ID: 1029499999

View in Genome Browser
Species Human (GRCh38)
Location 7:100923096-100923118
Sequence TAAGGGTGAAGGACCAAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1056
Summary {0: 465, 1: 199, 2: 49, 3: 107, 4: 236}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029499999_1029500007 1 Left 1029499999 7:100923096-100923118 CCTGCCTTGGTCCTTCACCCTTA 0: 465
1: 199
2: 49
3: 107
4: 236
Right 1029500007 7:100923120-100923142 TGGAAAGTACCGCTTTTCTGGGG No data
1029499999_1029500008 2 Left 1029499999 7:100923096-100923118 CCTGCCTTGGTCCTTCACCCTTA 0: 465
1: 199
2: 49
3: 107
4: 236
Right 1029500008 7:100923121-100923143 GGAAAGTACCGCTTTTCTGGGGG No data
1029499999_1029500006 0 Left 1029499999 7:100923096-100923118 CCTGCCTTGGTCCTTCACCCTTA 0: 465
1: 199
2: 49
3: 107
4: 236
Right 1029500006 7:100923119-100923141 GTGGAAAGTACCGCTTTTCTGGG No data
1029499999_1029500005 -1 Left 1029499999 7:100923096-100923118 CCTGCCTTGGTCCTTCACCCTTA 0: 465
1: 199
2: 49
3: 107
4: 236
Right 1029500005 7:100923118-100923140 AGTGGAAAGTACCGCTTTTCTGG No data
1029499999_1029500009 3 Left 1029499999 7:100923096-100923118 CCTGCCTTGGTCCTTCACCCTTA 0: 465
1: 199
2: 49
3: 107
4: 236
Right 1029500009 7:100923122-100923144 GAAAGTACCGCTTTTCTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029499999 Original CRISPR TAAGGGTGAAGGACCAAGGC AGG (reversed) Intergenic
900840541 1:5045664-5045686 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
901083884 1:6599084-6599106 TGGGGGCGAAGGACCAGGGCGGG + Exonic
901211120 1:7526591-7526613 CAAGGGTGAGGGACAAAGGTGGG + Intronic
902050675 1:13561616-13561638 TGTGGGTGAATGACCAAGGCAGG - Intergenic
904089888 1:27937360-27937382 TGAGGGAGCAGGACCAGGGCAGG + Intronic
904393784 1:30204481-30204503 CGTGGGTGAATGACCAAGGCAGG - Intergenic
904393818 1:30204659-30204681 TAAGGGAGAAGGAGGAATGCAGG - Intergenic
904481689 1:30797917-30797939 GAAGGGGGGATGACCAAGGCAGG - Intergenic
904711399 1:32433178-32433200 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
904996677 1:34636669-34636691 CAAGGGTGAAGGACCAAGGCAGG + Intergenic
905060757 1:35137162-35137184 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
905429102 1:37908750-37908772 TGTGGGTGAATGACTAAGGCAGG - Intronic
905499541 1:38425952-38425974 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
905634272 1:39538955-39538977 TGAGGGTGAAGAAGCCAGGCTGG + Intergenic
906049313 1:42857484-42857506 TGTGGGTGAATGATCAAGGCAGG - Intergenic
906049323 1:42857537-42857559 TGTGGGTGAATGATCAAGGCAGG - Intergenic
906049333 1:42857590-42857612 TGTGGGTGAATGATCAAGGCAGG - Intergenic
906080673 1:43086350-43086372 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
906303771 1:44703243-44703265 TAGAGGTGCAGGAACAAGGCCGG - Intronic
906729761 1:48070973-48070995 TCAGGGTGAGGGAACCAGGCTGG + Intergenic
906744783 1:48213963-48213985 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
907292394 1:53425184-53425206 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
907293422 1:53433382-53433404 CCAAGGTGAAGGATCAAGGCAGG - Intergenic
907503817 1:54902747-54902769 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
907521039 1:55023597-55023619 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
908208720 1:61878216-61878238 TGAGGAGGAAGGACCAGGGCAGG - Intronic
908461958 1:64354878-64354900 TAAGGGTGAAGGACTAAGGCAGG + Intergenic
908592293 1:65647152-65647174 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
908852096 1:68386866-68386888 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
909014538 1:70368488-70368510 TAAGGGTGAAGGATCAAGGCAGG - Intronic
909035239 1:70589223-70589245 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
909222869 1:72984590-72984612 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
909223907 1:72992702-72992724 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
909545893 1:76845856-76845878 AAAGGCTGCAGGACCAAGGAGGG + Intergenic
909551228 1:76899527-76899549 TAAGGGTGAAGGACCAAGGCAGG + Intronic
909729213 1:78873042-78873064 TAAGGATGAATGACCAAGGCAGG - Intergenic
909776840 1:79493001-79493023 TAAGGGAGAAGGAGCAATGGAGG + Intergenic
909776900 1:79493258-79493280 TAAGGGTGAAGGACCAAGACAGG + Intergenic
909788504 1:79643632-79643654 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
909793217 1:79701183-79701205 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
909909696 1:81246157-81246179 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
909978676 1:82072292-82072314 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
910049132 1:82956151-82956173 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
910596334 1:88984485-88984507 TAAGGGTGAGCTACCACGGCTGG + Intronic
911070907 1:93831158-93831180 TGTGGGTGAATGACCAAGGTAGG - Intronic
911148260 1:94571931-94571953 TGTGGGTGAATGACCAAGGCAGG + Intergenic
911510820 1:98805966-98805988 TAAGGGTGAAGGAGCAAGGCAGG + Intergenic
911570140 1:99510376-99510398 TAAGGGTGAAGGACAAAGGCAGG - Intergenic
911759963 1:101602644-101602666 TAAGGGTGAAGGATCAAGGCAGG + Intergenic
911966712 1:104380959-104380981 CCAAGGTGAAGGATCAAGGCAGG - Intergenic
911983680 1:104597101-104597123 CACGGGTGAAGGATCAAGGCAGG - Intergenic
912296241 1:108473813-108473835 TAAGAGTGAATGACCAAGGCAGG - Intergenic
912691142 1:111805386-111805408 CAAGGGTGAGGGGACAAGGCTGG - Intronic
912813382 1:112810509-112810531 TGTGGGTGAATGACCAAGGCAGG - Intergenic
912815520 1:112825209-112825231 TGTGGGTGAATGACCAAGGCAGG + Intergenic
913244958 1:116863220-116863242 TGTGGGTGAATGACCAAGGCAGG - Intergenic
917749472 1:178041083-178041105 TGTGGGTGAATGACCAAGGCAGG - Intergenic
918346758 1:183614070-183614092 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
918567951 1:185953307-185953329 TAAGGGTGAAGGACCAAGGCAGG + Intronic
918714638 1:187770317-187770339 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
919091108 1:192979740-192979762 TGTGGGTGAATGACTAAGGCAGG + Intergenic
919476128 1:198035486-198035508 TAAGGGTGAAGGACTAAGGCAGG - Intergenic
920373549 1:205494225-205494247 GAGGGGAGAGGGACCAAGGCTGG - Intergenic
920427509 1:205889871-205889893 TGTGGTTGAATGACCAAGGCAGG + Intergenic
920829125 1:209449674-209449696 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
920901708 1:210115395-210115417 TAAGGGTGAAGGATCAAGGCAGG + Intronic
920907832 1:210188408-210188430 TGTGGGTGAATGACCAAGGCAGG - Intergenic
921460013 1:215414789-215414811 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
921519907 1:216146479-216146501 TAAGGGTGAAGGACCAAGGCAGG - Intronic
921733349 1:218599184-218599206 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
922046208 1:221948635-221948657 TGTGGGTGAATGATCAAGGCAGG - Intergenic
922048171 1:221966783-221966805 TAAGGGTGAAGGACTAAGGCAGG - Intergenic
922049804 1:221978068-221978090 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
922154306 1:223029262-223029284 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
922363768 1:224845235-224845257 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
922368262 1:224886146-224886168 TGTGGGTGAATGATCAAGGCAGG - Intergenic
922598779 1:226834275-226834297 TGTGGGTGAATGATCAAGGCAGG - Intergenic
922598789 1:226834328-226834350 TGTGGGTGAATGATCAAGGCAGG - Intergenic
922845640 1:228681942-228681964 TGTGGGTGAATGACCAAGGCAGG + Intergenic
922906148 1:229175196-229175218 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
922934572 1:229413233-229413255 TAAGGGTGAAGGACCAAGTCAGG - Intergenic
923074969 1:230602076-230602098 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
923214368 1:231834797-231834819 TAACGGTGAAGGACCAAGGCAGG + Intronic
923244502 1:232118982-232119004 TAAGGGTGAAGGACCAAGGTGGG - Intergenic
923257517 1:232234110-232234132 TAAGGGTGAAGGACCAAGACAGG + Intergenic
923770964 1:236937045-236937067 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
923962523 1:239102046-239102068 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
924180388 1:241434718-241434740 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
924658851 1:245997775-245997797 AAAGGGGGAAGGACAAAGGCAGG + Intronic
924896266 1:248340251-248340273 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1062930580 10:1349852-1349874 CGTGGGTGAATGACCAAGGCAGG - Intronic
1063106593 10:2997626-2997648 CGTGGGTGAATGACCAAGGCAGG + Intergenic
1063362864 10:5471606-5471628 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1063509883 10:6634642-6634664 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1063527935 10:6802052-6802074 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1064664041 10:17631606-17631628 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1064887245 10:20124094-20124116 TAAGGATGAAGGACAAAGGCAGG + Intronic
1065362397 10:24901318-24901340 TAAGGGTGAAGGAACCCAGCAGG + Intronic
1065437388 10:25717246-25717268 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1065443423 10:25773985-25774007 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1066103538 10:32138032-32138054 TGTGGGTGAATGACCAAGGCAGG + Intergenic
1066227154 10:33394390-33394412 TAAGAGAGAAGGAACAAGGAGGG + Intergenic
1067360141 10:45571998-45572020 TGTGGGTGAATGACAAAGGCAGG - Intronic
1067943829 10:50678259-50678281 TAAAGGAGAAGGACCAGGGATGG + Intergenic
1068058589 10:52038672-52038694 TAAGGGTGAAGGACCAAGGCAGG + Intronic
1068179885 10:53503870-53503892 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1068230718 10:54167540-54167562 TAAGGGTGAAGGACCAAGGCAGG - Intronic
1068592598 10:58865925-58865947 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1069422613 10:68260664-68260686 TGGGGGTGAAGGTCCATGGCTGG + Intergenic
1069895119 10:71675799-71675821 GAAGGGTGATGGGGCAAGGCTGG - Intronic
1070370413 10:75777085-75777107 TAAGGGAGCAGGGCCAAGGCTGG + Intronic
1070474596 10:76819136-76819158 TAAGGGCGAAGGACCAAGGCAGG - Intergenic
1070507490 10:77126845-77126867 TAAGGGTGGAGAACTCAGGCTGG - Intronic
1071550965 10:86565875-86565897 TGTGGGTGAATGACCAAGGCAGG + Intergenic
1071821489 10:89285547-89285569 TGTGGGTGAATGACCAAGGCAGG - Intronic
1071897969 10:90085905-90085927 TAAGGGTGAAGGACCAAGGCTGG + Intergenic
1071915965 10:90295837-90295859 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1071960846 10:90808155-90808177 TAAGGGTGAAGGACCAAGGCAGG - Intronic
