ID: 1029495163

View in Genome Browser
Species Human (GRCh38)
Location 7:100892605-100892627
Sequence GGACCCGGCACGCCTGAGGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 107}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029495163_1029495170 7 Left 1029495163 7:100892605-100892627 CCTCCCTCAGGCGTGCCGGGTCC 0: 1
1: 0
2: 1
3: 7
4: 107
Right 1029495170 7:100892635-100892657 GCAGCCAGTCTGTGTAATGCAGG 0: 1
1: 0
2: 0
3: 7
4: 118
1029495163_1029495172 20 Left 1029495163 7:100892605-100892627 CCTCCCTCAGGCGTGCCGGGTCC 0: 1
1: 0
2: 1
3: 7
4: 107
Right 1029495172 7:100892648-100892670 GTAATGCAGGACCACAGCCTCGG 0: 1
1: 0
2: 2
3: 20
4: 198
1029495163_1029495173 28 Left 1029495163 7:100892605-100892627 CCTCCCTCAGGCGTGCCGGGTCC 0: 1
1: 0
2: 1
3: 7
4: 107
Right 1029495173 7:100892656-100892678 GGACCACAGCCTCGGCTGCCAGG 0: 1
1: 0
2: 2
3: 24
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029495163 Original CRISPR GGACCCGGCACGCCTGAGGG AGG (reversed) Exonic
900485973 1:2923026-2923048 GGGCCCGGCAGGGCTGGGGGAGG - Intergenic
901627434 1:10631995-10632017 TGACCCAGCAGGTCTGAGGGTGG - Intergenic
902169674 1:14599453-14599475 GGCCCCGGCCAGCCTGAGCGAGG + Intronic
903855559 1:26336105-26336127 GGACCCGGCAGGACTGAGGTCGG + Exonic
905824407 1:41017736-41017758 GGACCGCGCACGCCTGCTGGTGG - Exonic
906198719 1:43946320-43946342 GGACTTGGCACGCCTCAGGAAGG - Intergenic
906214586 1:44031318-44031340 GGACCCAGCACGCCTGGGCCGGG - Intronic
920172691 1:204081679-204081701 GGACCTGGCACTCCTCAGAGTGG + Intronic
1063470452 10:6280412-6280434 GAACCTGGCTCGCCTGACGGTGG + Intergenic
1073463014 10:103677356-103677378 GGTCCCGGAAGGTCTGAGGGAGG + Intronic
1074182560 10:111077240-111077262 TGCCCCGGCCCGCCTGAGGACGG + Exonic
1075612145 10:123862828-123862850 AGACCAGGCATGCCTGTGGGTGG - Intronic
1076120904 10:127935713-127935735 GGACACGGCAGCCCTCAGGGAGG - Intronic
1077035587 11:492960-492982 GGACCCGCAGCGCGTGAGGGGGG - Intergenic
1081814539 11:45931128-45931150 GTACCCGACACTGCTGAGGGCGG + Intronic
1083489999 11:63009137-63009159 GCCCCCGGCAGGGCTGAGGGTGG + Intronic
1084426029 11:69085023-69085045 GGACCCGCCAGCCCTGGGGGAGG + Intronic
1088328388 11:108625569-108625591 GCACTGGGCACGACTGAGGGTGG + Intergenic
1097014282 12:55974276-55974298 GGCCCCGGCAGGCCTAATGGGGG + Intronic
1100610309 12:96186332-96186354 GGTCCCTGCAGGCATGAGGGGGG - Intergenic
1101412506 12:104481202-104481224 GGACCAGGCAGGCCTCAGTGAGG - Intronic
1102674402 12:114647029-114647051 AGACCTGGCCCGCCAGAGGGAGG + Intergenic
1105026464 12:132852587-132852609 GGACCCAGGACCCCAGAGGGAGG + Intronic
1108689252 13:52847250-52847272 GGAGCCGGGACGCCGGAGGCTGG - Exonic
1114811568 14:25906492-25906514 GGACAAGGAAGGCCTGAGGGAGG + Intergenic
1119137357 14:72232876-72232898 GGGCCTGGCAAGCCTGAGGCTGG + Intronic
1122588403 14:102827020-102827042 GGACCTTGCACGCCTGTGGCCGG - Intronic
1123705657 15:22949231-22949253 GGACCAGGCAGGCCGGAGGGCGG + Intronic
1124666296 15:31595769-31595791 GGTCCTGGCACACCTGAAGGAGG - Intronic
