ID: 1029498772

View in Genome Browser
Species Human (GRCh38)
Location 7:100914557-100914579
Sequence GTAGATCACCACATCCACAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029498770_1029498772 4 Left 1029498770 7:100914530-100914552 CCAAAGGTTGCTGGCTAGACTTT No data
Right 1029498772 7:100914557-100914579 GTAGATCACCACATCCACATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029498772 Original CRISPR GTAGATCACCACATCCACAT GGG Intergenic
No off target data available for this crispr