ID: 1029500000

View in Genome Browser
Species Human (GRCh38)
Location 7:100923100-100923122
Sequence CCACTAAGGGTGAAGGACCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1522
Summary {0: 93, 1: 326, 2: 368, 3: 366, 4: 369}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029500000_1029500008 -2 Left 1029500000 7:100923100-100923122 CCTTGGTCCTTCACCCTTAGTGG 0: 93
1: 326
2: 368
3: 366
4: 369
Right 1029500008 7:100923121-100923143 GGAAAGTACCGCTTTTCTGGGGG No data
1029500000_1029500006 -4 Left 1029500000 7:100923100-100923122 CCTTGGTCCTTCACCCTTAGTGG 0: 93
1: 326
2: 368
3: 366
4: 369
Right 1029500006 7:100923119-100923141 GTGGAAAGTACCGCTTTTCTGGG No data
1029500000_1029500009 -1 Left 1029500000 7:100923100-100923122 CCTTGGTCCTTCACCCTTAGTGG 0: 93
1: 326
2: 368
3: 366
4: 369
Right 1029500009 7:100923122-100923144 GAAAGTACCGCTTTTCTGGGGGG No data
1029500000_1029500005 -5 Left 1029500000 7:100923100-100923122 CCTTGGTCCTTCACCCTTAGTGG 0: 93
1: 326
2: 368
3: 366
4: 369
Right 1029500005 7:100923118-100923140 AGTGGAAAGTACCGCTTTTCTGG No data
1029500000_1029500007 -3 Left 1029500000 7:100923100-100923122 CCTTGGTCCTTCACCCTTAGTGG 0: 93
1: 326
2: 368
3: 366
4: 369
Right 1029500007 7:100923120-100923142 TGGAAAGTACCGCTTTTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029500000 Original CRISPR CCACTAAGGGTGAAGGACCA AGG (reversed) Intergenic
900782129 1:4625129-4625151 CCACTCACTGTGGAGGACCACGG - Intergenic
900840542 1:5045668-5045690 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
900840582 1:5045856-5045878 CCACTAAGGGTGAAGGAGAAGGG - Intergenic
901831561 1:11895364-11895386 CCACGAAGGGAGAAGCATCAGGG + Intergenic
902226161 1:14997696-14997718 CCCCTGAGGGTGGAGGAGCAGGG + Intronic
904711400 1:32433182-32433204 CAGCTAAGGGTGAAGGACCAAGG - Intergenic
904711434 1:32433303-32433325 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
904996675 1:34636665-34636687 CTGCCAAGGGTGAAGGACCAAGG + Intergenic
905060756 1:35137158-35137180 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
905499542 1:38425956-38425978 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
905499571 1:38426077-38426099 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
906080674 1:43086354-43086376 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
906080707 1:43086471-43086493 CCACTAAGGGTAAAGGAGAAGGG - Intergenic
906488357 1:46248324-46248346 CGGCTAAGAGTGTAGGACCAGGG - Exonic
906744749 1:48213834-48213856 CCTATAAGGGTGAAGGAGAAGGG + Intergenic
906744782 1:48213959-48213981 CCACTAAGGGTGAAGGACCAAGG + Intergenic
907292395 1:53425188-53425210 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
907503782 1:54902622-54902644 CCACTAAGGGTGAAGGAGAAGGG + Intergenic
907503816 1:54902743-54902765 CCACTAAGGGTGAAGGACCAAGG + Intergenic
907521040 1:55023601-55023623 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
908208721 1:61878220-61878242 ACACTGAGGAGGAAGGACCAGGG - Intronic
908461924 1:64354749-64354771 CCACTAAGGGTGAAGGAGAAGGG + Intergenic
908461957 1:64354874-64354896 CCGCTAAGGGTGAAGGACTAAGG + Intergenic
908592187 1:65646710-65646732 CCACTAAGAGTGAAGGAGAAGGG + Intergenic
908592214 1:65646837-65646859 CCGCTAAGAGTGAAGGAGAAAGG + Intergenic
908592231 1:65646901-65646923 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
908592292 1:65647148-65647170 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
908852097 1:68386870-68386892 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
908852174 1:68387178-68387200 CCACTAAGGGTGAAGGAGAAGGG - Intergenic
908852192 1:68387242-68387264 CCGCTAAAGGTGAAGGAGAAGGG - Intergenic
908852208 1:68387306-68387328 TCACTAAGGGTGAAGGAGAAGGG - Intergenic
909014539 1:70368492-70368514 CCACTAAGGGTGAAGGATCAAGG - Intronic
909035240 1:70589227-70589249 CCACTAAGGGTGAAGGACCAAGG - Intergenic
909035275 1:70589352-70589374 CCACTAAGAGTGAAAGAGAAGGG - Intergenic
909222852 1:72984523-72984545 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
909222868 1:72984586-72984608 CTGCTAAGGGTGAAGGACCAAGG + Intergenic
909223850 1:72992506-72992528 CTGCTAAGGGTGAAGGAGAAGGG + Intergenic
909223869 1:72992570-72992592 CCACTAAGGGTGAAGGAGAAGGG + Intergenic
909223888 1:72992634-72992656 CCACTAAGGGTGAAGGAGAAGGG + Intergenic
909223906 1:72992698-72992720 CCACTAAGGGTGAAGGACCAAGG + Intergenic
909551227 1:76899523-76899545 CCGCTAAGGGTGAAGGACCAAGG + Intronic
909729214 1:78873046-78873068 CTGCTAAGGATGAATGACCAAGG - Intergenic
909788472 1:79643508-79643530 CTGCTAAGGGTGAAGGAGAAGGG + Intergenic
909788503 1:79643628-79643650 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
909793216 1:79701179-79701201 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
909909697 1:81246161-81246183 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
909909731 1:81246286-81246308 CCGCAAAGGGTGAAGGAGCAGGG - Intergenic
909978643 1:82072163-82072185 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
909978675 1:82072288-82072310 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
910049133 1:82956155-82956177 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
911510819 1:98805962-98805984 CCACTAAGGGTGAAGGAGCAAGG + Intergenic
911570141 1:99510380-99510402 CCGCTAAGGGTGAAGGACAAAGG - Intergenic
911570171 1:99510505-99510527 CCACGAAGGGTGAAGGAGAAGGG - Intergenic
911570188 1:99510569-99510591 CCACTAAGAGTGAAGGAGAAGGG - Intergenic
911672234 1:100620266-100620288 CAACTAAGGAAGCAGGACCAGGG - Intergenic
911759962 1:101602640-101602662 CTGCTAAGGGTGAAGGATCAAGG + Intergenic
911983682 1:104597105-104597127 CCACCACGGGTGAAGGATCAAGG - Intergenic
912296242 1:108473817-108473839 CCGCTAAGAGTGAATGACCAAGG - Intergenic
915111548 1:153567112-153567134 ACACTGAGGGTGAGGGACAAGGG + Intronic
918346759 1:183614074-183614096 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
918567886 1:185953050-185953072 CCACTAAGGGTGAAGGAGAAGGG + Intronic
918567905 1:185953114-185953136 CCACTAAGGGTGAAGGAGAAGGG + Intronic
918567950 1:185953303-185953325 CTGCTAAGGGTGAAGGACCAAGG + Intronic
918714604 1:187770187-187770209 CCACTAAGGGTGAAGGAGAAGGG + Intergenic
918714622 1:187770251-187770273 CCACTAAGGGTGAAGGAGAAGGG + Intergenic