1072011540 10:91306473-91306495 TAAGGGTCAAGGACCAAGGCAGG + Intergenic
1072884352 10:99260684-99260706 TGTGGGTGAATGACCAAGGCAGG - Intergenic
1073013695 10:100381714-100381736 TGTGGGTGAATGACCAAGGCAGG - Intergenic
1073683345 10:105728433-105728455 TAAGGGTGAAGGATCAAGGCAGG - Intergenic
1073709665 10:106022200-106022222 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1074018808 10:109563285-109563307 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1074740532 10:116481512-116481534 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1075248485 10:120845823-120845845 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1075420988 10:122300019-122300041 TAAGGGAGAAGGAGCCTGGCAGG - Intronic
1077116702 11:888424-888446 TCTGGGTGAAGGACACAGGCTGG - Intronic
1077327954 11:1971765-1971787 TAAGGGTCATGGGCCAAGGAGGG - Intronic
1077590081 11:3484388-3484410 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1077611932 11:3648735-3648757 TAAGGGTGAAGGACCAAGGCAGG - Intronic
1077679353 11:4224426-4224448 TAAGGGTGAAAGACCAAGGCAGG + Intergenic
1077688774 11:4321010-4321032 TAAGGGCGAAAGACCAAGGCAGG + Intergenic
1077766648 11:5165255-5165277 TAAGGGTGAAGGACCAAGGCAGG + Intronic
1077851090 11:6074994-6075016 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1077883162 11:6366864-6366886 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1078046365 11:7917028-7917050 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1078928618 11:15896104-15896126 TACTGGGGAAGCACCAAGGCCGG + Intergenic
1079230342 11:18644109-18644131 TGTGGGTGAATGACCAAGGCAGG - Intergenic
1079447249 11:20568741-20568763 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1079672821 11:23188842-23188864 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1079727328 11:23892075-23892097 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1080028179 11:27634043-27634065 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1080083692 11:28253026-28253048 AAAAGGCCAAGGACCAAGGCTGG - Intronic
1080227143 11:29974219-29974241 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1080243593 11:30155035-30155057 TGAGGATGATGGACAAAGGCTGG - Intergenic
1081159427 11:39734981-39735003 TAAGGGTGAAAGACCAAGGCAGG - Intergenic
1081356594 11:42121525-42121547 TAAGGGTGAAGGACCAAGGTGGG - Intergenic
1081549874 11:44101130-44101152 TAAGGGTGTTGGACCAAAGGTGG + Intronic
1082197945 11:49326026-49326048 CTAAGGTGAAGGATCAAGGCAGG + Intergenic
1082955487 11:58865718-58865740 AAAGGATGAAGGAAGAAGGCAGG + Intronic
1082962954 11:58936509-58936531 AAAGGATGAAGGAAGAAGGCAGG + Intronic
1083301511 11:61741887-61741909 TAGGGGTGAACCACCATGGCCGG + Intronic
1084046929 11:66574456-66574478 TAAGGGTGAAGGACTAAGGCAGG - Intergenic
1084232058 11:67760513-67760535 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1084245799 11:67856160-67856182 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1084344263 11:68534047-68534069 TACAGGTGAAGGACCATGGGAGG + Intronic
1084353790 11:68623628-68623650 TAAGGGTGAAGGACTAAGGCAGG - Intergenic
1084355320 11:68634589-68634611 TAAGGGCGAAGGACCAAGGCAGG - Intergenic
1084613542 11:70219305-70219327 TATGGGTGAAGGACCAAGGCAGG + Intergenic
1084826871 11:71738354-71738376 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1085569996 11:77550949-77550971 TGTGGGTGAATGATCAAGGCAGG - Intronic
1085570006 11:77551002-77551024 TGTGGGTAAATGACCAAGGCAGG - Intronic
1085641319 11:78194931-78194953 TAAGGGAGATTGACCCAGGCAGG + Intronic
1085735508 11:79035442-79035464 TAAGGAGGAATGACAAAGGCAGG - Intronic
1085987770 11:81806996-81807018 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1086004842 11:82026288-82026310 TGTGGGTGAATGATCAAGGCAGG - Intergenic
1086132909 11:83419976-83419998 TAAGGGTGAAGGATCAAGGCAGG - Intergenic
1086136510 11:83447734-83447756 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1086550011 11:88044232-88044254 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1086657871 11:89382098-89382120 CTAAGGTGAAGGATCAAGGCAGG - Intronic
1087098864 11:94346555-94346577 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1087127565 11:94642424-94642446 TAAGGGTGAAGGACCAAGACAGG - Intergenic
1087196646 11:95310317-95310339 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1087225296 11:95592308-95592330 TAAAAGTGAAGGACAATGGCTGG - Intergenic
1087314378 11:96588503-96588525 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1087839791 11:102909050-102909072 TAAAGGTGAAGGACAAAGGCAGG + Intergenic
1088787640 11:113197039-113197061 GAAGGGTGAATGAGCAAAGCAGG + Intronic
1089472323 11:118731000-118731022 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1089867269 11:121642667-121642689 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1089953016 11:122547455-122547477 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1089987150 11:122825260-122825282 TAAGGGTGAAAGACCAAGGCAGG - Intergenic
1090107773 11:123870215-123870237 CATGGGTGAATGATCAAGGCAGG + Intergenic
1090527024 11:127547617-127547639 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1090850811 11:130569081-130569103 TAAGGATGAAGGACCGAGGCAGG + Intergenic
1090872183 11:130758286-130758308 TAAGGGTGAAGGACCGAGGCAGG + Intergenic
1090927199 11:131259416-131259438 TAAGGGTGAAGGACCAAGACTGG + Intergenic
1091183409 11:133627611-133627633 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1202810933 11_KI270721v1_random:26945-26967 TAAGGGTCATGGGCCAAGGAGGG - Intergenic
1091648627 12:2292779-2292801 TATGGGTGAAGGTCCAAGTGGGG + Intronic
1091886281 12:4019409-4019431 TGAGGTTGAAGGACCAAGGCAGG - Intergenic
1092228198 12:6762598-6762620 TATGGGTGGAAGACCAAGGAAGG + Intronic
1092416382 12:8293290-8293312 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1092474224 12:8805699-8805721 TAAGGGTGAAGGACCAATGCAGG - Intergenic
1092592961 12:9967828-9967850 TAAGGGTGAAGGACCAAGGCAGG + Intronic
1092626979 12:10337753-10337775 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1092652669 12:10651166-10651188 GAAAAGTGCAGGACCAAGGCAGG - Intronic
1092723970 12:11467120-11467142 TAAGGGTGAAGGACCAAGGCAGG + Intronic
1092739527 12:11614410-11614432 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1092789468 12:12059206-12059228 TAAGGGTGAAGGACCAAGGCAGG - Intronic
1092925051 12:13264669-13264691 TAAGGGTGAAGGACGAAGGCAGG + Intergenic
1093071392 12:14709707-14709729 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1093268239 12:17026484-17026506 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1093302056 12:17470702-17470724 TGTGGGTGAATGACCAAGGCAGG - Intergenic
1093578494 12:20763787-20763809 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1093584732 12:20821736-20821758 TAAGGGTGAAGGACCAAGGCAGG + Intronic
1093813034 12:23510676-23510698 TAAGGGTGAAGGACCAGGGCAGG + Intergenic
1093950844 12:25164050-25164072 TAAGGGTGAAGGACCAAGGCAGG - Intronic
1094316307 12:29139907-29139929 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1094400446 12:30056918-30056940 TAAGGGTGCAGGACCAAGGCAGG - Intergenic
1095942426 12:47735764-47735786 GAACGGTGAAGGGCCACGGCTGG + Intronic
1095999262 12:48115114-48115136 CACGGGTGAATGATCAAGGCAGG + Intronic
1096907361 12:54947526-54947548 TAAGGGTGAAGGATCAAGGCAGG + Intergenic
1097398302 12:59102504-59102526 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1097417285 12:59328054-59328076 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1097542423 12:60956768-60956790 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1097592183 12:61587911-61587933 TAAGGGTGAAGGATCAAGGCAGG - Intergenic
1097693942 12:62759632-62759654 TAAGGGTGAAAGACCAAGGCAGG - Intronic
1098172318 12:67759326-67759348 TTATGGTGGAGGACCAAGGATGG + Intergenic
1098173859 12:67771455-67771477 TAAAGGTGAAGGACCAAGGCAGG + Intergenic
1098401973 12:70086156-70086178 TAAGGCTGAAGGACCAAGGCAGG - Intergenic
1098628812 12:72704090-72704112 TAAGGGCGAAGGACCAAGGCAGG - Intergenic
1098654076 12:73006866-73006888 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1098919724 12:76292536-76292558 TGTGGGTGAATGACCAAGGCAGG - Intergenic
1099140975 12:78975047-78975069 TATGTGTGAAGACCCAAGGCAGG - Intronic
1099188472 12:79540716-79540738 TAAGGGTGAAGGACAAAGGCAGG - Intergenic
1099292347 12:80788047-80788069 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1099762334 12:86939559-86939581 TAAGGGTGAGAGACCAAGGCAGG - Intergenic
1099836289 12:87912037-87912059 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1100561041 12:95749700-95749722 TAAGGGTGAAGGACCAAGGCAGG - Intronic
1100940057 12:99716023-99716045 TAAGGGTGAAGGACCGAGGCAGG - Intronic
1101278662 12:103227666-103227688 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1102531261 12:113548093-113548115 AAAGGGAGAAGGAGCATGGCAGG - Intergenic
1103926104 12:124424085-124424107 GAAGGGTGGGGGACCCAGGCTGG - Intronic
1104046271 12:125165196-125165218 TGAGGGTGTCAGACCAAGGCAGG - Intergenic
1104207321 12:126651746-126651768 TAGGGCTGAAGGAGGAAGGCAGG + Intergenic
1104270490 12:127278516-127278538 TCAGGGCCAAGGACCAAGGATGG - Intergenic
1105031976 12:132890394-132890416 TAAGGGTGAAGGACCAAGGCAGG - Intronic
1107075318 13:36317196-36317218 TAAGGGTGAAGGACCAAGGCAGG - Intronic
1107220556 13:37974108-37974130 TAAGGGTGAAGGACAAAGGCAGG + Intergenic
1107683380 13:42872255-42872277 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1108202437 13:48057193-48057215 TAAGGGTGAAGGACCAAGGCAGG - Intronic
1108282224 13:48871618-48871640 CATGGGTGAATGACCAAGGCAGG + Intergenic
1108407086 13:50115379-50115401 TCAGGGTGAAGGCCCACAGCTGG - Intronic
1108512753 13:51170744-51170766 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1108913676 13:55583198-55583220 TAAGGGTGAAGGACCACGGCAGG + Intergenic
1108919795 13:55659906-55659928 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1108947196 13:56041119-56041141 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1108953198 13:56117369-56117391 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1109106671 13:58260711-58260733 AAAGGGTCAATGACCAAGGAAGG + Intergenic
