ID: 1029496224

View in Genome Browser
Species Human (GRCh38)
Location 7:100896626-100896648
Sequence ACTTCTGGAACCCCCGCGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 54}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029496220_1029496224 -6 Left 1029496220 7:100896609-100896631 CCGCGGCGGCAGTGGAAACTTCT 0: 1
1: 0
2: 0
3: 11
4: 65
Right 1029496224 7:100896626-100896648 ACTTCTGGAACCCCCGCGGGTGG 0: 1
1: 0
2: 0
3: 4
4: 54
1029496219_1029496224 1 Left 1029496219 7:100896602-100896624 CCGCACTCCGCGGCGGCAGTGGA 0: 1
1: 0
2: 0
3: 4
4: 56
Right 1029496224 7:100896626-100896648 ACTTCTGGAACCCCCGCGGGTGG 0: 1
1: 0
2: 0
3: 4
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029496224 Original CRISPR ACTTCTGGAACCCCCGCGGG TGG Intronic
900227962 1:1541431-1541453 CCATGTGGAACCCCCCCGGGCGG - Intergenic
901751578 1:11413409-11413431 CCTTCTGGAAACCCTGCGGAAGG - Intergenic
904800024 1:33086014-33086036 GCTTCAGGAACCCCAGGGGGAGG + Intronic
905449595 1:38047695-38047717 CCTTCTGGAACCCCGGAGCGCGG - Intergenic
918118522 1:181517313-181517335 ACTTCTGGAAGCCTGGCAGGTGG + Intronic
923247778 1:232149780-232149802 TCTTCTTGAACCCTCGTGGGTGG - Intergenic
1062916460 10:1244084-1244106 ACTTCTGGGACCCCCGCTAGGGG - Intronic
1063686560 10:8242284-8242306 ACTGCTGTAACCACCGTGGGTGG + Intergenic
1065328729 10:24572027-24572049 ACTTCTGGTACCCCCTGAGGTGG + Intergenic
1076677360 10:132154005-132154027 ACTGCTGGAACCCCGGGGAGGGG + Intronic
1079602598 11:22328166-22328188 ACTTCTGGAAGCCAAGCAGGAGG - Intergenic
1079970623 11:27031561-27031583 GCCTCTGGAATCCCAGCGGGAGG + Intergenic
1081528370 11:43942417-43942439 TCTCCCGGAACCCCCGCGGGCGG + Exonic
1103702551 12:122855385-122855407 ACCACTGGCTCCCCCGCGGGGGG - Exonic
1104001175 12:124861642-124861664 ACTTCTGGAACCGCCCAGGCTGG - Intronic
1108466806 13:50724978-50725000 TCTTCTGGAACACCTGCGGTAGG - Intronic
1118540019 14:66813530-66813552 GCCTCTGGAACCCCAGCAGGAGG + Intronic
1121740742 14:96250687-96250709 TCTTCTGGAAGCCCTGCAGGTGG + Intronic
1122486335 14:102084157-102084179 ACAGCTTGAACCCCCCCGGGAGG - Intronic
1126097005 15:45097083-45097105 CCTTCAGGAACCCCCGAGAGTGG + Intronic
1130964391 15:88686224-88686246 ACTTTTGGGACCCCCTGGGGAGG - Intergenic
1132766548 16:1537273-1537295 ACATCCGGAAACCCCGAGGGTGG - Intronic
1136064612 16:27750285-27750307 GCCTCTGGAACCCTGGCGGGAGG + Exonic
1137782954 16:51113554-51113576 ACTTGTGGAGCCCCAGAGGGAGG + Intergenic
1142863493 17:2777154-2777176 TCCTCAGAAACCCCCGCGGGCGG + Intronic
1146590470 17:34124046-34124068 ACTTCTGTCACCCAGGCGGGAGG - Intronic
1156896983 18:42257079-42257101 GCCTCTGGAACCCCAGCAGGAGG - Intergenic
1161667053 19:5583654-5583676 ACTTCTTGAACCCTGGGGGGCGG - Intergenic
1162930562 19:13955573-13955595 ACTCCTGGAACCCCCCCAGGAGG + Intronic
1166709542 19:44927803-44927825 ACTTCTGGAGCCCCCTAGGCTGG - Intergenic
1166805626 19:45485410-45485432 ACTTCCGGACCCGCCGCTGGAGG - Exonic
933782900 2:85814140-85814162 CCTTCTGGAAGCCCCTGGGGTGG - Intergenic
1172009479 20:31838026-31838048 GCCTCTGGAACCCCAGTGGGAGG + Intergenic
1180192536 21:46172952-46172974 GCCTCTGGAACCCCAGCTGGGGG + Intronic
1180602517 22:17031992-17032014 ACTTCTGAGACCCCCACCGGGGG - Intergenic
957529316 3:81420547-81420569 ACTTCTCCAACCCCCACAGGAGG - Intergenic
958768754 3:98401960-98401982 GCTTCTGGAGCCCCAGCAGGAGG + Intergenic
959241921 3:103808046-103808068 GCCTCTGGAACCCCAGCAGGAGG + Intergenic
960937689 3:122913412-122913434 ACGTCTTGAACTCCTGCGGGTGG + Exonic
962411032 3:135141987-135142009 ACTTCTGGGAGCCCCTGGGGAGG - Intronic
968425214 4:518761-518783 GCGTCTGGAACCCCCCCTGGCGG + Intronic
972830656 4:42810223-42810245 CCCTCTGGAACCCCAGCAGGAGG - Intergenic
974582013 4:63815087-63815109 GCCTCTGGAACCCCAGCAGGAGG - Intergenic
999894185 5:156011524-156011546 ACTTCTTGAACCCGCGGGGCAGG - Intronic
1001419414 5:171575011-171575033 ACTTCTGAAACACCCGCTTGGGG - Intergenic
1003405190 6:5822083-5822105 GCTGCTGGAACCCCAGCAGGAGG + Intergenic
1008649362 6:53547533-53547555 AGCTCTGGGACCCCCGCTGGGGG - Intronic
1019552143 7:1608372-1608394 ACCCCTGGATCCCCCGTGGGAGG - Intergenic
1021135178 7:16956737-16956759 ACTTCTTGAACCACCACTGGTGG - Intergenic
1029496224 7:100896626-100896648 ACTTCTGGAACCCCCGCGGGTGG + Intronic
1035717916 8:1768027-1768049 ATTTCTGGAACCCAGGAGGGTGG - Intronic
1038319728 8:26514997-26515019 TCTTCTGAAACCCTCCCGGGCGG + Intronic
1042927015 8:73976618-73976640 ACTTCTGCAAGCCCCGCAGAGGG - Intronic
1055429254 9:76227300-76227322 ACTTCTGGAGCCCCCGGGAGAGG + Intronic
1059187418 9:112287424-112287446 ATTGCTTGAACCCCCGGGGGCGG - Intronic
1059405918 9:114098401-114098423 ACTTCTGGACCCCCGCCTGGAGG + Intronic
1059714973 9:116905148-116905170 ACTTCTGGAGGGGCCGCGGGTGG + Intronic
1062561951 9:137145636-137145658 ACTGCCGGAACACCCGCCGGAGG - Intronic
1186685702 X:11922635-11922657 ACCTCTGGAACCCCAGAAGGAGG + Intergenic