918714637 1:187770313-187770335 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
919476129 1:198035490-198035512 CCGCTAAGGGTGAAGGACTAAGG - Intergenic
920272678 1:204778029-204778051 CCACTCTGGCTGATGGACCATGG + Intergenic
920829126 1:209449678-209449700 CCACTAAGGGTGAAGGACCAAGG - Intergenic
920829160 1:209449805-209449827 CCACTAAGGGTGAAGGAGAAGGG - Intergenic
920829177 1:209449869-209449891 CCACTAAGGGTGAAGGAGAAGGG - Intergenic
920829196 1:209449933-209449955 CCGCTCAGGGTGAAGGAGAAGGG - Intergenic
920901707 1:210115391-210115413 CCACTAAGGGTGAAGGATCAAGG + Intronic
921212214 1:212910509-212910531 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
921459998 1:215414721-215414743 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
921460012 1:215414785-215414807 CTGCTAAGGGTGAAGGACCAAGG + Intergenic
921519908 1:216146483-216146505 GCGCTAAGGGTGAAGGACCAAGG - Intronic
921519926 1:216146547-216146569 CCGCTAAGGGTGAAGGAGAAGGG - Intronic
921733180 1:218598500-218598522 TCGCTAAGGGTGAAGGAGAAGGG + Intergenic
921733197 1:218598564-218598586 GCGCTAAGGGTGAAGGAGAAGGG + Intergenic
921733216 1:218598628-218598650 CCACTAAGGGTGAAGGAGAAGGG + Intergenic
921733348 1:218599180-218599202 CTGCTAAGGGTGAAGGACCAAGG + Intergenic
922048172 1:221966787-221966809 CCGCTAAGGGTGAAGGACTAAGG - Intergenic
922048205 1:221966912-221966934 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
922048222 1:221966976-221966998 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
922049755 1:221977876-221977898 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
922049772 1:221977940-221977962 CCAGTAAGGGTGAAGGAGAATGG + Intergenic
922049803 1:221978064-221978086 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
922154277 1:223029134-223029156 CTGCTAAGGGTGAAGGAGAATGG + Intergenic
922154305 1:223029258-223029280 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
922363744 1:224845137-224845159 CCACTAAGGGTGAAGGACCAAGG + Intergenic
922363767 1:224845231-224845253 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
922906149 1:229175200-229175222 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
922934634 1:229413480-229413502 CCACTAAGGGTGAAGGAGAAGGG - Intergenic
923074970 1:230602080-230602102 CTGCTAAGGGTGAAGGACCAAGG - Intergenic
923075001 1:230602201-230602223 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
923214367 1:231834793-231834815 CCACTAACGGTGAAGGACCAAGG + Intronic
923244504 1:232118986-232119008 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
923244537 1:232119111-232119133 CCACTAAGGGTGAAGGAGAAGGG - Intergenic
923257489 1:232233981-232234003 CCACTAAGGGTGAAGGAGAAGGG + Intergenic
923408842 1:233688269-233688291 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
923408862 1:233688352-233688374 CCACTAAGGGTGAAGGAGAAGGG + Intergenic
923408881 1:233688416-233688438 CCACTAAGGGTGAAGGAGAAGGG + Intergenic
923408915 1:233688541-233688563 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
923770918 1:236936856-236936878 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
923770963 1:236937041-236937063 CTGCTAAGGGTGAAGGACCAAGG + Intergenic
923962524 1:239102050-239102072 CCACTAAGGGTGAAGGACCAAGG - Intergenic
923962556 1:239102174-239102196 CCGCTAAGAGTGAAGGAGAAGGG - Intergenic
924180389 1:241434722-241434744 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
924180421 1:241434847-241434869 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
924896265 1:248340247-248340269 CCACTAAGGGTGAAGGACCAAGG + Intergenic
1063362865 10:5471610-5471632 CCACTAAGGGTGAAGGACCAAGG - Intergenic
1063362897 10:5471735-5471757 CCACTAAGGGTGAAGGAGAAGGG - Intergenic
1063509821 10:6634388-6634410 CCACTAAGAGTGAAGGAGAAGGG + Intergenic
1063509837 10:6634452-6634474 TCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1063509882 10:6634638-6634660 CTGCTAAGGGTGAAGGACCAAGG + Intergenic
1063527876 10:6801801-6801823 CCACTAAGAGTGAAGGAGAAGGG + Intergenic
1063527934 10:6802048-6802070 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
1063770825 10:9197928-9197950 ACACTAAGAGTGAAGAAACAAGG + Intergenic
1064464356 10:15564376-15564398 CCACTGAGGGTGGAGGACGCTGG + Intronic
1064664006 10:17631476-17631498 CCTCTAAGGGTGAAGGAGAAGGG + Intergenic
1064664040 10:17631602-17631624 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
1064887244 10:20124090-20124112 CCGCTAAGGATGAAGGACAAAGG + Intronic
1065437389 10:25717250-25717272 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
1065443404 10:25773917-25773939 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1065443422 10:25773981-25774003 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
1068058558 10:52038543-52038565 CCGCTAAGAGTGAAGGAGAAGGG + Intronic
1068058588 10:52038668-52038690 CTGCTAAGGGTGAAGGACCAAGG + Intronic
1068179853 10:53503741-53503763 CCGCTAAGCGTGAAGGAGAAGGG + Intergenic
1068179884 10:53503866-53503888 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
1068230719 10:54167544-54167566 CCGCTAAGGGTGAAGGACCAAGG - Intronic
1068360606 10:55972332-55972354 CCTCTAAGGGTGAAGGATCAAGG - Intergenic
1068592547 10:58865732-58865754 CCGCTAAGGGTGAAAGAGAAGGG + Intergenic
1068592565 10:58865796-58865818 CCACTAAGGATGAAGGAGAAGGG + Intergenic
1068592597 10:58865921-58865943 CTGCTAAGGGTGAAGGACCAAGG + Intergenic
1070474597 10:76819140-76819162 CCGCTAAGGGCGAAGGACCAAGG - Intergenic
1070474616 10:76819204-76819226 CCGCTGAGGGTGAAGGAGAAGGG - Intergenic
1070474636 10:76819268-76819290 CCGCTGAGGGTGAAGGAGAAGGG - Intergenic
1070474655 10:76819332-76819354 CCGCTGAGGGTGAAGGAGAAGGG - Intergenic
1070474675 10:76819396-76819418 CCGCTGAGGGTGAAGGAGAAGGG - Intergenic
1070474694 10:76819460-76819482 CCGCTGAGGGTGAAGGAGAAGGG - Intergenic
1070474713 10:76819524-76819546 CCGCTGAGGGTGAAGGAGAAGGG - Intergenic
1070474732 10:76819588-76819610 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
1071897935 10:90085776-90085798 CCGCTAAGAGTGAAGGAGAAGGG + Intergenic
1071897968 10:90085901-90085923 CTGCTAAGGGTGAAGGACCAAGG + Intergenic
1071915966 10:90295841-90295863 CTGCTAAGGGTGAAGGACCAAGG - Intergenic
