ID: 1029498770

View in Genome Browser
Species Human (GRCh38)
Location 7:100914530-100914552
Sequence AAAGTCTAGCCAGCAACCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029498770_1029498771 3 Left 1029498770 7:100914530-100914552 CCAAAGGTTGCTGGCTAGACTTT No data
Right 1029498771 7:100914556-100914578 AGTAGATCACCACATCCACATGG No data
1029498770_1029498774 13 Left 1029498770 7:100914530-100914552 CCAAAGGTTGCTGGCTAGACTTT No data
Right 1029498774 7:100914566-100914588 CACATCCACATGGGCCAAGCTGG No data
1029498770_1029498772 4 Left 1029498770 7:100914530-100914552 CCAAAGGTTGCTGGCTAGACTTT No data
Right 1029498772 7:100914557-100914579 GTAGATCACCACATCCACATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029498770 Original CRISPR AAAGTCTAGCCAGCAACCTT TGG (reversed) Intergenic
No off target data available for this crispr