1109343363 13:61089292-61089314 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1109499044 13:63213947-63213969 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1109508590 13:63338012-63338034 GAAGAGTGAAGGAACAAAGCTGG - Intergenic
1109709889 13:66146153-66146175 TAAGGATGAAGGACCAAGGCAGG + Intergenic
1109717037 13:66231450-66231472 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1110650751 13:77938528-77938550 TAAGGGTGAATGACCAAGGCAGG + Intergenic
1110765214 13:79274916-79274938 TAAGGGTGAGGGACCAAGGCAGG - Intergenic
1110845084 13:80184388-80184410 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1110978219 13:81866934-81866956 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1111126242 13:83912962-83912984 TAAGGGTGAAGGACTAAGGCAGG + Intergenic
1111301762 13:86359045-86359067 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1111362352 13:87191251-87191273 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1111459126 13:88517842-88517864 TAAGGGTGAAGGACCAAGACAGG + Intergenic
1111630238 13:90840420-90840442 TAAGGCTGAAGGACCAAGGCAGG - Intergenic
1111631926 13:90853391-90853413 TAAAGGTGAAGGACCAAGGCAGG + Intergenic
1112236592 13:97643142-97643164 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1112324922 13:98437762-98437784 TAAGGGAAAAGGAGCCAGGCTGG - Exonic
1112889542 13:104212861-104212883 TAAGGGTGAAGGAGAAGGGTTGG + Intergenic
1112889571 13:104212975-104212997 TAAGGGTGAATGACCAAGGCAGG + Intergenic
1113324025 13:109265948-109265970 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1113571793 13:111363183-111363205 TAAGAGTGAAGGTCCCAGGAGGG + Intergenic
1114221502 14:20701643-20701665 TGTGGGTGAATGACCATGGCAGG - Intergenic
1114771217 14:25430183-25430205 TGTGGGTGAATGATCAAGGCAGG + Intergenic
1115240866 14:31250227-31250249 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1115904542 14:38191512-38191534 TAAGGGTGAAGGACAAAGGCAGG - Intergenic
1116179425 14:41516740-41516762 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1116237913 14:42304863-42304885 TCTGAGTGAAGGACCAAGGAAGG - Intergenic
1116535020 14:46017249-46017271 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1116573240 14:46544900-46544922 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1116702601 14:48260090-48260112 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1116703554 14:48267423-48267445 TAAGGCTGAATGACGAAGGCAGG + Intergenic
1116952671 14:50894039-50894061 TAAGGGTGAAGGACCAAGGCAGG - Intronic
1117958158 14:61138305-61138327 TAAAGGTGAAAGACCAAGGCAGG + Intergenic
1118442590 14:65825822-65825844 GACAGGTGAAGGATCAAGGCAGG - Intergenic
1118937559 14:70301092-70301114 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1119022153 14:71125044-71125066 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1119248585 14:73133255-73133277 CCAAGGTGAAGGATCAAGGCAGG + Intergenic
1119316921 14:73704197-73704219 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1119560509 14:75585638-75585660 TGTGGGTGAATGACCAAGGCAGG + Intronic
1119819442 14:77602001-77602023 TGTGGGTGAATGACCAAGGCAGG - Intronic
1120438308 14:84505124-84505146 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1120539784 14:85737739-85737761 TAAGGGTGAAAGACCAAGGCAGG + Intergenic
1120660215 14:87239936-87239958 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1121193482 14:92049323-92049345 TGTGGGTGAATGACCAAGACAGG + Exonic
1122040767 14:98986113-98986135 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1122314319 14:100816778-100816800 TGAGGGTCAAGGTCCAGGGCTGG - Intergenic
1122381540 14:101310396-101310418 TGTGAGTGAATGACCAAGGCAGG + Intergenic
1122507449 14:102240708-102240730 TGTGGGTGAATGACCAAGGCAGG - Intronic
1122893212 14:104742525-104742547 TGAGGGTGAAAGAGGAAGGCTGG - Intronic
1125045493 15:35239489-35239511 TAAGGGTGAAGGACCAAGGCAGG - Intronic
1125131814 15:36290799-36290821 TAAGGGTGAAGGACGAAGGCAGG + Intergenic
1125213391 15:37240801-37240823 CATGGGTGAATGATCAAGGCAGG + Intergenic
1125628962 15:41132217-41132239 CCAAGGTGAAGGATCAAGGCAGG - Intergenic
1125848904 15:42885602-42885624 TAAGGGTGAAGGACCAAGGCAGG - Intronic
1126530371 15:49703898-49703920 TAAGGTTGAAGGACCAAGGCAGG + Intergenic
1126843504 15:52739417-52739439 TAAGGGTGAAAGACCAAGGCAGG - Intergenic
1126912609 15:53431581-53431603 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1127314638 15:57783203-57783225 AAAGGTTGAAGGACCAGGACAGG + Intergenic
1127723996 15:61729549-61729571 GAAGGGTGAAGGCCTAAGTCAGG + Intergenic
1129259242 15:74354968-74354990 TAAGGGTGAAGGATCAAGGCAGG - Intronic
1130304346 15:82703204-82703226 TAAGGGTGAAAGATCAAGGCAGG - Intronic
1130854838 15:87831973-87831995 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1130947718 15:88561361-88561383 TAAGAGTGAAGGACCAAAGCAGG + Intergenic
1131164679 15:90133915-90133937 TAAGGGTGAACGATCAAGGCAGG - Intergenic
1131447456 15:92512199-92512221 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1131683942 15:94751589-94751611 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1131828668 15:96340889-96340911 TAATGGTGAAAGGCCGAGGCAGG - Intergenic
1131882771 15:96876777-96876799 TAAGGGTGAAAGACCAAGGCAGG + Intergenic
1132262752 15:100441037-100441059 TAAGGGTGAAGGACCAAGGCAGG - Intronic
1132330721 15:101010742-101010764 AAAGAGTGAAGGAACAGGGCAGG - Exonic
1132340169 15:101073367-101073389 TAAGGGTGAAGGACCAAGGCAGG - Intronic
1132748257 16:1445839-1445861 TGAGGCTCAGGGACCAAGGCAGG + Exonic
1133651151 16:7815513-7815535 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1133765942 16:8837755-8837777 TAAGGGTGAAGGACCAAGGCAGG + Intronic
1133766946 16:8844586-8844608 TAAGGGTTATGGACCAAGGCAGG + Intronic
1133869853 16:9676371-9676393 TAAGGGTGAAGGACCAAGGCAGG + Intronic
1135025587 16:18996791-18996813 TGTGGGTGAATGACCAAGGCAGG + Intronic
1137363249 16:47839576-47839598 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1137676374 16:50305684-50305706 GCAGGGGGAAGGAACAAGGCTGG - Intronic
1138804650 16:60079414-60079436 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1139039666 16:62984653-62984675 TAAGGGTGAAGGACTAAGGCAGG + Intergenic
1139226132 16:65234594-65234616 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1139943247 16:70621175-70621197 TAAGGTTGAAGGACCAAGGCAGG + Intronic
1139943948 16:70625564-70625586 TAAGGGTGAAGGACCAAGGCAGG + Intronic
1140575742 16:76166398-76166420 CAAGGGTGAAGGACCAAGAAAGG - Intergenic
1141865428 16:86746755-86746777 TGAGGGTGAAGGACCAAGGCAGG + Intergenic
1142066854 16:88067732-88067754 AAAGGGTGGAGGACCAGGACTGG - Intronic
1142127607 16:88418008-88418030 TTAGGGTGAGGGACCAATTCGGG - Intergenic
1143414565 17:6736572-6736594 TGTGGGTGAATGACCAAGGCAGG + Intergenic
1144104387 17:11972616-11972638 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1145080832 17:19893035-19893057 TGTGGGTGAATGACCAAGGCAGG + Intergenic
1146597632 17:34184039-34184061 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1146693647 17:34893128-34893150 AGAGGGAGGAGGACCAAGGCTGG + Intergenic
1147425932 17:40345857-40345879 TGAGGTACAAGGACCAAGGCCGG - Intronic
1147583543 17:41639661-41639683 TGAGGGAGGAGGACCAGGGCAGG + Intergenic
1148756706 17:49976774-49976796 TAAGGGAGGGGGACCAAGACTGG + Intergenic
1149273219 17:55005368-55005390 CAAAGATGAAAGACCAAGGCAGG - Intronic
1149319325 17:55468510-55468532 TGTGGGTGAATGATCAAGGCAGG - Intergenic
1149319335 17:55468563-55468585 AGTGGGTGAATGACCAAGGCAGG - Intergenic
1150860668 17:68797188-68797210 CCAAGGTGAAGGATCAAGGCAGG + Intergenic
1151622251 17:75253469-75253491 TAAGGGTGAAGGACCAAGGCAGG - Intronic
1151839962 17:76610634-76610656 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1152453714 17:80400628-80400650 TGTGGGTGAATGACCAAGGCAGG - Intergenic
1152500715 17:80707077-80707099 TCAGGGTTAAGGGCCCAGGCAGG + Intronic
1154135356 18:11773026-11773048 TGAGAGTGAAGCACAAAGGCAGG - Intronic
1155618312 18:27746628-27746650 TAAGAATGAAAGACAAAGGCCGG + Intergenic
1155697268 18:28698000-28698022 GAAGGGTGAAGGACCAAGGCAGG + Intergenic
1155892924 18:31289076-31289098 TGTGGGTGAATGACCAAAGCAGG + Intergenic
1155941301 18:31804600-31804622 TAAAGGTGAAGGACAAAGGCAGG - Intergenic
1155961773 18:32001355-32001377 TATGGGTGAATGATGAAGGCAGG - Intergenic
1156237171 18:35216837-35216859 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1156252110 18:35360931-35360953 TGTGGGTGAATGATCAAGGCAGG + Intergenic
1156302055 18:35844927-35844949 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1156915645 18:42462656-42462678 TAAGGGTGAAGGATCAAAGCAGG - Intergenic
1156924268 18:42557241-42557263 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1158336108 18:56416313-56416335 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1158394903 18:57071598-57071620 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1159164246 18:64682566-64682588 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1159271542 18:66159481-66159503 TCAGTGTAAAGGACCAAGGCTGG - Intergenic
1159834795 18:73325463-73325485 TAAGAGTGAAGGACCAAGGCAGG - Intergenic
1159855495 18:73582949-73582971 TAAGAGAGAAGGGACAAGGCTGG - Intergenic
1159929050 18:74293620-74293642 CCAAGGTGAAGGATCAAGGCAGG - Intergenic
1161661498 19:5549443-5549465 TAAGGGTGAAGGACCAAGGCGGG - Intergenic
1161710999 19:5848049-5848071 TGTGGGTGAATGACCAAGGCAGG - Intronic
1162242396 19:9365567-9365589 TAAGGGTGAAGGACCAAGGCAGG + Intronic
1162261818 19:9540152-9540174 TGTGGGTGAATGATCAAGGCAGG - Intergenic
1163209415 19:15829572-15829594 TGTGGGTGAATGACCAAGGCAGG - Intergenic
1163591679 19:18197344-18197366 TAAGGGTGACGGGCTAAGTCAGG + Exonic
1163900532 19:20095886-20095908 TAAGGGTGAAGGACCAAGGCAGG + Intronic
1163906792 19:20155390-20155412 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1164004245 19:21134340-21134362 CCAAGGTGAAGGATCAAGGCAGG + Intergenic
1164080621 19:21858869-21858891 CCAAGGTGAAGGATCAAGGCAGG - Intergenic
1164152750 19:22569180-22569202 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1164202674 19:23031432-23031454 TGTGGGTGAATGACCAAGGCAGG + Intergenic
1164219158 19:23177782-23177804 CCAAGGTGAAGGATCAAGGCAGG - Intergenic
1164258585 19:23550344-23550366 TGTGGGTGAATGACCAAGGCAGG - Intronic
1164459504 19:28434902-28434924 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1164626382 19:29731324-29731346 CAAGGGTGGATTACCAAGGCTGG + Intergenic