1071916009 10:90296023-90296045 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
1071960847 10:90808159-90808181 CCGCTAAGGGTGAAGGACCAAGG - Intronic
1071960907 10:90808398-90808420 CCGCTAAGGATGAAGGAGAAGGG - Intronic
1072011525 10:91306409-91306431 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1072011539 10:91306469-91306491 CTGCTAAGGGTCAAGGACCAAGG + Intergenic
1073683346 10:105728437-105728459 CCACTAAGGGTGAAGGATCAAGG - Intergenic
1073709664 10:106022196-106022218 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
1074018809 10:109563289-109563311 CTGCTAAGGGTGAAGGACCAAGG - Intergenic
1074740533 10:116481516-116481538 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
1074740565 10:116481637-116481659 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
1075248486 10:120845827-120845849 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
1075248504 10:120845891-120845913 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
1076134809 10:128038178-128038200 CCACTGAGAGTGAATGGCCAGGG + Intronic
1077327956 11:1971769-1971791 CCGCTAAGGGTCATGGGCCAAGG - Intronic
1077590080 11:3484384-3484406 CTGCTAAGGGTGAAGGACCAAGG + Intergenic
1077611933 11:3648739-3648761 CCGCTAAGGGTGAAGGACCAAGG - Intronic
1077611963 11:3648864-3648886 CCGCTAAGGGTGAAGGAGAAGGG - Intronic
1077679352 11:4224422-4224444 CCACTAAGGGTGAAAGACCAAGG + Intergenic
1077688773 11:4321006-4321028 CCACTAAGGGCGAAAGACCAAGG + Intergenic
1077766647 11:5165251-5165273 CCGCTAAGGGTGAAGGACCAAGG + Intronic
1077851046 11:6074802-6074824 CCACTAAGGGTGAAGGAGAAGGG + Intergenic
1077851089 11:6074990-6075012 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
1077883163 11:6366868-6366890 CCACTAAGGGTGAAGGACCAAGG - Intergenic
1078046347 11:7916960-7916982 CCACTAAGGGTGAAGGAGAAGGG + Intergenic
1078046364 11:7917024-7917046 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
1079111376 11:17607039-17607061 CCTCCAAGGGTCTAGGACCAGGG - Intronic
1079447250 11:20568745-20568767 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
1079447267 11:20568809-20568831 CCACTAAGGGTGAAGGAGAAAGG - Intergenic
1079672755 11:23188589-23188611 CTGCTAAGGGTGAAGGAGAAGGG + Intergenic
1079672820 11:23188838-23188860 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
1079727296 11:23891950-23891972 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1079727327 11:23892071-23892093 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
1080028126 11:27633850-27633872 CCACTAAGAGTGAAGGAGAAGGG + Intergenic
1080028144 11:27633914-27633936 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1080028178 11:27634039-27634061 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
1080227144 11:29974223-29974245 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
1081159428 11:39734985-39735007 CCGCTAAGGGTGAAAGACCAAGG - Intergenic
1081356596 11:42121529-42121551 CTGCTAAGGGTGAAGGACCAAGG - Intergenic
1082055605 11:47813379-47813401 CCACTAAGGATGAGGGAATAAGG + Exonic
1082225821 11:49705807-49705829 CCACTAGGGCTAAAGGAACAAGG + Intergenic
1082645520 11:55719940-55719962 CCAGTAAGGGCAAAGGGCCAGGG + Intergenic
1084046930 11:66574460-66574482 CCGCTAAGGGTGAAGGACTAAGG - Intergenic
1084046958 11:66574585-66574607 CCACTAAGGGTGAAGGAGAAGGG - Intergenic
1084232059 11:67760517-67760539 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
1084232089 11:67760638-67760660 CCACTAAGGGTGAAGGAAAAGGG - Intergenic
1084245798 11:67856156-67856178 CTGCTAAGGGTGAAGGACCAAGG + Intergenic
1084353791 11:68623632-68623654 CCGCTAAGGGTGAAGGACTAAGG - Intergenic
1084355321 11:68634593-68634615 CCACTAAGGGCGAAGGACCAAGG - Intergenic
1084355344 11:68634687-68634709 CCACTCAGGGTGAAGGAGAAGGG - Intergenic
1084613482 11:70219059-70219081 CTGCTAAGGGTGAAGGAGAAGGG + Intergenic
1084613541 11:70219301-70219323 CCGCTATGGGTGAAGGACCAAGG + Intergenic
1084826872 11:71738358-71738380 CTGCTAAGGGTGAAGGACCAAGG - Intergenic
1084826885 11:71738422-71738444 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
1084933724 11:72576018-72576040 GCACCAAGGGTGGAGGACCCTGG + Intergenic
1085987771 11:81807000-81807022 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
1085987799 11:81807119-81807141 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
1085995545 11:81908394-81908416 CAACTAAGGGTGCTGTACCAAGG - Intergenic
1086132910 11:83419980-83420002 CCACTAAGGGTGAAGGATCAAGG - Intergenic
1086136509 11:83447730-83447752 CCACTAAGGGTGAAGGACCAAGG + Intergenic
1086550012 11:88044236-88044258 CTGCTAAGGGTGAAGGACCAAGG - Intergenic
1086623274 11:88913924-88913946 CCACTAGGGCTGAAGGAACAAGG - Intronic
1087098865 11:94346559-94346581 CCACTAAGGGTGAAGGACCAAGG - Intergenic
1087098896 11:94346683-94346705 CCACTTAGGGTGAAGGAGAAGGG - Intergenic
1087127598 11:94642548-94642570 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
1087196647 11:95310321-95310343 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
1087196697 11:95310507-95310529 CCACTGAGGGTGAAGGAGAAGGG - Intergenic
1087196716 11:95310571-95310593 CCACTAAGGGTGAAGGAGAAGGG - Intergenic
1087314379 11:96588507-96588529 CCACTAAGGGTGAAGGACCAAGG - Intergenic
1087314410 11:96588632-96588654 CCGCTAAGGGTGAAGGAGAAAGG - Intergenic
1087314426 11:96588696-96588718 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
1087314443 11:96588760-96588782 CCACTAAGAGTGAAGGAGAAGGG - Intergenic
1087839790 11:102909046-102909068 CCACTAAAGGTGAAGGACAAAGG + Intergenic
1089348900 11:117810301-117810323 CCACTAAGGGTGAAGGAGAAGGG - Intronic
1089472289 11:118730875-118730897 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1089472322 11:118730996-118731018 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
1089867268 11:121642663-121642685 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
1089953017 11:122547459-122547481 CTGCTAAGGGTGAAGGACCAAGG - Intergenic
1089987151 11:122825264-122825286 CCACTAAGGGTGAAAGACCAAGG - Intergenic
1089987180 11:122825385-122825407 CCACTAAGAGTGAAGGAGAAGGG - Intergenic
1089987226 11:122825565-122825587 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