1125205708 15:37151662-37151684 AGACCCGGAATTCCTGAGGGAGG + Intergenic
1125674789 15:41496060-41496082 GGCCCCGGCGGGCCTGGGGGTGG - Intronic
1129653436 15:77507404-77507426 GGACCAGGCACAGCGGAGGGAGG - Intergenic
1131367368 15:91852768-91852790 GGACCCAGCAGGCCTGCGGCTGG + Intergenic
1132600598 16:770949-770971 GGCCCCGGCCAGCCTGTGGGAGG + Exonic
1132828752 16:1917634-1917656 GGACCCAGCAGGACTGGGGGAGG - Intronic
1133018449 16:2955522-2955544 GGACTAGGCCCCCCTGAGGGGGG + Intergenic
1133073808 16:3264354-3264376 GGTCCCGGCCTGCCTGCGGGAGG + Intronic
1141421260 16:83918035-83918057 GGAACTAGCACGCCTGAGGTAGG + Exonic
1141779918 16:86152512-86152534 GGAGCCGGGACACCTGGGGGTGG + Intergenic
1142276012 16:89119258-89119280 GGACACGGCACGGCTGGGGTAGG - Intronic
1142618949 17:1153415-1153437 GGTCCAGGCACACCTGCGGGAGG + Intronic
1142618960 17:1153444-1153466 GGTCCAGGCACACCTGCGGGAGG + Intronic
1142619005 17:1153561-1153583 GGTCCAGGCACACCTGCGGGAGG + Intronic
1142619049 17:1153677-1153699 GGTCCAGGCACACCTGCGGGAGG + Intronic
1142619071 17:1153735-1153757 GGTCCAGGCACACCTGCGGGAGG + Intronic
1142619082 17:1153764-1153786 GGTCCAGGCACACCTGCGGGAGG + Intronic
1144856044 17:18268458-18268480 GGACCCGGCAGCCCTGGGAGTGG - Intergenic
1148618481 17:49016940-49016962 GGACCTGGCACGCTTCAGGATGG - Intronic
1151540289 17:74761329-74761351 GGTCCTGGAACGCCTGAGGATGG + Intronic
1152336500 17:79702261-79702283 GGACCCTGCAGGCCCGAGGCAGG + Intergenic
1152684716 17:81688367-81688389 GGACCCGGCAGGCCTGACGGTGG - Intronic
1152795133 17:82302864-82302886 GGACCCAGGAGGCCTGAGGCAGG + Intergenic
1155258101 18:24015320-24015342 GCACCGGGCACGTCTGTGGGAGG - Intronic
1156316343 18:35972480-35972502 GGACCCGGCAGGCCAAGGGGTGG + Exonic
1157469773 18:47980040-47980062 GGGCCCTGCATCCCTGAGGGAGG - Intergenic
1160807849 19:1000503-1000525 GGACGCCGCACGGCTGAGGGTGG - Exonic
1165323307 19:35099538-35099560 GGACACGCCACACCTGGGGGAGG - Intergenic
1166205054 19:41264332-41264354 GGACGAGGCACGAGTGAGGGGGG + Exonic
1167369510 19:49072261-49072283 GGCCCTGGCACGCCTGCGCGAGG - Exonic
1167504287 19:49863009-49863031 GGCGCCGGCACGCCGGAGGCTGG - Intronic
1167717829 19:51155256-51155278 GGAGGTGGCACTCCTGAGGGTGG + Intergenic
1167766077 19:51483365-51483387 GGAGGTGGCACTCCTGAGGGTGG - Intronic
929930766 2:46253912-46253934 GGCCCCCTCACGCCTAAGGGGGG + Intergenic
932355836 2:71068015-71068037 GGTCCCGGCAGCCCTGAGGAGGG - Intronic
933713609 2:85344825-85344847 GGGCCCGGCATGCCTCAGGCAGG - Intronic
937274554 2:120675462-120675484 GGAGCGGGCATGACTGAGGGCGG - Intergenic
937908296 2:127063396-127063418 GGCCCAGGCACTCCTGAAGGGGG + Intronic
940774893 2:157875744-157875766 GGAGCCGGGAGGACTGAGGGAGG - Intronic
947537854 2:230952193-230952215 GGACAGGGAAAGCCTGAGGGCGG + Intronic
948530118 2:238598771-238598793 GTACACGGCACGCCTGTGTGGGG - Intergenic
948887550 2:240891734-240891756 GAACGCGGCCAGCCTGAGGGAGG - Exonic
1170878550 20:20273805-20273827 GGCCCCAGCAGGCCTGTGGGCGG - Intronic