1165249012 19:34514922-34514944 TAAGGGTGAAGGATCAAGGCAGG - Intergenic
1165497216 19:36160133-36160155 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1165510560 19:36264346-36264368 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1166499218 19:43328513-43328535 TAAGGGTGAAGGACCAAGACAGG + Intergenic
1166905982 19:46108674-46108696 CCAAGGTGAAGGATCAAGGCAGG + Intergenic
1166917049 19:46202560-46202582 CCAAGGTGAAGGATCAAGGCAGG + Intergenic
1166927344 19:46277985-46278007 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1167046825 19:47054528-47054550 CAAGGATGAAGGACCAAGGCAGG + Intergenic
1167099199 19:47393699-47393721 TAAGGGTGAAAGACCAAGGCAGG - Intergenic
1167901916 19:52628621-52628643 TAAGGGTGAAGGACCAAGGCAGG - Intronic
1168051381 19:53832283-53832305 TGAGGGTGAAGGACCAAGGCAGG - Intergenic
1168212355 19:54899747-54899769 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1168228216 19:55011578-55011600 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1168229947 19:55024487-55024509 TCAGAGTGAAGCACCAAGGCAGG - Intronic
1168406676 19:56114252-56114274 TAAGGGTGAAAGACCGGGCCTGG - Intronic
925434022 2:3820493-3820515 TGTGGGTGAATGACCAAGGCAGG + Intronic
925491657 2:4401801-4401823 TAAGTGTAAAAGACCAAGGATGG + Intergenic
925544266 2:5001634-5001656 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
925829186 2:7877992-7878014 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
926407503 2:12570536-12570558 TAAGGGTGAAGGACCGAGGCAGG - Intergenic
926413325 2:12627198-12627220 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
926464320 2:13168813-13168835 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
926815803 2:16796835-16796857 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
927133990 2:20083441-20083463 TAAAGGTGAAGGATCAAGGCAGG - Intergenic
927428575 2:23007786-23007808 TGTGTGTGACGGACCAAGGCTGG - Intergenic
928770807 2:34700506-34700528 TAAGGTTGAAGGACCAAGGCAGG + Intergenic
928778079 2:34790656-34790678 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
928779935 2:34805864-34805886 TAAGGGTGAAGAACGAAGGTAGG + Intergenic
928827837 2:35441742-35441764 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
928928327 2:36599953-36599975 TAAGGGTGAAGGACCAAGGCAGG - Intronic
929076934 2:38085677-38085699 TAAGGGTGAAGGACCAAGGCAGG + Intronic
929684714 2:44023672-44023694 TGTGGGTGAATGACCAAGGCAGG + Intergenic
929793319 2:45039312-45039334 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
930099307 2:47590647-47590669 CCAAGGTGAAGGATCAAGGCAGG + Intergenic
930954873 2:57193923-57193945 TAAGGGTGATGGACCAAGGCAGG - Intergenic
930958182 2:57229892-57229914 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
931026636 2:58118249-58118271 TAAGGGTGAAGGACCAAGGCAGG + Intronic
931042452 2:58314985-58315007 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
931236637 2:60418262-60418284 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
931625514 2:64253318-64253340 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
931850176 2:66244763-66244785 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
931948005 2:67332344-67332366 TAAGGGTGAAGGACTAAGGCAGG - Intergenic
931974854 2:67631988-67632010 TATTGGAGAATGACCAAGGCAGG - Intergenic
932159695 2:69448472-69448494 TAAGGCTGAAGGACCAAGGCAGG + Intergenic
932295581 2:70621326-70621348 TAAGGGTGAAGGACCAAGGCAGG - Intronic
932359106 2:71090108-71090130 TAAGGATGAAGGACCAAGGCAGG + Intergenic
932854439 2:75218619-75218641 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
932974208 2:76578795-76578817 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
933012825 2:77089103-77089125 TAAGGGTGAAGGACCAAGGCAGG - Intronic
933079034 2:77965997-77966019 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
933163501 2:79052216-79052238 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
933180047 2:79216857-79216879 TAAGGGTGAAGGACCAAGGCAGG + Intronic
933329765 2:80879344-80879366 TAAGGGCGAAAGACCAAGGCAGG + Intergenic
933552597 2:83793621-83793643 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
933806290 2:86000200-86000222 TAAGCGTGAAGGACCAAGGCGGG - Intergenic
936175736 2:110218759-110218781 TAAGGGTGAAGGACTAAGGCAGG - Intergenic
936794464 2:116188850-116188872 CATGGGTGAATGATCAAGGCAGG + Intergenic
936870617 2:117131392-117131414 TGTGGGTGAATGACCAAGGCAGG - Intergenic
936883109 2:117279632-117279654 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
938902391 2:135809083-135809105 CAGGGGTGAAGGACCCAGGCTGG - Exonic
939083381 2:137687803-137687825 TAAGGGTGAAGGACTAAGGCAGG + Intergenic
939460917 2:142494494-142494516 TAAGAGTGAAGGACCAAGGCAGG + Intergenic
940107142 2:150113596-150113618 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
940182764 2:150954169-150954191 CCAAGGTGAAGGATCAAGGCAGG - Intergenic
940529948 2:154868154-154868176 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
940676050 2:156724990-156725012 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
940726606 2:157342706-157342728 CCAAGGTGAAGGATCAAGGCAGG + Intergenic
941180241 2:162251003-162251025 AATGGGTAAAGGACCAAAGCAGG + Intergenic
941340160 2:164296681-164296703 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
941456415 2:165715267-165715289 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
941547302 2:166868133-166868155 TAAGATTGAAGGACTTAGGCAGG + Intergenic
941936139 2:170982536-170982558 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
942096853 2:172542630-172542652 TAAGGGTGACGGACCAAGGCAGG - Intergenic
942730491 2:179056473-179056495 AAGGGTTGAAGGACTAAGGCAGG + Intergenic
943061371 2:183044910-183044932 TAAGGGCGAAGGATCATGGTGGG - Intergenic
943421825 2:187675373-187675395 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
943449954 2:188034342-188034364 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
943460356 2:188165487-188165509 TGTGGGTGAATGACCAAGGCAGG + Intergenic
943461381 2:188173835-188173857 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
943806337 2:192131005-192131027 TAAGGGTGAAGGACCAAGGCAGG - Intronic
943834917 2:192506908-192506930 TAAGGGTGAAGGACTAAGGCAGG - Intergenic
943865173 2:192919147-192919169 TAAGATTGAAGGATCAAGGCAGG - Intergenic
944387204 2:199180243-199180265 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
944393895 2:199247777-199247799 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
944876373 2:203966827-203966849 TAAGCATGAAGGACCAAGGCAGG + Intergenic
945153352 2:206811744-206811766 TAAGGGTAAAGGACCAAGGCAGG + Intergenic
945173206 2:207018045-207018067 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
945301723 2:208221090-208221112 TAGGGGTGAAGGACCATGGCAGG + Intergenic
945361436 2:208900180-208900202 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
945375857 2:209078900-209078922 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
945394098 2:209300219-209300241 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
945554523 2:211262569-211262591 TGTGGGTGAATGACCAAGGCAGG - Intergenic
945938059 2:215923179-215923201 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
946023434 2:216657407-216657429 AAAGGGTGAAAGAGAAAGGCCGG - Intronic
946130292 2:217601378-217601400 TAAGCTTGAAGGACAAAGGGAGG - Intronic
946215310 2:218179007-218179029 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
946781272 2:223194667-223194689 TAAGGGTGAAGGACCAAGGCAGG + Intronic
946872000 2:224092659-224092681 TAAGGGTGAAGGACCAAGGAAGG + Intergenic
946886263 2:224226158-224226180 TAATGGTGAAGAACCAAGGCAGG - Intergenic
946893019 2:224297471-224297493 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
948076371 2:235168170-235168192 TAAGGGGAAAGGAGCCAGGCAGG - Intergenic
948100114 2:235366507-235366529 TAATGGGGAAGGACCAGGGGAGG + Intergenic
948147279 2:235717034-235717056 TGGGGGTGGAGGAGCAAGGCAGG - Intronic
948390396 2:237607614-237607636 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1168739176 20:173648-173670 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1168839096 20:897618-897640 TGTGGGTGAATGACCAAGGCAGG - Intronic
1168943504 20:1732688-1732710 CTAAGGTGAAGGATCAAGGCAGG + Intergenic
1169044458 20:2524768-2524790 TAAGAGGGAAGGGCCAAGGCAGG - Intergenic
1169406113 20:5322531-5322553 CAATGCTGAAGGAGCAAGGCAGG - Intergenic
1170010792 20:11721058-11721080 TAAGGGTGGAAGAACCAGGCAGG + Intergenic
1170069089 20:12345062-12345084 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1170105982 20:12754694-12754716 TAAGGGCGAAGGACCAAGGCAGG - Intergenic
1170165647 20:13358814-13358836 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1170325727 20:15152700-15152722 TAAGGGTGAAGGACCAAAGCAGG + Intronic
1170680617 20:18522239-18522261 TGTGGGTGAATGACCAAGGCAGG + Intronic
1170820930 20:19755904-19755926 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1171029266 20:21662716-21662738 TATGGGTTAAGAACCAGGGCTGG + Intergenic
1171141799 20:22749888-22749910 CCAGGGTGATGGAGCAAGGCAGG - Intergenic
1172932761 20:38597936-38597958 TAAGAGTGAAGGACCAAGGCAGG + Intergenic
1173101635 20:40093959-40093981 TAAGGGTGAAGGACAAAGGCAGG - Intergenic
1173651794 20:44671079-44671101 TGTGGGTGAATGACCAAAGCAGG - Intergenic
1173781401 20:45760181-45760203 TAAGGGTGAAGGACCAAGGCAGG - Intronic
1176034075 20:63028007-63028029 GAAGAGTGAAGAACCAACGCGGG + Intergenic
1177031367 21:15984454-15984476 AAAGGGTGAAGGACCAAGGCAGG + Intergenic
1177100387 21:16893041-16893063 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1177102476 21:16914958-16914980 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1177119324 21:17122321-17122343 TAAGGGTAAAGGACCAAGGCAGG - Intergenic
1177840907 21:26232625-26232647 CGTGGGTGAATGACCAAGGCAGG + Intergenic
1179015480 21:37591657-37591679 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1179278550 21:39913900-39913922 TCAGGGTGAAGAGCCAGGGCGGG + Intronic
1179387283 21:40955636-40955658 TAAAGGTGAAGGACCAAGGCAGG - Intergenic
1179650560 21:42805685-42805707 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1180560668 22:16612203-16612225 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1180790714 22:18574113-18574135 TAAGGGTTAGGGACCTGGGCTGG - Intergenic