1090527002 11:127547488-127547510 CCACTAAGGGTGAAGGAGAAGGG + Intergenic
1090527023 11:127547613-127547635 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
1090546699 11:127773856-127773878 CCACTAAGGGTGGAGGAGAAGGG + Intergenic
1090546710 11:127773920-127773942 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1090546731 11:127774045-127774067 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
1090850793 11:130569013-130569035 CCGCTGAGGGTGAAGGAGAAGGG + Intergenic
1090850810 11:130569077-130569099 CCACTAAGGATGAAGGACCGAGG + Intergenic
1090872148 11:130758157-130758179 CCGCTGAGGGTGAAGGAGAAGGG + Intergenic
1090872182 11:130758282-130758304 CCGCTAAGGGTGAAGGACCGAGG + Intergenic
1090927177 11:131259293-131259315 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1091183410 11:133627615-133627637 CTGCTAAGGGTGAAGGACCAAGG - Intergenic
1202810935 11_KI270721v1_random:26949-26971 CCGCTAAGGGTCATGGGCCAAGG - Intergenic
1091886282 12:4019413-4019435 CCGCTGAGGTTGAAGGACCAAGG - Intergenic
1091886310 12:4019538-4019560 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
1092416381 12:8293286-8293308 CTGCTAAGGGTGAAGGACCAAGG + Intergenic
1092474257 12:8805824-8805846 CCACTAAGAGTGAAGGAGAAGGG - Intergenic
1092592920 12:9967650-9967672 CCGCTAAGGGTGAAGGAGAAGGG + Intronic
1092592960 12:9967824-9967846 TCGCTAAGGGTGAAGGACCAAGG + Intronic
1092626947 12:10337624-10337646 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1092626978 12:10337749-10337771 CTGCTAAGGGTGAAGGACCAAGG + Intergenic
1092723935 12:11466991-11467013 CCGCTAAGGGTGAAGGAGAAGGG + Intronic
1092723969 12:11467116-11467138 CCAGTAAGGGTGAAGGACCAAGG + Intronic
1092739526 12:11614406-11614428 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
1092789469 12:12059210-12059232 CCGCTAAGGGTGAAGGACCAAGG - Intronic
1092789503 12:12059331-12059353 CCGCTAAGGGTGAAGGATAAGGG - Intronic
1092925050 12:13264665-13264687 CCGCTAAGGGTGAAGGACGAAGG + Intergenic
1093071391 12:14709703-14709725 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
1093160956 12:15745825-15745847 CAACAAAGGATGAATGACCAGGG + Intronic
1093268204 12:17026355-17026377 CCACTAAGGGTGAAGGAGAAGGG + Intergenic
1093268238 12:17026480-17026502 CCACTAAGGGTGAAGGACCAAGG + Intergenic
1093578495 12:20763791-20763813 CTGCTAAGGGTGAAGGACCAAGG - Intergenic
1093578526 12:20763916-20763938 CCACTAAGAGTGAAGGAGAACGG - Intergenic
1093578538 12:20763980-20764002 CCACTAAGGGTGAAGGAGAAGGG - Intergenic
1093584696 12:20821607-20821629 CCACTAAGGGTGAAGGAGAAGGG + Intronic
1093584731 12:20821732-20821754 CGGCTAAGGGTGAAGGACCAAGG + Intronic
1093813033 12:23510672-23510694 CCGCTAAGGGTGAAGGACCAGGG + Intergenic
1093950845 12:25164054-25164076 CCGCTAAGGGTGAAGGACCAAGG - Intronic
1093950888 12:25164229-25164251 CTGCTAAGGGTGAAGGAGAAGGG - Intronic
1094316263 12:29139725-29139747 CTGCTAAGGGTGAAGGAGAAGGG + Intergenic
1094316306 12:29139903-29139925 CCACTAAGGGTGAAGGACCAAGG + Intergenic
1094400447 12:30056922-30056944 CCACTAAGGGTGCAGGACCAAGG - Intergenic
1094400463 12:30056983-30057005 CCACTAAGGGTGAAGGAGAAGGG - Intergenic
1094825523 12:34266475-34266497 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
1095880523 12:47131484-47131506 CCACTACTGATGAAGGACAATGG - Intronic
1096196377 12:49651403-49651425 CCACAGAGGGTGCAGCACCAGGG + Exonic
1096907360 12:54947522-54947544 TCACTAAGGGTGAAGGATCAAGG + Intergenic
1097398303 12:59102508-59102530 CTGCTAAGGGTGAAGGACCAAGG - Intergenic
1097398379 12:59102816-59102838 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
1097417250 12:59327922-59327944 CCGCCAAGGGTGAAGGAGAAGGG + Intergenic
1097417284 12:59328050-59328072 CCACTAAGGGTGAAGGACCAAGG + Intergenic
1097542422 12:60956764-60956786 CCTCTAAGGGTGAAGGACCAAGG + Intergenic
1097591707 12:61582699-61582721 CCACAAGAGGTGAAGGAGCAGGG + Intergenic
1097592184 12:61587915-61587937 CCGCTAAGGGTGAAGGATCAAGG - Intergenic
1097693943 12:62759636-62759658 CTGCTAAGGGTGAAAGACCAAGG - Intronic
1098173830 12:67771326-67771348 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1098173858 12:67771451-67771473 CCGCTAAAGGTGAAGGACCAAGG + Intergenic
1098401974 12:70086160-70086182 TCGCTAAGGCTGAAGGACCAAGG - Intergenic
1098401990 12:70086224-70086246 CCGCTGAGGGTGAAGGAGAAGGG - Intergenic
1098402009 12:70086288-70086310 CCGCTGAGGGTGAAGGAGAAGGG - Intergenic
1098402028 12:70086352-70086374 CCGCTGAGGGTGAAGGAGAAAGG - Intergenic
1098402046 12:70086416-70086438 CCGCTGAGGGTGAAGGAGAAGGG - Intergenic
1098628813 12:72704094-72704116 CTGATAAGGGCGAAGGACCAAGG - Intergenic
1098654075 12:73006862-73006884 CCACTAAGGGTGAAGGACCAAGG + Intergenic
1099188473 12:79540720-79540742 CTGCTAAGGGTGAAGGACAAAGG - Intergenic
1099188503 12:79540845-79540867 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
1099292315 12:80787922-80787944 CCACTAAGAGTGAAGGAGAAGGG + Intergenic
1099292346 12:80788043-80788065 CTGCTAAGGGTGAAGGACCAAGG + Intergenic
1099639959 12:85273848-85273870 CTCCTAGGGGTGCAGGACCAAGG - Intergenic
1099762335 12:86939563-86939585 CCGCTAAGGGTGAGAGACCAAGG - Intergenic
1099762366 12:86939687-86939709 CCGCTAAGGGTGAAGGAGAGGGG - Intergenic
1099836288 12:87912033-87912055 CCACTAAGGGTGAAGGACCAAGG + Intergenic
1100561042 12:95749704-95749726 CCACTAAGGGTGAAGGACCAAGG - Intronic
1100561090 12:95749893-95749915 CCACTAAGGGTGAAGGAGAAGGG - Intronic
1100561109 12:95749957-95749979 CCACTAAGGGTGAAGGAGAAGGG - Intronic
1100561128 12:95750021-95750043 CCGCTAAGAGTGAAGGAGAAGGG - Intronic
1100940058 12:99716027-99716049 CTGCTAAGGGTGAAGGACCGAGG - Intronic
1101001956 12:100365592-100365614 CCACTAAGGAAGAAGCACAATGG - Intronic
1101066566 12:101027714-101027736 CCACTAGGGGATAAGGCCCAGGG - Intronic
1101278661 12:103227662-103227684 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
1105031977 12:132890398-132890420 CCACTAAGGGTGAAGGACCAAGG - Intronic
1106943209 13:34799557-34799579 CCGCTGAGGGTGAAGGAGAAGGG - Intergenic
1106943227 13:34799621-34799643 CCGCTGAGGGTGAAGGAGAAGGG - Intergenic
1107075319 13:36317200-36317222 CCGCTAAGGGTGAAGGACCAAGG - Intronic
1107220505 13:37973915-37973937 CCACTAAGGGTGAAGGAGAAGGG + Intergenic
