ID: 1029499997

View in Genome Browser
Species Human (GRCh38)
Location 7:100923083-100923105
Sequence CCAAGGCAGGCATCCCCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029499997_1029500001 -6 Left 1029499997 7:100923083-100923105 CCATGTGGGGATGCCTGCCTTGG No data
Right 1029500001 7:100923100-100923122 CCTTGGTCCTTCACCCTTAGTGG 0: 366
1: 158
2: 40
3: 379
4: 323
1029499997_1029500006 13 Left 1029499997 7:100923083-100923105 CCATGTGGGGATGCCTGCCTTGG No data
Right 1029500006 7:100923119-100923141 GTGGAAAGTACCGCTTTTCTGGG No data
1029499997_1029500007 14 Left 1029499997 7:100923083-100923105 CCATGTGGGGATGCCTGCCTTGG No data
Right 1029500007 7:100923120-100923142 TGGAAAGTACCGCTTTTCTGGGG No data
1029499997_1029500008 15 Left 1029499997 7:100923083-100923105 CCATGTGGGGATGCCTGCCTTGG No data
Right 1029500008 7:100923121-100923143 GGAAAGTACCGCTTTTCTGGGGG No data
1029499997_1029500009 16 Left 1029499997 7:100923083-100923105 CCATGTGGGGATGCCTGCCTTGG No data
Right 1029500009 7:100923122-100923144 GAAAGTACCGCTTTTCTGGGGGG No data
1029499997_1029500005 12 Left 1029499997 7:100923083-100923105 CCATGTGGGGATGCCTGCCTTGG No data
Right 1029500005 7:100923118-100923140 AGTGGAAAGTACCGCTTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029499997 Original CRISPR CCAAGGCAGGCATCCCCACA TGG (reversed) Intergenic
No off target data available for this crispr