1180866817 22:19124469-19124491 AAAGGGGGAAGGGCCACGGCAGG + Intergenic
1180945703 22:19691982-19692004 TAATGGTGACATACCAAGGCAGG - Intergenic
1181231023 22:21421201-21421223 TAAGGGTTAGGGACCTGGGCTGG + Intronic
1181247625 22:21513667-21513689 TAAGGGTTAGGGACCTGGGCTGG - Intergenic
1181354585 22:22290412-22290434 GAAGGGTCCAGGGCCAAGGCAGG - Intergenic
1182113706 22:27742861-27742883 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1182732034 22:32503601-32503623 CAAGGGTGAAGGACCAAGGCAGG - Intergenic
1183320010 22:37159485-37159507 GAAGGGGGAAGGAGCAAGGCAGG + Intronic
1185188364 22:49417097-49417119 GAAGGGAGGAGGAGCAAGGCTGG + Intronic
949162340 3:895555-895577 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
949670906 3:6398467-6398489 TAAGGGTGAAGGACCAAGCCAGG - Intergenic
949827194 3:8177850-8177872 TAAGGGTGAAGGAGCAAGGCAGG - Intergenic
949942049 3:9162669-9162691 CATGGGTGAAGCACCAAGGGTGG + Intronic
950569589 3:13791886-13791908 GAAGGGTGAAGGACTAAGAAGGG - Intergenic
950926245 3:16745109-16745131 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
951299052 3:20972372-20972394 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
951762995 3:26165026-26165048 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
951894688 3:27599815-27599837 TGTGGGTGAATGACCAAGGCAGG - Intergenic
952296637 3:32068314-32068336 TGTGGGTGAATGACCAAGGCAGG - Intronic
952343752 3:32466065-32466087 AAAGGGTGAAGGACCAAGGCAGG + Intronic
952379822 3:32796057-32796079 TGTGGGTGAATGACCAAGGCAGG + Intergenic
952663696 3:35879216-35879238 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
952895516 3:38075921-38075943 TAAGGGTGAAAGACCAAGGCAGG + Intronic
952896783 3:38082808-38082830 TAAGGGTGAAGGACCAAGGCAGG + Intronic
953077396 3:39582768-39582790 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
953176930 3:40561724-40561746 TAAGGGTGAAGGACTAAAGCAGG - Intronic
953447250 3:42979117-42979139 GACGGGTGATGCACCAAGGCTGG - Intronic
953825948 3:46251157-46251179 TAAGGGTGAAGGACCAAGGCAGG + Intronic
953841372 3:46392555-46392577 TGTGGGTGAATGACCAAGGCAGG + Intergenic
954110607 3:48430814-48430836 TAAGGGTGAGGGATCCAGGGAGG - Intergenic
954161979 3:48729342-48729364 CCAAGGTGAAGGATCAAGGCAGG + Intronic
954969502 3:54639317-54639339 TAAGGGTGAAGGACCAAGGCAGG + Intronic
955253162 3:57304693-57304715 TAAGGGTGAAGGACCAAGGCAGG - Intronic
956233683 3:67043302-67043324 TAAGGGTGAAGGATCAAGGGAGG + Intergenic
956549171 3:70439553-70439575 TACGGGTGAAGGACCAAGGCAGG + Intergenic
956709005 3:72023962-72023984 TAAGGGTGAAGTACCAAGGCAGG - Intergenic
957060126 3:75474883-75474905 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
957168050 3:76700350-76700372 TAAGGGTGAAGGAAGAAAGGGGG - Intronic
957294961 3:78324522-78324544 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
957317560 3:78588027-78588049 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
957394210 3:79619005-79619027 TGTGGGTGAATGATCAAGGCAGG - Intronic
957394236 3:79619164-79619186 TGTGGGTGAATGACCAAGGCAGG - Intronic
957735085 3:84192579-84192601 TAAGGGTGAAGGATCAAGACAGG + Intergenic
957905065 3:86543151-86543173 TAAGGGTGAAGGATCAAGGCAGG + Intergenic
958182045 3:90072441-90072463 TAAGGGTGAAAGACCAAGGCAGG + Intergenic
958425761 3:93977183-93977205 TAACTGTGAAAGACCAAGGCAGG + Intergenic
958750783 3:98191893-98191915 TAAGGGTGAAGGATCAAGGCAGG - Intronic
959288602 3:104444903-104444925 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
959485998 3:106927532-106927554 TAAGGATGAAGGACCAAGGCAGG + Intergenic
959543883 3:107571280-107571302 CGTGGGTGAATGACCAAGGCAGG + Intronic
959760879 3:109963429-109963451 TATGGTGGAAGGACCAAGGCAGG + Intergenic
959883908 3:111477192-111477214 TAAGGGTCAGAGACCAAGTCAGG - Intronic
959972509 3:112422463-112422485 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
960283102 3:115798266-115798288 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
960310403 3:116110350-116110372 TAAGGGTGAAGGACCAAGGCAGG + Intronic
961131576 3:124472391-124472413 TAAGGGAGAAGGGCCCAGGCTGG + Intronic
961164987 3:124757307-124757329 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
961293259 3:125864523-125864545 TAAGGGTGAAGGACAAAGGCAGG - Intergenic
961711873 3:128834058-128834080 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
961712949 3:128841166-128841188 TGTGGGTGAATGACCAAGGCAGG + Intergenic
961730350 3:128960674-128960696 TAAGGGTGAAGGACCAAGGCAGG - Intronic
961880776 3:130059975-130059997 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
961893923 3:130151889-130151911 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
962022353 3:131513712-131513734 TAAGGGTGAAGGATCAAGGCAGG + Intergenic
962281785 3:134057676-134057698 TGAGGGTGCAGGGCCAAGGCAGG - Intergenic
962524204 3:136222875-136222897 TGTGGATGAATGACCAAGGCAGG + Intergenic
962660431 3:137596479-137596501 TAAAGGTGAAGGACCAAGGCAGG - Intergenic
963058353 3:141205737-141205759 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
963319559 3:143798370-143798392 TGTGGGTGAATGACCAAGGCAGG - Intronic
963424990 3:145113903-145113925 TAAGGGTGAAGGATCAAGGCAGG - Intergenic
963456920 3:145556061-145556083 TAAGGGTGAAGGACCAAGGAAGG + Intergenic
963468387 3:145711275-145711297 TAAGGATGAAGGACCAAGGCAGG - Intergenic
963521387 3:146362924-146362946 TAAGGGTGAAGGACCAAGACAGG - Intergenic
963663065 3:148152376-148152398 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
963684067 3:148415112-148415134 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
964067575 3:152597850-152597872 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
964125730 3:153231663-153231685 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
964176352 3:153828534-153828556 TGTGGGTGAATGACCAAGGCAGG + Intergenic
964300467 3:155279945-155279967 TAAGGATGAAGGACCAAGGCAGG + Intergenic
964906808 3:161726919-161726941 TAAGGGTGAAAGACCAAGGCAGG + Intergenic
964983425 3:162713335-162713357 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
965070089 3:163908365-163908387 TAAGGGTGAAGGAGCAAGGCAGG - Intergenic
965105461 3:164346991-164347013 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
965262869 3:166505568-166505590 TAAGGGTGAAGGACCAAGACAGG + Intergenic
965286953 3:166828847-166828869 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
965334870 3:167423274-167423296 TAAGGGTAAAGGACCAAGGCAGG - Intergenic
965625133 3:170677411-170677433 TAAGGGTGAAGGACCAAGGCAGG + Intronic
965626590 3:170688355-170688377 TAAGAGTGAAAGACCAAGGCAGG + Intronic
965640301 3:170822916-170822938 TAAGGGTGAAGGACCAAGGCAGG + Intronic
965713141 3:171577204-171577226 TAAGGGTGAAGGAACAAGGCAGG - Intergenic
965862190 3:173160676-173160698 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
966066555 3:175828363-175828385 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
966085201 3:176062177-176062199 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
966105323 3:176326462-176326484 TAAAGGTGAAGGACCAAGGCAGG + Intergenic
966278946 3:178208017-178208039 TAAGGGTGAAGGACTAAGGCAGG - Intergenic
966397469 3:179517909-179517931 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
967005546 3:185379154-185379176 TGTGGGTGAATGACCAAGGCAGG + Intronic
967151881 3:186658600-186658622 TAAGGGTGAAAGACCAAGGCAGG - Intergenic
967212410 3:187180373-187180395 TAAGGGCGAAGGACCAAGGCAGG + Intronic
967244409 3:187471153-187471175 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
967495995 3:190145416-190145438 TAAGGGTGAAGGACTAAGGCAGG - Intergenic
967561162 3:190921038-190921060 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
967624921 3:191671477-191671499 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
967644071 3:191900251-191900273 TAAGGGTGAAAGACCAAGGCAGG + Intergenic
967658367 3:192076006-192076028 TAAGGGCAAAGGACCAAGGCAGG + Intergenic
967740241 3:192996485-192996507 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
967857052 3:194125994-194126016 TAGGGGTGATGGTCCAGGGCAGG - Intergenic
968413490 4:408480-408502 TGTGGGTGAATGACCAAGGCAGG + Intergenic
968722771 4:2219951-2219973 TGAGGGTGCTGGATCAAGGCAGG - Intronic
968993159 4:3928265-3928287 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
969004030 4:4005044-4005066 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
969405663 4:6989799-6989821 TAAGGTTGAAGAAAAAAGGCAGG - Intronic
969654378 4:8487810-8487832 TAAGGGTGAAAGACCAAGGCAGG + Intronic
969748838 4:9095179-9095201 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
969809889 4:9639757-9639779 TAAGGGTGAAGGACCAAGTCAGG - Intergenic
970029427 4:11658425-11658447 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
970041875 4:11807173-11807195 TAAGGGTGAATGACCAAGGCAGG - Intergenic
970087345 4:12364691-12364713 TAAGGGTGAAGGACCAAGCCAGG - Intergenic
970406089 4:15765766-15765788 TTTGGGTAAAGGACCAAGGAAGG - Intergenic
970532514 4:16998616-16998638 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
970854288 4:20635117-20635139 TAAGGGTGAAAGACCAAGGCAGG + Intergenic
971123451 4:23726979-23727001 TAAGGGTAAAGGACCAAGGCAGG + Intergenic
971180325 4:24324144-24324166 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
971199884 4:24501854-24501876 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
972071310 4:35021414-35021436 TGTGAGTGAATGACCAAGGCAGG + Intergenic
973680414 4:53312157-53312179 TAAGGGTGAGGGACCAGGCTAGG + Intronic
973750943 4:54020897-54020919 TGTGGGTGAATGACCAAGGCAGG - Intronic
974428626 4:61769092-61769114 TAAGGGTGAAGGACCAAGGCAGG + Intronic
974903600 4:68031735-68031757 TAAGGGTGAAGGATCAAGGCAGG - Intergenic
975151890 4:71032300-71032322 TGTGGGTGAATCACCAAGGCAGG - Intergenic
975865356 4:78718832-78718854 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
975934132 4:79558820-79558842 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
976558383 4:86475654-86475676 TAAGGGTGAAGGACCAAGGCAGG - Intronic
976696287 4:87922668-87922690 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
976740133 4:88348330-88348352 CAAAGGTGAAGGATCAAGGCAGG + Intergenic
976884815 4:89969628-89969650 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