1107220522 13:37973979-37974001 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1107220555 13:37974104-37974126 CCGCTAAGGGTGAAGGACAAAGG + Intergenic
1107619039 13:42205941-42205963 ACACTAAAGATGAAGGACAATGG - Intronic
1107683343 13:42872123-42872145 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1107683379 13:42872251-42872273 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
1108202438 13:48057197-48057219 CCGCTAAGGGTGAAGGACCAAGG - Intronic
1108221404 13:48237026-48237048 CCAGAAAGGGTAAAGAACCAGGG - Intronic
1108512754 13:51170748-51170770 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
1108512771 13:51170812-51170834 CCACTAAGGGTGAAGGAGAAGGG - Intergenic
1108512787 13:51170876-51170898 CCACTAAGGGTGAAGGAGAAGGG - Intergenic
1108913625 13:55583005-55583027 CCACTAAGAGTGAAGGAGAAGGG + Intergenic
1108913643 13:55583069-55583091 CCACTAAGGTTGAAGGAGAAGGG + Intergenic
1108913675 13:55583194-55583216 TCGCTAAGGGTGAAGGACCACGG + Intergenic
1108919767 13:55659775-55659797 CCACTAAGGGTGAAGGAGAAGGG + Intergenic
1108919794 13:55659902-55659924 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
1108947197 13:56041123-56041145 CTGCTAAGGGTGAAGGACCAAGG - Intergenic
1108953168 13:56117240-56117262 CCGCTAAGGGTGAAGGAGAAAGG + Intergenic
1108953197 13:56117365-56117387 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
1109092884 13:58071018-58071040 CCACTAAGTGAGGAGAACCAAGG - Intergenic
1109343364 13:61089296-61089318 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
1109499045 13:63213951-63213973 CTGCTAAGGGTGAAGGACCAAGG - Intergenic
1109499077 13:63214071-63214093 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
1109674010 13:65648861-65648883 CCACTAAGCTGGAAGGAGCAAGG - Intergenic
1109709858 13:66146024-66146046 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1109709888 13:66146149-66146171 CCGCTAAGGATGAAGGACCAAGG + Intergenic
1109716971 13:66231193-66231215 CCACTAAGGGTGAATTAGAAGGG + Intergenic
1109716989 13:66231257-66231279 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1109717036 13:66231446-66231468 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
1110650734 13:77938464-77938486 CTGCTAAGGGTGAAGGAGAAGGG + Intergenic
1110650750 13:77938524-77938546 CCGCTAAGGGTGAATGACCAAGG + Intergenic
1110765215 13:79274920-79274942 CCGCTAAGGGTGAGGGACCAAGG - Intergenic
1110765248 13:79275041-79275063 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
1110845085 13:80184392-80184414 CAGCTAAGGGTGAAGGACCAAGG - Intergenic
1110978220 13:81866938-81866960 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
1110978254 13:81867059-81867081 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
1111126241 13:83912958-83912980 CCGCTAAGGGTGAAGGACTAAGG + Intergenic
1111301763 13:86359049-86359071 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
1111301795 13:86359174-86359196 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
1111362318 13:87191122-87191144 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1111362351 13:87191247-87191269 CCACTAAGGGTGAAGGACCAAGG + Intergenic
1111459060 13:88517585-88517607 CCACTAAGGGTGAAAGAGAGGGG + Intergenic
1111459093 13:88517713-88517735 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1111630239 13:90840424-90840446 CCGCTAAGGCTGAAGGACCAAGG - Intergenic
1111630268 13:90840549-90840571 CCGCTAACGGTGAAGGAGAAGGG - Intergenic
1111631910 13:90853323-90853345 CCGCTAAGGGTGAAAGAGAAGGG + Intergenic
1111631925 13:90853387-90853409 CCGCTAAAGGTGAAGGACCAAGG + Intergenic
1112236593 13:97643146-97643168 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
1112236624 13:97643271-97643293 CCACTAACGGTGAAGGAGAAGGG - Intergenic
1112329728 13:98468116-98468138 TCACTAAGGCTGCAGGAACATGG - Intronic
1112889541 13:104212857-104212879 CTGCTAAGGGTGAAGGAGAAGGG + Intergenic
1112889570 13:104212971-104212993 CTGCTAAGGGTGAATGACCAAGG + Intergenic
1113324026 13:109265952-109265974 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
1113324089 13:109266199-109266221 CCACTAAGGGTGAAGGAGAAGGG - Intergenic
1113324108 13:109266263-109266285 CCACTAAGGGTGAAGGAGAAGGG - Intergenic
1115240865 14:31250223-31250245 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
1115904543 14:38191516-38191538 CCGCTAAGGGTGAAGGACAAAGG - Intergenic
1115904575 14:38191641-38191663 CCACTCAGGGTGAAAGAGAAGGG - Intergenic
1116179426 14:41516744-41516766 ACACTAAGGGTGAAGGACCAAGG - Intergenic
1116179455 14:41516869-41516891 CCACTAAGGGTGAAGGAGAAGGG - Intergenic
1116534986 14:46017124-46017146 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1116535019 14:46017245-46017267 CTGCTAAGGGTGAAGGACCAAGG + Intergenic
1116573241 14:46544904-46544926 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
1116573274 14:46545031-46545053 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
1116613294 14:47105113-47105135 CCGCTAAGGGTGAAGGACCAAGG - Intronic
1116613312 14:47105177-47105199 CCACTAAGGGTGAAGGAGAAGGG - Intronic
1116702600 14:48260086-48260108 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
1116703530 14:48267298-48267320 CCGCTCAGGGTGAAGGAGAAGGG + Intergenic
1116703553 14:48267419-48267441 CCGCTAAGGCTGAATGACGAAGG + Intergenic
1116952672 14:50894043-50894065 CCGCTAAGGGTGAAGGACCAAGG - Intronic
1116952706 14:50894168-50894190 CCACTAAGGATGAAGGAGAAGGG - Intronic
1116952724 14:50894232-50894254 CCGCTAAGGGTGAAGGAGAAGGG - Intronic
1117958124 14:61138176-61138198 CCGCTAAGGGTGAAGGAAAAGGG + Intergenic
1117958157 14:61138301-61138323 CCGCTAAAGGTGAAAGACCAAGG + Intergenic
1118937558 14:70301088-70301110 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
1118940246 14:70328230-70328252 CCAACAAGGGAGAAGGGCCAAGG + Intronic
1119022154 14:71125048-71125070 CTGCTAAGGGTGAAGGACCAAGG - Intergenic
1119022187 14:71125169-71125191 CCACTAAGAGTGAAGGAGAAGGG - Intergenic
1119316922 14:73704201-73704223 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
1120438276 14:84505003-84505025 CCGCTAAAGGTGAAGGAGAAGGG + Intergenic
1120438307 14:84505120-84505142 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
