ID: 1029496349

View in Genome Browser
Species Human (GRCh38)
Location 7:100897100-100897122
Sequence GGCGCCGCCGCCAGGGACCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029496338_1029496349 8 Left 1029496338 7:100897069-100897091 CCGCAGCGCCCCGCAGCGCCTCG No data
Right 1029496349 7:100897100-100897122 GGCGCCGCCGCCAGGGACCGCGG No data
1029496344_1029496349 -2 Left 1029496344 7:100897079-100897101 CCGCAGCGCCTCGGGCACGCGGG No data
Right 1029496349 7:100897100-100897122 GGCGCCGCCGCCAGGGACCGCGG No data
1029496342_1029496349 -1 Left 1029496342 7:100897078-100897100 CCCGCAGCGCCTCGGGCACGCGG No data
Right 1029496349 7:100897100-100897122 GGCGCCGCCGCCAGGGACCGCGG No data
1029496346_1029496349 -10 Left 1029496346 7:100897087-100897109 CCTCGGGCACGCGGGCGCCGCCG No data
Right 1029496349 7:100897100-100897122 GGCGCCGCCGCCAGGGACCGCGG No data
1029496336_1029496349 10 Left 1029496336 7:100897067-100897089 CCCCGCAGCGCCCCGCAGCGCCT No data
Right 1029496349 7:100897100-100897122 GGCGCCGCCGCCAGGGACCGCGG No data
1029496337_1029496349 9 Left 1029496337 7:100897068-100897090 CCCGCAGCGCCCCGCAGCGCCTC No data
Right 1029496349 7:100897100-100897122 GGCGCCGCCGCCAGGGACCGCGG No data
1029496341_1029496349 0 Left 1029496341 7:100897077-100897099 CCCCGCAGCGCCTCGGGCACGCG No data
Right 1029496349 7:100897100-100897122 GGCGCCGCCGCCAGGGACCGCGG No data
1029496335_1029496349 17 Left 1029496335 7:100897060-100897082 CCGCGCGCCCCGCAGCGCCCCGC No data
Right 1029496349 7:100897100-100897122 GGCGCCGCCGCCAGGGACCGCGG No data
1029496334_1029496349 20 Left 1029496334 7:100897057-100897079 CCGCCGCGCGCCCCGCAGCGCCC No data
Right 1029496349 7:100897100-100897122 GGCGCCGCCGCCAGGGACCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029496349 Original CRISPR GGCGCCGCCGCCAGGGACCG CGG Intergenic
No off target data available for this crispr