977009993 4:91624505-91624527 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
977010051 4:91624800-91624822 TAAGGACGAAGGACCAAGGCAGG - Intergenic
977013202 4:91659678-91659700 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
977041762 4:92026669-92026691 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
977062835 4:92276758-92276780 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
977075432 4:92443763-92443785 TAAGGGTGAAGGACCAAGGCAGG + Intronic
977198648 4:94089385-94089407 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
977217387 4:94298015-94298037 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
977225601 4:94388416-94388438 TAAGAGTGAAGGACCAAGGCAGG + Intergenic
977782690 4:100996626-100996648 TAAGGGTGAAGGATCAAGGCAGG + Intergenic
977904154 4:102456359-102456381 TCAGGGTGAGGGACCAAATCTGG + Intergenic
978001355 4:103558592-103558614 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
978031274 4:103942150-103942172 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
978303405 4:107295041-107295063 TGTGGGTGAATGACCAAGACAGG + Intergenic
978730558 4:112021579-112021601 CAATAGAGAAGGACCAAGGCTGG - Intergenic
979054845 4:115980432-115980454 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
979146382 4:117252936-117252958 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
979379639 4:119994540-119994562 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
979641025 4:123012500-123012522 TGTGGGTGAATGACCAAGGCAGG + Intronic
979850565 4:125566568-125566590 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
980003584 4:127516303-127516325 TAAGGATGAAGCACCAAGGCAGG + Intergenic
980284728 4:130768240-130768262 TAAGGTTGAAGAACCAAGGCAGG - Intergenic
980388673 4:132119009-132119031 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
980491532 4:133533754-133533776 TAAGGGTGAAGGATCAAGGCAGG + Intergenic
980527649 4:134013049-134013071 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
980575873 4:134682707-134682729 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
980612027 4:135172238-135172260 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
980903668 4:138928654-138928676 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
981040035 4:140214518-140214540 TAAGGGCGAAGGACCAAGGCAGG - Intergenic
981482894 4:145256155-145256177 TGTGGGTGAATGACCAAGGCAGG + Intergenic
981524893 4:145699700-145699722 TAAGGGTGAAGGACCAAGGCAGG - Intronic
981539451 4:145833438-145833460 TAAGGGTGAAGGACTAAGGCAGG - Intronic
982084186 4:151817380-151817402 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
982180737 4:152746258-152746280 TAAGGGTGAAGGACCAAGGCAGG + Intronic
982318614 4:154057345-154057367 CAAAGGTGAAGGATCAAGGCAGG - Intergenic
982396959 4:154923704-154923726 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
982414436 4:155113336-155113358 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
982497376 4:156108456-156108478 TAAGGGTGAAGGACAAAGGCAGG + Intergenic
982535178 4:156601060-156601082 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
983023633 4:162710013-162710035 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
983055257 4:163094031-163094053 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
983265790 4:165506787-165506809 TATAGGTGAATGACCATGGCCGG - Intergenic
983345361 4:166521527-166521549 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
983360141 4:166716999-166717021 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
983414946 4:167440643-167440665 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
983447830 4:167877139-167877161 TAAGGGTGAAGGACCACGGCAGG - Intergenic
983452091 4:167923733-167923755 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
983659344 4:170117267-170117289 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
983884073 4:172961449-172961471 TAAGGGTGAAGGACCAAGGCAGG + Intronic
984099273 4:175466231-175466253 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
984165559 4:176299549-176299571 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
984321938 4:178207961-178207983 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
984393836 4:179169669-179169691 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
984411543 4:179404295-179404317 TGTGGGTGAATGACCAAGGCAGG - Intergenic
984437035 4:179721363-179721385 TAAGGGTGAAGGACGAAGGCAGG - Intergenic
984700375 4:182815170-182815192 TAAGGGTGAAGGACCAAAGCAGG - Intergenic
985057577 4:186048822-186048844 CGTGGGTGAATGACCAAGGCAGG + Intergenic
985079196 4:186246766-186246788 TAAGGGTGAAGGATCAAGGCAGG + Intronic
985390150 4:189484516-189484538 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
985435497 4:189926722-189926744 TAAGGGTGAAAGACCAAGGCAGG - Intergenic
985582028 5:703328-703350 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
986193294 5:5516401-5516423 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
986388642 5:7264446-7264468 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
986555815 5:9008822-9008844 TAAGGGTGAAAGACCAAGGCAGG + Intergenic
986905545 5:12490743-12490765 TGAGGGTGAAGGACCAAGGCAGG - Intergenic
986919841 5:12667448-12667470 TAAGGGCGAAGGACCAAGGCAGG + Intergenic
987281789 5:16420803-16420825 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
987498371 5:18673702-18673724 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
987755548 5:22095487-22095509 TAAGGGTGAAGGACCAAGGCAGG - Intronic
989530535 5:42502912-42502934 TAAAGGAGAAGGAGCAAGGCAGG + Intronic
990565302 5:57021616-57021638 TGTGGGTGAATGACCAAGGCAGG + Intergenic
992394406 5:76358119-76358141 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
992452460 5:76886142-76886164 TAAGGGTGAAGGACCAAGGCAGG + Intronic
992960581 5:81954060-81954082 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
993192419 5:84699086-84699108 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
993836413 5:92824602-92824624 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
994126298 5:96171495-96171517 TGTGGGTGAATGACCAAGGCAGG + Intergenic
994324647 5:98435342-98435364 TGTGGGTGAATGACCAAGGCAGG - Intergenic
994376016 5:99016084-99016106 TAAAGGTGAAAGACCAAGGAAGG + Intergenic
994532844 5:100989344-100989366 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
994556716 5:101315856-101315878 TAAGGGCAAAGGACTAAGGCAGG - Intergenic
994775459 5:104032536-104032558 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
994779295 5:104069591-104069613 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
995125492 5:108573815-108573837 TAAGGGTGAAGGACCAAGACAGG + Intergenic
995769199 5:115651592-115651614 TGTGGGTGAATGACCAAGGCAGG - Intergenic
996052847 5:118951820-118951842 CCAAGGTGAAGGATCAAGGCAGG + Intronic
996203514 5:120702521-120702543 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
996345019 5:122478283-122478305 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
996358802 5:122623471-122623493 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
996509667 5:124304600-124304622 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
996527817 5:124497873-124497895 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
996575202 5:124971262-124971284 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
996745772 5:126844809-126844831 TAAGGGTGAAGGACAAAGGCAGG + Intergenic
997157051 5:131572521-131572543 TGTGGGTGAATGATCAAGGCAGG - Intronic
997362348 5:133303186-133303208 TCTGGGTTGAGGACCAAGGCAGG - Intronic
997679091 5:135736641-135736663 TATGGGTGAAGGACCAAGGCAGG + Intergenic
997746179 5:136302257-136302279 TAAGGGTGAAGGACCAAGGCAGG - Intronic
997769921 5:136544515-136544537 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
997772915 5:136570357-136570379 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
997788735 5:136737859-136737881 TAAGAGTGAAGGACCATGGCAGG - Intergenic
998881623 5:146651187-146651209 TAAGGATTAAGGACAAAGCCAGG - Intronic
998996608 5:147873627-147873649 TAAGGGTGAAGGACCAAGGCAGG + Intronic
999619101 5:153454527-153454549 TAAGTGTGAAGGACTAAGGCAGG + Intergenic
999954213 5:156682751-156682773 TAGGGGTCAAGGACCAGGGGAGG + Intronic
1000438342 5:161240805-161240827 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1000519665 5:162280299-162280321 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1000885535 5:166743804-166743826 TAAGGGGGAAGGACCAAGGCAGG + Intergenic
1000935902 5:167302819-167302841 TAAGGGTGAAGGACCAAGGCAGG + Intronic
1001331733 5:170767015-170767037 TAAGGGTGAAGGACCAAGGCAGG + Intronic
1001354697 5:171008009-171008031 TATGGGTAAATGACCAAGGCAGG + Intronic
1002611222 5:180419625-180419647 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1003430436 6:6032747-6032769 TAAGGGTGAAGGACCAAGACAGG + Intergenic
1004031472 6:11874241-11874263 TAAATGTGAAGGGCCGAGGCAGG + Intergenic
1004105960 6:12668009-12668031 TAAGGATGAAGGACCAAGGCAGG - Intergenic
1004283803 6:14301944-14301966 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1004508272 6:16264041-16264063 TAAGGGTGAAGGACCAAGGCAGG + Intronic
1004574985 6:16886807-16886829 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1004768845 6:18759039-18759061 TAAGGGTGAAGGACCAAGGTAGG + Intergenic
1004785098 6:18959790-18959812 TAAGGGTGAAAGAACAGTGCAGG + Intergenic
1004836792 6:19539865-19539887 TAAGGGTAAAGGACCAAGGCAGG - Intergenic
1005014914 6:21366377-21366399 TAAGGGTGAAGTACCAAGGCAGG + Intergenic
1005350936 6:24935009-24935031 TAAGAGAGAAGGACCCAGGCCGG + Intronic
1005463444 6:26090145-26090167 TAAGAATTCAGGACCAAGGCTGG + Intronic
1005786754 6:29251847-29251869 TGTGGGTGAATGACCAAGGCAGG + Intergenic
1005786771 6:29251961-29251983 TGTGGGTGAATGATCAAGGCAGG + Intergenic
1006392086 6:33764411-33764433 TAAAGGTGTAGCACCCAGGCTGG - Intergenic
1006603088 6:35238757-35238779 AAAGGGTGGAGGAAAAAGGCAGG + Intronic
1006881641 6:37345003-37345025 TAAGGGTGCATGACCAAAACAGG - Intergenic
1007084770 6:39135641-39135663 TGTGGGTGAATGACCAAGGCAGG + Intergenic
1008476301 6:51939105-51939127 TAAGGGTGAAGGACCAAGGCAGG - Intronic
1008850529 6:56015937-56015959 TAAGGGTGAAGGACCAATGCAGG + Intergenic
1009269606 6:61601061-61601083 TGTGGGTGAATGACCAAGGCAGG - Intergenic