1120539783 14:85737735-85737757 CCGCTAAGGGTGAAAGACCAAGG + Intergenic
1120660181 14:87239811-87239833 CCACTAAGGGTGAAGGAGAAGGG + Intergenic
1120660214 14:87239932-87239954 GCGCTAAGGGTGAAGGACCAAGG + Intergenic
1121703418 14:95973839-95973861 CCACTAAGGGTGAAGGAGAAGGG - Intergenic
1121703434 14:95973903-95973925 CCGCTAAGGGTGCAGGAGAAGGG - Intergenic
1121715212 14:96068924-96068946 CCACTGAGGGAGAAGGAAAAAGG + Intronic
1122037268 14:98957812-98957834 CCACAGAGGGCGGAGGACCAGGG + Intergenic
1122040768 14:98986117-98986139 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
1122040786 14:98986181-98986203 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
1124386145 15:29209596-29209618 CCACAGAGAGAGAAGGACCATGG + Intronic
1125045494 15:35239493-35239515 CCGCTAAGGGTGAAGGACCAAGG - Intronic
1125045528 15:35239619-35239641 CCGCTAAGGTTGAAGGAGAAGGG - Intronic
1125045546 15:35239683-35239705 CCACTAAGGGTGAAGGAGAAGGG - Intronic
1125045564 15:35239747-35239769 CTGCTAAGGGTGAAGGAGAAGGG - Intronic
1125131813 15:36290795-36290817 CCGCTAAGGGTGAAGGACGAAGG + Intergenic
1125848905 15:42885606-42885628 CTGCTAAGGGTGAAGGACCAAGG - Intronic
1126530345 15:49703775-49703797 CCACTAAGGGTGAAGGAGAAGGG + Intergenic
1126530370 15:49703894-49703916 CCGCTAAGGTTGAAGGACCAAGG + Intergenic
1126843505 15:52739421-52739443 CCGCTAAGGGTGAAAGACCAAGG - Intergenic
1126843536 15:52739540-52739562 CCGCTAAAGGTGAAGGAGAAGGG - Intergenic
1126912586 15:53431484-53431506 CCACTAAGGGTGAAGGAGAGGGG + Intergenic
1126912608 15:53431577-53431599 CGGCTAAGGGTGAAGGACCAAGG + Intergenic
1129259243 15:74354972-74354994 CCACTAAGGGTGAAGGATCAAGG - Intronic
1129997863 15:80022516-80022538 CCACTAAGGCTGAAGAGGCAAGG + Intergenic
1130304347 15:82703208-82703230 CCACTAAGGGTGAAAGATCAAGG - Intronic
1130360147 15:83176580-83176602 ACACTAATGGTGAAGGTCCAGGG - Intronic
1130854839 15:87831977-87831999 CCACTAAGGGTGAAGGACCAAGG - Intergenic
1130947690 15:88561232-88561254 CCGCTAGGGGTGAAGGAGAAGGG + Intergenic
1131164680 15:90133919-90133941 CCACTAAGGGTGAACGATCAAGG - Intergenic
1131447457 15:92512203-92512225 CTGCTAAGGGTGAAGGACCAAGG - Intergenic
1131447486 15:92512321-92512343 CCGCTAAGGGTGAAGGAGAAAGG - Intergenic
1131683943 15:94751593-94751615 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
1131882734 15:96876645-96876667 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1131882753 15:96876709-96876731 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1131882770 15:96876773-96876795 CCGCTAAGGGTGAAAGACCAAGG + Intergenic
1132262753 15:100441041-100441063 CCGCTAAGGGTGAAGGACCAAGG - Intronic
1132340170 15:101073371-101073393 CCGCTAAGGGTGAAGGACCAAGG - Intronic
1132340205 15:101073492-101073514 CCGCTCAGGGTGAAGGAGAAGGG - Intronic
1133651152 16:7815517-7815539 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
1133651182 16:7815638-7815660 CCGCTAAGAGTGAAGGAGAAGGG - Intergenic
1133765941 16:8837751-8837773 CCGCTAAGGGTGAAGGACCAAGG + Intronic
1133766911 16:8844457-8844479 CCGCTAAGGGTGAAGGAGAAGGG + Intronic
1133766945 16:8844582-8844604 CCGCTAAGGGTTATGGACCAAGG + Intronic
1133869825 16:9676242-9676264 CTGCTAAGGGTGAAGGAGAAGGG + Intronic
1133869852 16:9676367-9676389 CCACTAAGGGTGAAGGACCAAGG + Intronic
1137363250 16:47839580-47839602 CTGCTAAGGGTGAAGGACCAAGG - Intergenic
1138394403 16:56692780-56692802 CCACAAAGGGTTAAGGGACAAGG + Intronic
1138804651 16:60079418-60079440 CTGCTAAGGGTGAAGGACCAAGG - Intergenic
1139039420 16:62983782-62983804 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1139039457 16:62983905-62983927 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1139039494 16:62984030-62984052 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1139039530 16:62984155-62984177 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1139039630 16:62984524-62984546 CCACTAAGGGTGAAGGAAAAGGG + Intergenic
1139039665 16:62984649-62984671 CCGCTAAGGGTGAAGGACTAAGG + Intergenic
1139226113 16:65234526-65234548 CCACTAAGGGTGAAGGAGAAGGG + Intergenic
1139226131 16:65234590-65234612 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
1139943230 16:70621107-70621129 TCGCTAAGGGTGAAGGAGAAGGG + Intronic
1139943246 16:70621171-70621193 CCGCTAAGGTTGAAGGACCAAGG + Intronic
1139943915 16:70625437-70625459 CCGCTAAGGGCGAAGGAGAAGGG + Intronic
1139943947 16:70625560-70625582 CTGCTAAGGGTGAAGGACCAAGG + Intronic
1141796498 16:86278778-86278800 CCGCTGAGGGTGAAGGAGAAGGG - Intergenic
1141796518 16:86278842-86278864 CCGCTGAGGGTGAAGGAGAAGGG - Intergenic
1141796538 16:86278906-86278928 CCGCTGAGGGTGAAGGAGAAGGG - Intergenic
1141796558 16:86278970-86278992 CCGCTGAGGGTGAAGGAGAAGGG - Intergenic
1141796578 16:86279034-86279056 CCGCTGAGGGTGAAGGAGAAAGG - Intergenic
1141865410 16:86746687-86746709 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1141865427 16:86746751-86746773 TCGCTGAGGGTGAAGGACCAAGG + Intergenic
1142270732 16:89088146-89088168 CCACTCAAGGTGGAGGCCCAGGG - Intergenic
1144104388 17:11972620-11972642 CCACTAAGGGTGAAGGACCAAGG - Intergenic
1144104419 17:11972742-11972764 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
1146515613 17:33486861-33486883 CCACCAAGTGAGAAGGACAAGGG + Intronic
1146597633 17:34184043-34184065 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
1146597664 17:34184168-34184190 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
1146597683 17:34184232-34184254 CCACTAAGGGTGAAAGAGAAGGG - Intergenic
1147261470 17:39211785-39211807 CCACCAAGGGTGGAGGGCCGAGG + Exonic
1147497381 17:40929815-40929837 CTATTTAGGGTGAAGGACAAGGG + Intronic
1147583542 17:41639657-41639679 GCACTGAGGGAGGAGGACCAGGG + Intergenic
1150306995 17:64093971-64093993 GCACTAAGTGTGGGGGACCAGGG + Intronic
1151622252 17:75253473-75253495 CCGCTAAGGGTGAAGGACCAAGG - Intronic
1151622284 17:75253598-75253620 CCGCTAAGGGTGAAGGAGAAGGG - Intronic
1151670659 17:75570159-75570181 CCACTCAGAGTGCAGGGCCAAGG - Exonic
1151839945 17:76610566-76610588 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1151839961 17:76610630-76610652 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
1152169558 17:78735330-78735352 CAAGTAAGCGTGAGGGACCATGG + Intronic
