGGGGGAAAGAAGGGATGG - Intergenic
1010642895 6:78352480-78352502 ATCTCTGCTGAAAGAAAGGAAGG - Intergenic
1017703055 6:157094680-157094702 ATCCCTCTGGAAGGTTGGGAAGG + Intronic
1018167895 6:161116442-161116464 GTCCCTGGGAAAGGAAAGGAAGG + Intronic
1019398521 7:836806-836828 ACCCCTGCAGAGGGAAAGGATGG + Intronic
1020283840 7:6664925-6664947 GACCCTGCAGAAGGAAAGGAGGG - Intergenic
1020747604 7:12097458-12097480 ATCTCAGGAGAAGGAAGGGAGGG + Intergenic
1024092450 7:45955769-45955791 ATCCCTGCTGATTGAGGGGATGG - Intergenic
1026444333 7:70470943-70470965 ATTCCCGGGGAAGGAAGGGCAGG + Intronic
1029371662 7:100154634-100154656 AGCCCTGCGGGAGGGAGGGAGGG + Exonic
1029494924 7:100891335-100891357 ATCCCTGCGGAAGGAAGGGAAGG + Exonic
1032463822 7:132131002-132131024 ATTTCTGCGGGAGGAAGGGTGGG - Intronic
1033137560 7:138797862-138797884 TTGGCTGAGGAAGGAAGGGAGGG - Intronic
1033214334 7:139483011-139483033 AGCCCCGCGGAAGGAAGCGCCGG - Exonic
1033598833 7:142874859-142874881 AGCCCTGTTGAGGGAAGGGATGG + Intronic
1034534166 7:151716592-151716614 ATCCCTTAGGAAGGAGGGTATGG + Intronic
1035039309 7:155916075-155916097 AGCCCTGAGGATGGGAGGGACGG - Intergenic
1035932475 8:3797433-3797455 TTGCCTGTGGAGGGAAGGGATGG - Intronic
1036183229 8:6602484-6602506 ATGCATGCGGGAGGAATGGATGG + Intronic
1036677429 8:10846652-10846674 ATACCTGCACAAGGAAGGTATGG + Intergenic
1038465853 8:27762042-27762064 ATCCATGCGGATGGAATAGACGG - Intronic
1038485777 8:27934237-27934259 ATGCCTGCAGAAGAAAGGAAGGG + Intronic
1038489130 8:27957108-27957130 AAAGCTGCAGAAGGAAGGGAGGG + Intronic
1039079052 8:33718054-33718076 ATCCCTTGGGATGGAGGGGAGGG + Intergenic
1039473218 8:37826524-37826546 GTCCCTGGAGAAGGAAGGGAAGG - Intronic
1039904061 8:41773392-41773414 ATCCCTGGAGGAGGGAGGGAAGG + Intronic
1040455754 8:47595596-47595618 AGCCCTGTGTCAGGAAGGGATGG - Intronic
1041238924 8:55832114-55832136 AGCCCTGGGGAAGGAGGGGAGGG + Intergenic
1041395384 8:57384809-57384831 ATCCCAGAGGAAAGAGGGGAAGG + Intergenic
1042571576 8:70171157-70171179 ATCCCAACGGAGGTAAGGGAAGG + Intronic
1042998129 8:74723537-74723559 TTCCATGAGGAAGGTAGGGATGG + Intronic
1045649452 8:104328586-104328608 AATCCTGCGGAAGAATGGGAGGG + Intergenic
1047291516 8:123535013-123535035 ATCTGTGGGGAAGGCAGGGATGG + Intronic
1047334002 8:123919115-123919137 ACTCCTTGGGAAGGAAGGGAGGG + Intronic
1048823105 8:138397837-138397859 TGCCCTGGGCAAGGAAGGGATGG - Intronic
1049239583 8:141530423-141530445 ATCACTGTGAAAGGAAGAGACGG - Intergenic
1049386840 8:142347132-142347154 AAGCCTGCAGAAGGACGGGAGGG + Intronic
1055533429 9:77211263-77211285 ATCTCTGGGGAAGGACGGGTGGG - Intronic
1056527123 9:87454108-87454130 ATCACTGCAGAAGGAAAAGAGGG + Intergenic
1056754375 9:89372859-89372881 GTCCCTGGGGCAGGATGGGACGG - Intronic
1057026887 9:91740769-91740791 ATCCCTGGGAAAGCAAGGAAAGG + Intronic
1057211118 9:93201635-93201657 AGCCCTGGGCAGGGAAGGGAAGG - Intronic
1059885975 9:118745125-118745147 ATACCTGTGGAAGGGAAGGAGGG - Intergenic
1061249870 9:129420414-129420436 ATCCCCAAGCAAGGAAGGGAGGG + Intergenic
1062321758 9:135993569-135993591 GGCCCTGAGGAAGGAACGGAGGG + Intergenic
1062325602 9:136011073-136011095 TTCCATGGGGAAGGAAGGAAGGG + Exonic
1062347955 9:136124082-136124104 CACCCACCGGAAGGAAGGGAGGG + Intergenic
1062563912 9:137155491-137155513 ATCCCTCCTCAAGGAGGGGAGGG + Intronic
1062729921 9:138103113-138103135 ATTCCTAGGAAAGGAAGGGAGGG - Intronic
1186121343 X:6365199-6365221 GTCCATTGGGAAGGAAGGGATGG - Intergenic
1186174418 X:6910111-6910133 TTCCGTGCTGCAGGAAGGGAAGG - Intergenic
1186434888 X:9534015-9534037 AACCATGCGGGAGCAAGGGAGGG + Intronic
1186662888 X:11687267-11687289 ATCCCTTGGGAAGGCAGTGATGG + Intergenic
1187137253 X:16560177-16560199 AACCCTGGAAAAGGAAGGGAAGG - Intergenic
1193083523 X:77428011-77428033 ATCCTGGAGGAGGGAAGGGAAGG + Intergenic
1193141708 X:78034671-78034693 ATCCTTTAGGAAGGAAGGGATGG - Intronic
1194024464 X:88735198-88735220 ATCCCTAGGGACGGAAGGAAAGG - Intergenic
1195875015 X:109531236-109531258 ATCCATTCTGAAGGAAGTGAAGG - Intergenic
1196370595 X:114975328-114975350 ATCACTGGGGAAAGAAGGGATGG + Intergenic
1196793608 X:119485538-119485560 ATGTTTGTGGAAGGAAGGGAGGG + Intergenic
1196911441 X:120488313-120488335 ATACCTGTGAAAGGAAGGGGTGG + Intergenic
1199675232 X:150183145-150183167 CTCCCTGGTGAAGGAAGGGCAGG - Intergenic
1199903950 X:152206182-152206204 ATCCCTGCAGCAGCAAGGGTGGG + Intronic