1009343374 6:62586809-62586831 TAAGGGTGAAGAACCAAGGCAGG - Intergenic
1009359142 6:62792451-62792473 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1009378952 6:63006311-63006333 TGTGGTTGAATGACCAAGGCAGG - Intergenic
1009464170 6:63951018-63951040 TAAGGGTGAAGGATCAAGGCAGG - Intronic
1009750490 6:67873558-67873580 TAAGGGTGAAGGATCAAGGCAGG + Intergenic
1010071916 6:71753213-71753235 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1010586987 6:77665564-77665586 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1010827153 6:80487258-80487280 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1010841508 6:80652476-80652498 TAAGGGTCAAGGACCAAGGCAGG + Intergenic
1010894841 6:81350289-81350311 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1011368106 6:86603044-86603066 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1012014612 6:93834861-93834883 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1012066760 6:94558685-94558707 TAAGGGTGAAGGACCAAGGCTGG + Intergenic
1012315562 6:97780376-97780398 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1012674899 6:102102950-102102972 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1012689294 6:102293589-102293611 TAAGGGTAAAGGACAAAGGCAGG - Intergenic
1012770969 6:103435274-103435296 TAGTGGTGAAGGAACAAGGCTGG - Intergenic
1013408148 6:109860717-109860739 GAAGGGTGAAGGACCAAGGCAGG + Intergenic
1013808315 6:114017307-114017329 TGTGGGTGAATGACCAAGGCAGG + Intergenic
1013891434 6:115032659-115032681 TGAGGGTGAAGGACCAAGGTAGG - Intergenic
1014395756 6:120925664-120925686 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1014455147 6:121625413-121625435 TAAGCGTGAAGGACCAAGGCAGG + Intergenic
1014555588 6:122840623-122840645 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1014611882 6:123557691-123557713 TAAGGGTGAAGGACCAAGACAGG - Intronic
1014614913 6:123587166-123587188 TAAGGATGAAGGACCAAGGCAGG + Intronic
1014718366 6:124891267-124891289 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1014794272 6:125706874-125706896 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1014891324 6:126849703-126849725 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1015164964 6:130193139-130193161 TAAAGGTGAAGGACCAAGGCAGG - Intronic
1015266476 6:131296224-131296246 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1015269405 6:131324175-131324197 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1015271111 6:131339679-131339701 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1015277930 6:131403786-131403808 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1015323562 6:131902421-131902443 TACGGGTGAAGGACCAAGGCAGG - Intergenic
1015801636 6:137066258-137066280 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1016114375 6:140262219-140262241 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1016204301 6:141453650-141453672 TAAGGGTGAAGGACAAAGGCAGG - Intergenic
1016248584 6:142016535-142016557 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1016518563 6:144924035-144924057 CAAGGGTGAAGGACCAAGGCAGG - Intergenic
1016535989 6:145108019-145108041 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1016650608 6:146455587-146455609 TAAGGGTGAAGGTCCAAGGCAGG + Intergenic
1016751016 6:147630990-147631012 TAAGGGTGAAGGATCAAGGCAGG - Intronic
1016853019 6:148640597-148640619 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1017269634 6:152491285-152491307 TGTGGGTGAATGACCAAGGCAGG - Intronic
1017510545 6:155110944-155110966 TCAGGGTCAAGCACAAAGGCAGG - Intronic
1017779598 6:157705636-157705658 TAAGGGTGAAGGACCAAGGCAGG + Intronic
1017923136 6:158888342-158888364 TGTGGGTGAATGACCAAGGCAGG + Intronic
1018084754 6:160291461-160291483 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1018495710 6:164343920-164343942 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1018521766 6:164657203-164657225 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1019397535 7:830097-830119 TAAGGGGGAAGGAGGAAGGAGGG + Intronic
1020315795 7:6904612-6904634 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1020324155 7:6961461-6961483 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1020532962 7:9358317-9358339 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1020541351 7:9463314-9463336 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1021172487 7:17414913-17414935 TAAAGGTGAAGGATCAAGGCAGG - Intergenic
1021393411 7:20121594-20121616 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1021660431 7:22914217-22914239 TGTGGGTGAATGACCAGGGCAGG - Intergenic
1021810419 7:24397125-24397147 TAATGGTGAAGGACCAAGGCAGG - Intergenic
1021978108 7:26028922-26028944 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1022372654 7:29785818-29785840 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1022447225 7:30480340-30480362 TGTGGGTGAATGACCAAGGCAGG - Intergenic
1022708871 7:32833443-32833465 TAAGGGTGAAGGACCAAGACAGG - Intergenic
1022710269 7:32842650-32842672 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1022854948 7:34304683-34304705 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1022990689 7:35704258-35704280 TAAGGGTGTTAGACCAAGGAGGG + Intergenic
1023699136 7:42875473-42875495 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1024697348 7:51870759-51870781 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1025910272 7:65823040-65823062 TAAGGCTGGGGGGCCAAGGCAGG - Intergenic
1027157567 7:75779737-75779759 TGTGGGTGAATGACCAAGGCAGG - Intronic
1027158045 7:75782362-75782384 TGTGGGTGAATGACCAAGGCAGG - Intronic
1027343935 7:77238146-77238168 TGAGGATGAGGAACCAAGGCTGG - Intronic
1027354228 7:77340758-77340780 TGTGGGTGAATGACCAAGGCAGG - Intronic
1027759797 7:82262947-82262969 TAATGGTGAGAGACCAAGGTGGG - Intronic
1027851706 7:83460531-83460553 TAAAGGTGAAGGACCAAGGCAGG - Intronic
1028590081 7:92484408-92484430 TGTGGGTGAGTGACCAAGGCAGG + Intergenic
1028689944 7:93640772-93640794 TAAGGGTGAAGGACCGAGGCAGG - Intronic
1029499999 7:100923096-100923118 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1030111901 7:106034058-106034080 GAAGTGGGAAGGAGCAAGGCAGG - Intergenic
1030163799 7:106533043-106533065 TGTGGGTGAATGACCAAGGCAGG + Intergenic
1030193242 7:106830404-106830426 TGTGGGTGAATGATCAAGGCAGG - Intergenic
1030441890 7:109596737-109596759 TAAGGGTGAAGGACCCAGGCAGG + Intergenic
1030445961 7:109646713-109646735 TAAGGGTGAAGGATCAAGGGAGG + Intergenic
1030585387 7:111412064-111412086 GAAGGGTGGAGGACAAATGCAGG + Intronic
1030751746 7:113238389-113238411 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1031004453 7:116456491-116456513 TAAGGGTGGAGGACCAAGGCAGG - Intronic
1031355451 7:120782037-120782059 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1031364987 7:120890532-120890554 TAAGGGTGAAAGACCAAGGCAGG + Intergenic
1031399692 7:121316246-121316268 TAAGGGTGAAGGACTGAGGCAGG - Intergenic
1031422684 7:121568819-121568841 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1031525309 7:122817597-122817619 TAAGGGTGAAGGACCAAGGCAGG - Intronic
1031639208 7:124141074-124141096 TAAGGTGGAAGGACCAACTCAGG - Intergenic
1031728166 7:125263740-125263762 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1031776087 7:125910829-125910851 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1031777088 7:125918399-125918421 TAAGGGTGAAGGAGCAAGGCAGG - Intergenic
1033084534 7:138330098-138330120 TGTGGGTGAATGACCAAGACAGG - Intergenic
1033114662 7:138614720-138614742 TAAGGTTGAAGGGACGAGGCTGG + Intronic
1033211310 7:139462268-139462290 TAAGGGTGAAGGACCAAGGCAGG - Intronic
1033465270 7:141583592-141583614 TAAGGGTGAAGGATCTAGGAAGG + Intronic
1033625401 7:143105912-143105934 TGTGGGTGAATGACCAAGGCAGG - Intergenic
1033676202 7:143542068-143542090 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1033695631 7:143787371-143787393 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1033909730 7:146248364-146248386 TAAGGGTGAAGGACCAAGGCAGG + Intronic
1034085038 7:148314755-148314777 TAAGGGTGAAGGACCAAGGCAGG + Intronic
1035886472 8:3296488-3296510 TAAGGATGATATACCAAGGCAGG + Intronic
1036071156 8:5441447-5441469 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1036281224 8:7403157-7403179 TAAGGGTGAATGACCAAGGCAGG - Intergenic
1036340242 8:7908415-7908437 TAAGGGTGAATGACCAAGGCAGG + Intergenic
1036371909 8:8169504-8169526 TAAGGGTGAAGGAACAAGGCAGG - Intergenic
1036472597 8:9064342-9064364 TAAGGGTGAGGGACAAAGGCAGG + Intronic
1036549484 8:9804030-9804052 TGTGGGTGAATGACCAAGACAGG - Intergenic
1036639213 8:10571941-10571963 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1036878995 8:12496139-12496161 TAAGGGTGAAGGAACAAGGCAGG + Intergenic
1040647838 8:49420584-49420606 TAAGCATGAAGGATCAAGGCAGG - Intergenic
1041652030 8:60311120-60311142 TAAGGGTGAAGGATCAAGGCAGG + Intergenic
1041669522 8:60478648-60478670 TAGGGGTGAGCCACCAAGGCTGG - Intergenic
1041917712 8:63152918-63152940 TGTGGGTGAATGACCAAGGCAGG + Intergenic
1042453278 8:68973847-68973869 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1042705892 8:71665465-71665487 CAAGGGTGAAGGATCAAGGCAGG - Intergenic
1042707142 8:71675805-71675827 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1043353879 8:79390804-79390826 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1043597632 8:81903134-81903156 TGTGGGTGAATGACCAAGGCAGG + Intergenic
1043718159 8:83510081-83510103 TAAGGGTGAAGGACCAAGGTAGG + Intergenic
1043837460 8:85063668-85063690 TAAGGGCAAAGGACCAAGGCAGG - Intergenic
1044148729 8:88746973-88746995 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1044258839 8:90094986-90095008 TAAGGGTGAAGGACCAAGGCAGG + Intronic
1044416831 8:91948848-91948870 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1044565357 8:93656609-93656631 TAACTGTCAAGGTCCAAGGCTGG - Intergenic
1044921713 8:97175880-97175902 TAAGGGTGGAGGACCAAGGCAGG - Intergenic
1044924882 8:97201638-97201660 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1045197230 8:99944541-99944563 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1046074718 8:109301909-109301931 TGTTGGTGAATGACCAAGGCAGG - Intronic