1171837192 20:30168124-30168146 GGTCCGGGCAGGCCTGAGGCTGG + Intergenic
1171846752 20:30281972-30281994 GGTCCGGGCAGGCCTGAGGCTGG - Intergenic
1175372002 20:58498587-58498609 GGGCCCGGCAGGGCAGAGGGAGG + Intronic
1176103081 20:63373292-63373314 GGCCCCCGCAGGCCTGATGGAGG + Intronic
1179889012 21:44326497-44326519 GGAGTGGGCACGCTTGAGGGCGG + Intronic
1181749108 22:24976639-24976661 GCACCCAGCACCCCTGTGGGTGG + Intronic
1183452646 22:37905542-37905564 GGACCCGGCAGGCCGCAGTGGGG + Intergenic
949506502 3:4733196-4733218 GGACCCGGCAAGCCCGGGGGAGG + Exonic
952241417 3:31533661-31533683 GGACCCGCCACGCCAGGAGGCGG + Intronic
955952108 3:64252633-64252655 GGACCCAGGACGCATGACGGTGG + Intronic
964195524 3:154059795-154059817 GGTCCCAGCATGCCTGAGGCAGG - Intergenic
965590868 3:170358418-170358440 GGACACGGGAAGCCTGGGGGTGG - Intronic
968614363 4:1570781-1570803 GGACCCAGCAAGCCTGAGACAGG + Intergenic
968910219 4:3473670-3473692 GGCCCCGGCACACCTGAACGGGG - Intronic
977667148 4:99654412-99654434 GGCCGCAGCAAGCCTGAGGGAGG + Exonic
982460907 4:155667634-155667656 GGACCCGCGGCGCCCGAGGGAGG + Intronic
998045862 5:138986037-138986059 GGACCCTGCAATCCAGAGGGAGG - Intronic
999253696 5:150197310-150197332 GGACCCTGCACTGCTGAGGGTGG + Intronic
999287230 5:150401492-150401514 GGGCCAGGCAGGCCTGGGGGGGG - Intergenic
1002277681 5:178114155-178114177 GCTCCCGGCAGGCCTCAGGGAGG + Intronic
1002566634 5:180115901-180115923 GGACTCAGCACCACTGAGGGAGG - Intronic
1003425851 6:5997668-5997690 GGCTCCGGCCCGCCTGAGGCGGG + Intergenic
1004228892 6:13813905-13813927 AGGCCCGGCAGGCCGGAGGGCGG - Intronic
1005842890 6:29755790-29755812 GGAGCCGGGACGCCTGTGTGGGG - Intergenic
1019417971 7:935826-935848 GCACCCGGCACTCGTGAGGATGG + Intronic
1024224364 7:47314444-47314466 GGAGCCGGCAGGGCTGGGGGAGG + Intronic
1028121406 7:87059688-87059710 GCTCCCGTCACGCCGGAGGGAGG + Exonic
1029491648 7:100873980-100874002 GGAGCAAGCACGCCTCAGGGAGG + Intergenic
1029495163 7:100892605-100892627 GGACCCGGCACGCCTGAGGGAGG - Exonic
1030267053 7:107631593-107631615 GGACCAGGCACAGCCGAGGGAGG - Intergenic
1033120129 7:138660225-138660247 GGACCTGCCACCCATGAGGGTGG - Intronic
1033361163 7:140640209-140640231 GGACCCAGCACGGCGCAGGGCGG + Intronic
1034951401 7:155298860-155298882 GGACCTGGCACCCCCGAGGGCGG + Intronic
1035580776 8:738057-738079 GGTCCCGGCACCCCCGAGCGCGG - Intronic
1054159771 9:61665623-61665645 CGTCCAGGCAGGCCTGAGGGAGG - Intergenic
1057537803 9:95931924-95931946 TGACCTGGCATGCCAGAGGGAGG - Intronic
1061799610 9:133106736-133106758 GGATCCGGCACTCCTGGGGCGGG + Exonic
1062578927 9:137221296-137221318 GGTCCCGCCAGGCCTGGGGGGGG + Exonic
1186520145 X:10198960-10198982 GGACCCTGCAGCCCTGATGGTGG + Intronic
1190243816 X:48677303-48677325 GGAACCTGGAAGCCTGAGGGAGG + Intronic
1198388122 X:136147671-136147693 GGACCCAGGACGCCGGCGGGCGG - Intronic
1199992002 X:152992751-152992773 GGACCCATCACGCCTGAGTCAGG - Intronic
1200135588 X:153873127-153873149 GGCCCCGGCACTCAGGAGGGCGG + Intronic
1200161735 X:154013121-154013143 GGACCCAGCACCCCTCAGGGAGG - Exonic