1152597384 17:81244423-81244445 CCACGAAGGGCAGAGGACCAGGG - Intergenic
1153485098 18:5590061-5590083 CCACTGAGGGCGAAGGAGGAAGG + Intronic
1153600322 18:6774796-6774818 CCACCATAGGTGTAGGACCAGGG - Intronic
1153959418 18:10127924-10127946 CTACTAAGGGTACCGGACCATGG + Intergenic
1155697250 18:28697932-28697954 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1155697267 18:28697996-28698018 CCGCGAAGGGTGAAGGACCAAGG + Intergenic
1155941302 18:31804604-31804626 CTGCTAAAGGTGAAGGACAAAGG - Intergenic
1155941333 18:31804725-31804747 CCACTAAGAGTGATGGAGAAGGG - Intergenic
1156237172 18:35216841-35216863 CCTCTAAGGGTGAAGGACCAAGG - Intergenic
1156302056 18:35844931-35844953 CTGCTAAGGGTGAAGGACCAAGG - Intergenic
1156924267 18:42557237-42557259 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
1157391488 18:47307133-47307155 CCACTAAGAGGGAGGGAGCAGGG + Intergenic
1158336109 18:56416317-56416339 CCACTAAGGGTGAAGGACCAAGG - Intergenic
1158336157 18:56416503-56416525 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
1158336174 18:56416567-56416589 CCGCTAAGGGTGAAGGAGAAAGG - Intergenic
1158336191 18:56416631-56416653 CCACTAAGAGTGAAGGAGAAGGG - Intergenic
1158394872 18:57071473-57071495 CCACTAAGAGTGAAGGAGAAGGG + Intergenic
1158394902 18:57071594-57071616 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
1159164247 18:64682570-64682592 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
1159369031 18:67508249-67508271 ACCCTAAGGGTGCAGGACCTGGG + Exonic
1159834796 18:73325467-73325489 CCGCTAAGAGTGAAGGACCAAGG - Intergenic
1159834845 18:73325654-73325676 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
1161661500 19:5549447-5549469 CCACTAAGGGTGAAGGACCAAGG - Intergenic
1161661518 19:5549511-5549533 CCACTGAGGGTGAAGGAGAAGGG - Intergenic
1161733384 19:5976181-5976203 CTACAATGGGTGAAAGACCATGG + Intronic
1161839434 19:6670100-6670122 CCTCTGAGGTTGAAGGACCCAGG - Exonic
1162242395 19:9365563-9365585 CCGCTAAGGGTGAAGGACCAAGG + Intronic
1163487071 19:17594356-17594378 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
1163900499 19:20095755-20095777 CCGCTAAGGGTGAAGGAGAAGGG + Intronic
1163900531 19:20095882-20095904 CCGCTAAGGGTGAAGGACCAAGG + Intronic
1163906793 19:20155394-20155416 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
1163906823 19:20155521-20155543 CCGCTAAGGGTGAAGGAGAAAGG - Intergenic
1163906841 19:20155585-20155607 CCACTAAGGGTGAAGGAGAAGGG - Intergenic
1164152751 19:22569184-22569206 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
1164152769 19:22569248-22569270 CCACTAAGGGTGAAGGAGAAGGG - Intergenic
1164459429 19:28434581-28434603 CCTCTAAGGGTGAAGGAGAAGGG + Intergenic
1164459471 19:28434773-28434795 CCATTAAGGGTGAAGGAGAAGGG + Intergenic
1164459503 19:28434898-28434920 CCACTAAGGGTGAAGGACCAAGG + Intergenic
1165079047 19:33297462-33297484 CCACTCATGGGGAAGGACAAGGG - Intergenic
1165249013 19:34514926-34514948 CCACTAAGGGTGAAGGATCAAGG - Intergenic
1165408097 19:35642823-35642845 CCCCTGAGGGTGAAGGAAAAGGG + Intronic
1165497215 19:36160129-36160151 CCACTAAGGGTGAAGGACCAAGG + Intergenic
1165510495 19:36264096-36264118 CTGCTAAGGGTGAAGGAGAAGGG + Intergenic
1165510527 19:36264217-36264239 CCACTAAGGGTGAAGGAGAAGGG + Intergenic
1165510559 19:36264342-36264364 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
1165835127 19:38750487-38750509 CCACTAACGGTGAAGGAGAAGGG - Intronic
1165835156 19:38750608-38750630 CTACTAAGGGTGAAGGAGAAGGG - Intronic
1166499152 19:43328263-43328285 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1166717504 19:44977756-44977778 TCACCAAGGGGGAAGGGCCAGGG + Intronic
1166927343 19:46277981-46278003 CTGCTAAGGGTGAAGGACCAAGG + Intergenic
1167046793 19:47054401-47054423 CCACTAAGGGTGAAGGAGAAGGG + Intergenic
1167046823 19:47054524-47054546 CCACCAAGGATGAAGGACCAAGG + Intergenic
1167099200 19:47393703-47393725 CCGCTAAGGGTGAAAGACCAAGG - Intergenic
1167901917 19:52628625-52628647 CTGCTAAGGGTGAAGGACCAAGG - Intronic
1167901942 19:52628745-52628767 CTGCTAAGGGTGAAGGAGAAGGG - Intronic
1168051382 19:53832287-53832309 CCGCTGAGGGTGAAGGACCAAGG - Intergenic
1168212323 19:54899625-54899647 CCACTAAGGGTGAAGGAGAAGGG + Intergenic
1168212354 19:54899743-54899765 CCACTAAGGGTGAAGGACCAAGG + Intergenic
1168228179 19:55011453-55011475 CCGCTAAGAGTGAAGGAGAAGGG + Intergenic
1168228215 19:55011574-55011596 CCACTAAGGGTGAAGGACCAAGG + Intergenic
1168247955 19:55123655-55123677 CCACTAAGGGTGAAGGATCAAGG - Intergenic
925544267 2:5001638-5001660 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
925680218 2:6412562-6412584 CCACTAAGTCTTAAGTACCACGG + Intergenic
925829035 2:7877416-7877438 CTACTAAGGGTGAAGGAGAAGGG + Intergenic
925829052 2:7877480-7877502 CCACTAAGGGTGAAGGAGAAGGG + Intergenic
925829069 2:7877544-7877566 CCACTAAGGGTGAAGGAGAAGGG + Intergenic
925829087 2:7877608-7877630 CCACTAAGGGTGAAGGAGAAGGG + Intergenic
925829104 2:7877672-7877694 CCACTAAGGGTGAAGGAGAAGGG + Intergenic
925829122 2:7877736-7877758 CCACTAAGGGTGAAGGAGAAGGG + Intergenic
925829155 2:7877864-7877886 CCACTAAGGGTGAAGGAGAAGGG + Intergenic
925829185 2:7877988-7878010 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
925918498 2:8623939-8623961 CCACTAATGCTCATGGACCAGGG + Intergenic
926407504 2:12570540-12570562 CCGCTAAGGGTGAAGGACCGAGG - Intergenic
926407554 2:12570729-12570751 CCACTAAGGGTGAAGGAGAAGGG - Intergenic
926413326 2:12627202-12627224 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
926413372 2:12627388-12627410 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
926413390 2:12627453-12627475 CCACTAAGAGTGAAGGAGAAGGG - Intergenic
926464287 2:13168684-13168706 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
926464319 2:13168809-13168831 CTGCTAAGGGTGAAGGACCAAGG + Intergenic
926815752 2:16796645-16796667 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
926815802 2:16796831-16796853 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
927133991 2:20083445-20083467 CCACTAAAGGTGAAGGATCAAGG - Intergenic
928706212 2:33952541-33952563 CCACCAAGGGTCAAGGCCCAGGG + Intergenic
928770806 2:34700502-34700524 CTGCTAAGGTTGAAGGACCAAGG + Intergenic