1046293881 8:112196705-112196727 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1046386612 8:113514488-113514510 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1046439818 8:114242472-114242494 TAAGGGTGAAGGACCATGGCAGG - Intergenic
1046442948 8:114282564-114282586 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1046511853 8:115213120-115213142 TAAGGGTGAAGGACAAAGGCAGG - Intergenic
1046559035 8:115815481-115815503 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1047699105 8:127432573-127432595 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1047829766 8:128616728-128616750 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1047856145 8:128915296-128915318 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1048135243 8:131741579-131741601 AAGGGGTGAAGGACCAAGGCAGG - Intergenic
1048168685 8:132085102-132085124 TAAGGGTGAAGGACCAAGGCAGG + Intronic
1048585692 8:135772131-135772153 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1048728622 8:137413029-137413051 TAAGGGTAAAGGACCAAGGCAGG + Intergenic
1048764480 8:137829715-137829737 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1049551189 8:143260723-143260745 TCAGGGTGACTGAGCAAGGCTGG - Intronic
1049632352 8:143665564-143665586 TGAGGGGGATGGAACAAGGCGGG + Intergenic
1049720262 8:144112345-144112367 GCAGGGTGAGGGACCCAGGCAGG + Exonic
1049869062 8:144959138-144959160 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1049874458 8:145007345-145007367 TGAGGGTGGAGGCCCAAGACAGG - Intergenic
1050117377 9:2276530-2276552 TAAGGGTGAAGGGACAAGGCAGG - Intergenic
1050140293 9:2510507-2510529 CCAAGGTGAAGGATCAAGGCAGG - Intergenic
1050258319 9:3815919-3815941 TAAGGGTGAAGGACCAAAGCAGG + Intergenic
1050473926 9:6020894-6020916 TAAAGGTGAAGGACCAAGGCAGG - Intergenic
1051052398 9:12949254-12949276 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1051849541 9:21490607-21490629 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1051953596 9:22663208-22663230 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1052191582 9:25669752-25669774 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1053040270 9:34864361-34864383 CAAGGGTCAAGGACAAAGGAAGG + Intergenic
1053057733 9:35004133-35004155 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1053078641 9:35155828-35155850 TGTAGGTGAATGACCAAGGCAGG + Intergenic
1053133961 9:35637754-35637776 TGTGGGTGAATGACCAAGGCAGG - Intronic
1054807690 9:69409456-69409478 TAAGGGTGAAGGACGAAGGCAGG + Intergenic
1055232794 9:74086447-74086469 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1055347968 9:75356664-75356686 TAAGAGTGAAGGACCAAGGCAGG + Intergenic
1055809793 9:80138158-80138180 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1055881529 9:81009908-81009930 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1055978281 9:81975514-81975536 TAAGTGAGAAGGACAAAGGGTGG - Intergenic
1056044956 9:82705398-82705420 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1056060918 9:82884612-82884634 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1056323572 9:85459202-85459224 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1056391700 9:86146903-86146925 TGTGGGTGAATGACCAAGGCAGG - Intergenic
1056467940 9:86877352-86877374 CAAAGGTGAAGGACCCAGGGTGG - Intergenic
1056522153 9:87411575-87411597 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1056882772 9:90413573-90413595 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1057234601 9:93348467-93348489 TAAGGGTGAAGGACCAAGGTAGG - Intergenic
1057377749 9:94540700-94540722 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1057389436 9:94630448-94630470 TAATGGTCAAGGCCCCAGGCTGG + Intronic
1057683696 9:97215394-97215416 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1057812764 9:98270454-98270476 TGTGGGTGAATGATCAAGGCAGG + Intergenic
1057812775 9:98270508-98270530 TGTGGGTGAATGATCAAGGCAGG + Intergenic
1057812786 9:98270562-98270584 TGTGGGTGAATGATCAAGGCAGG + Intergenic
1057981759 9:99670649-99670671 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1058026474 9:100145666-100145688 TAAGGGTGAAGGACCAAGGCAGG + Intronic
1058612182 9:106789110-106789132 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1059546390 9:115179479-115179501 TAAGGGTGAAGGACCAAGGCAGG + Intronic
1059574338 9:115474061-115474083 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1059606946 9:115844039-115844061 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1059863720 9:118490508-118490530 TAAGAGTGAAGGACAAAGGCAGG + Intergenic
1060211573 9:121713589-121713611 CAGGGGTGAAGGAGCAGGGCAGG + Intronic
1060225916 9:121790877-121790899 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1060318676 9:122535298-122535320 TAAGGGTAAAGGACCAAGGCCGG + Intergenic
1060738142 9:126079566-126079588 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1060920083 9:127414403-127414425 CCAAGGTGAAGGATCAAGGCAGG - Intergenic
1060977655 9:127774408-127774430 TCAGAGTGAAGGACCGAGGGAGG + Exonic
1061582849 9:131548051-131548073 TGTGGGTGAATGACCAAGGCAGG - Intergenic
1185858827 X:3559279-3559301 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1185990828 X:4892478-4892500 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1186113133 X:6277078-6277100 TAAGGGTGAAGGAGCAAGGCAGG + Intergenic
1186783832 X:12940705-12940727 TAAGCATGAATGACCAAGGCAGG - Intergenic
1187086774 X:16049575-16049597 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1187100139 X:16183577-16183599 TAAGGGTGAAAGACCAAGGCAGG + Intergenic
1187103950 X:16221442-16221464 TGTGGGTGAATGACCAAGGCAGG + Intergenic
1188201184 X:27294098-27294120 CCAAGGTGAAGGATCAAGGCAGG + Intergenic
1188301237 X:28507005-28507027 TAAGGATGAAGGATCAAGGAAGG + Intergenic
1188333218 X:28897259-28897281 TAAGGGTGAAGGACCAAGGCAGG + Intronic
1188463619 X:30453962-30453984 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1188552459 X:31378593-31378615 TAAAGGTGAAGGACCAAGGCAGG - Intronic
1188890871 X:35610182-35610204 CGTGGGTGAATGACCAAGGCAGG - Intergenic
1189031998 X:37460409-37460431 TAAATGTGAAGGATCAAGGCAGG + Intronic
1189822397 X:44883209-44883231 TAAGCGTGAACCACCAAGCCTGG + Intronic
1191014370 X:55792890-55792912 TGTGGGTGAATGACCAAGGCAGG + Intergenic
1192705893 X:73528550-73528572 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1192731829 X:73808568-73808590 CCAAGGTGAAGGATCAAGGCAGG + Intergenic
1192936033 X:75859228-75859250 TGTGGGTGAATGACCAAGGCAGG + Intergenic
1193536879 X:82727623-82727645 TGTGGGTGAATGACCAAGGCAGG - Intergenic
1193941215 X:87682557-87682579 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1194186500 X:90778256-90778278 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1194293836 X:92104990-92105012 CAAGGGTGAAGGACCAAGTCAGG + Intronic
1194308780 X:92277915-92277937 TAAGGGTGAAGGACCAAGGCAGG + Intronic
1194351036 X:92825309-92825331 TAAGGGTGAAGGAGCAAGGCAGG - Intergenic
1194366862 X:93023798-93023820 TAAGGGTGAAGGATCAAGGCAGG - Intergenic
1194503233 X:94703725-94703747 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1194660436 X:96624834-96624856 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1194823023 X:98529183-98529205 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1194874053 X:99164336-99164358 TAAGGTTGAAGGAGCAAGGCAGG + Intergenic
1195017138 X:100791068-100791090 TGTGGGTGAATGACCAAGGTAGG + Intergenic
1195291479 X:103434587-103434609 TGTGGGTGAATGACCAAGGCAGG + Intergenic
1195327071 X:103766479-103766501 TAAGGGTGAAGGATCAAGGCAGG + Intergenic
1195908898 X:109869973-109869995 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1195941058 X:110168339-110168361 TCAGGGTCAAGGACCATGTCAGG - Intronic
1196072818 X:111544676-111544698 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1196165262 X:112531271-112531293 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1196221216 X:113113536-113113558 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1196299796 X:114040918-114040940 TAAGGGTGAAGTACCAAGGCAGG - Intergenic
1196330567 X:114467539-114467561 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1196342000 X:114606354-114606376 TTAAGGTGAAGGATCAAGGCAGG + Intronic
1196525736 X:116725847-116725869 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1196533777 X:116817325-116817347 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1196572253 X:117280007-117280029 AAAGGGTGAAGGACCAAGGCAGG - Intergenic
1196584930 X:117418734-117418756 TGTGGGTGAATGACCAAGGCAGG - Intergenic
1196774094 X:119322591-119322613 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1196992932 X:121347825-121347847 TAAGGGTGAAGGACTAAAGCAGG + Intergenic
1197064670 X:122222883-122222905 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1197352291 X:125393674-125393696 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1197470720 X:126863939-126863961 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1197793467 X:130278164-130278186 CTAAGGTGAAGGATCAAGGCAGG - Intergenic
1197932835 X:131712876-131712898 TAAGGGTGAAAGACCAAGGCAGG - Intergenic
1198598183 X:138259488-138259510 TAAGGGTGAAGGACCATGGCAGG - Intergenic
1198599639 X:138269181-138269203 TAAGGGTAAAGGACCAAGGTAGG + Intergenic
1199576214 X:149316461-149316483 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1200008022 X:153100682-153100704 TGTGGGTGAATGATCAAGGCAGG + Intergenic
1200533100 Y:4360332-4360354 TAAGGGTGAAGGACCAAGGCAGG + Intergenic
1200611355 Y:5329531-5329553 CAAGGGTGAAGGACCAAGTCAGG + Intronic
1200659362 Y:5941989-5942011 TAAGGGTGAAGGACTAAGGCAGG - Intergenic
1200675085 Y:6140054-6140076 TAAGGTTGAAGGATCAAGGCAGG - Intergenic
1200870130 Y:8088777-8088799 TATATGTGAAGGACCAAGGCAGG + Intergenic
1201061825 Y:10052916-10052938 TGTGAGTGAATGACCAAGGCAGG + Intergenic
1201504983 Y:14688349-14688371 AAAGGGCAAAAGACCAAGGCTGG + Intronic
1201524730 Y:14919525-14919547 GAAGGAGGAAGGACCAGGGCAGG + Intergenic
1201581147 Y:15513148-15513170 TAAGGGTGAAGGACCAACACAGG - Intergenic
1201852158 Y:18497205-18497227 TAAGTGTGGGGGGCCAAGGCGGG + Intergenic
1201881163 Y:18823175-18823197 TAAGTGTGGGGGGCCAAGGCGGG - Intronic
1201936841 Y:19419331-19419353 TAAGGGTGAAGGACCAAGGCAGG - Intergenic
1202076789 Y:21044296-21044318 CAAGGGTGAAGGACCAAGGCGGG + Intergenic