928778080 2:34790660-34790682 CCACTAAGGGTGAAGGACCAAGG - Intergenic
928779907 2:34805741-34805763 CCGCTAAGGATGAAGGAGAAGGG + Intergenic
928779934 2:34805860-34805882 CTGCTAAGGGTGAAGAACGAAGG + Intergenic
928827836 2:35441738-35441760 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
928928328 2:36599957-36599979 CCGCTAAGGGTGAAGGACCAAGG - Intronic
928928359 2:36600083-36600105 CCGCTAAGGGTGAAGGAGAAGGG - Intronic
929076900 2:38085552-38085574 CCGCTCAGGGTGAAGGAGAAGGG + Intronic
929076933 2:38085673-38085695 CCGCTAAGGGTGAAGGACCAAGG + Intronic
929793288 2:45039183-45039205 TCACTAAGGGTGAAGGAGAAGGG + Intergenic
929793318 2:45039308-45039330 CCACTAAGGGTGAAGGACCAAGG + Intergenic
930954874 2:57193927-57193949 CCGCTAAGGGTGATGGACCAAGG - Intergenic
930954892 2:57193991-57194013 CCACTAAGGGTGAAGGAGAAGGG - Intergenic
930954911 2:57194055-57194077 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
930958183 2:57229896-57229918 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
930958209 2:57230012-57230034 CCACTAAGGATGAAGGAGAAGGG - Intergenic
931026582 2:58118056-58118078 CTGCTAAGGGTGAAGGAGAAGGG + Intronic
931026601 2:58118120-58118142 CCACTAAGGGTGAAGGAGAAGGG + Intronic
931026635 2:58118245-58118267 CCGCTAAGGGTGAAGGACCAAGG + Intronic
931042453 2:58314989-58315011 CTGCTAAGGGTGAAGGACCAAGG - Intergenic
931042486 2:58315111-58315133 CCACTCAGGGTGAAGGAGAAGGG - Intergenic
931236638 2:60418266-60418288 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
931236691 2:60418456-60418478 CCACTGAGCGTGAAGGAGAAGGG - Intergenic
931236706 2:60418520-60418542 CCGCTGAGGGTGAAGGAGAAGGG - Intergenic
931236725 2:60418584-60418606 CCGCTGAGGGTGAAGGAGAAGGG - Intergenic
931236741 2:60418648-60418670 CCGCTGAGGGTGAAGGAGAAGGG - Intergenic
931461416 2:62453464-62453486 CAACTGAGGGTGAAGGAAAAAGG - Intergenic
931625515 2:64253322-64253344 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
931625550 2:64253447-64253469 CCGCTGAGGGTGAAGGAGAAGGG - Intergenic
931625568 2:64253511-64253533 CCACTGAGCGTGAAGGAGAAGGG - Intergenic
931850177 2:66244767-66244789 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
931850206 2:66244892-66244914 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
931850224 2:66244956-66244978 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
931948006 2:67332348-67332370 CCACTAAGGGTGAAGGACTAAGG - Intergenic
931948032 2:67332473-67332495 CCACTAAGGGTGAAGGAGAAGGG - Intergenic
932159694 2:69448468-69448490 CCGCTAAGGCTGAAGGACCAAGG + Intergenic
932295582 2:70621330-70621352 CCGCTAAGGGTGAAGGACCAAGG - Intronic
932295613 2:70621451-70621473 CCACTAAGAGTGAAGGAGAAGGG - Intronic
932359044 2:71089852-71089874 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
932359105 2:71090104-71090126 CCGCTAAGGATGAAGGACCAAGG + Intergenic
932367875 2:71164518-71164540 CCACTAAGGGTGAAGGAGAAGGG + Intergenic
932367924 2:71164704-71164726 CCACTAAGGGTGAAGGAGAAGGG + Intergenic
932854407 2:75218490-75218512 CCGCAAAGGGTGAAGGAGAAGGG + Intergenic
932854438 2:75218615-75218637 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
932974174 2:76578664-76578686 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
932974207 2:76578791-76578813 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
933012828 2:77089107-77089129 CCCCTAAGGGTGAAGGACCAAGG - Intronic
933079035 2:77966001-77966023 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
933079053 2:77966065-77966087 CCACTAAGGGTGAAGGAGAAGGG - Intergenic
933079072 2:77966129-77966151 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
933163502 2:79052220-79052242 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
933163533 2:79052341-79052363 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
933180046 2:79216853-79216875 CCACTAAGGGTGAAGGACCAAGG + Intronic
933329716 2:80879154-80879176 CCACTAAGGGTGAAGGAGAAGGG + Intergenic
933329764 2:80879340-80879362 CCACTAAGGGCGAAAGACCAAGG + Intergenic
933552596 2:83793617-83793639 CTGCTAAGGGTGAAGGACCAAGG + Intergenic
933775994 2:85771593-85771615 ATGCTAAGGGTGCAGGACCAGGG - Intronic
933806294 2:86000204-86000226 ACCCTAAGCGTGAAGGACCAAGG - Intergenic
934922860 2:98359822-98359844 GCACTCAGGGAGATGGACCAGGG + Intronic
935052697 2:99536916-99536938 GAGCTAGGGGTGAAGGACCAGGG + Intergenic
936175737 2:110218763-110218785 CCGCTAAGGGTGAAGGACTAAGG - Intergenic
936175768 2:110218889-110218911 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
936175781 2:110218953-110218975 CCACTAAGGGTGAAGGAGAAGGG - Intergenic
936883110 2:117279636-117279658 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
936883142 2:117279763-117279785 CCGCTAAGGGTGAAGGAGAGGGG - Intergenic
938902395 2:135809087-135809109 CCCCCAGGGGTGAAGGACCCAGG - Exonic
939083349 2:137687678-137687700 CCACTAAGGGTGAAGGAGAAGGG + Intergenic
939083380 2:137687799-137687821 TTGCTAAGGGTGAAGGACTAAGG + Intergenic
939355950 2:141102163-141102185 CCACTAAGGGTGAAGAATACAGG - Intronic
939460916 2:142494490-142494512 CCGCTAAGAGTGAAGGACCAAGG + Intergenic
940107143 2:150113600-150113622 CCACTAAGGGTGAAGGACCAAGG - Intergenic
940529949 2:154868158-154868180 CCACTAAGGGTGAAGGACCAAGG - Intergenic
940529981 2:154868279-154868301 CCACTCAGGGTGAAGGAGAAGGG - Intergenic
940676024 2:156724865-156724887 CCACTCAGGGTGAAGGAGAAGGG + Intergenic
940676049 2:156724986-156725008 CTGCTAAGGGTGAAGGACCAAGG + Intergenic
940799909 2:158122156-158122178 CTACTAGGGATGAAGGGCCAAGG + Intronic
941340161 2:164296685-164296707 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
941340208 2:164296874-164296896 CCACTAAGGGTGAAGGAGAAGGG - Intergenic
941353171 2:164460074-164460096 CCACTAAGGGTGAAGGACCAAGG - Intergenic
941353189 2:164460138-164460160 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
941456396 2:165715199-165715221 CCACTAAGGGTGAAGGAGAAGGG + Intergenic
941456414 2:165715263-165715285 CCACTAAGGGTGAAGGACCAAGG + Intergenic
941936138 2:170982532-170982554 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
942096854 2:172542634-172542656 CTGCTAAGGGTGACGGACCAAGG - Intergenic
942096886 2:172542753-172542775 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
942096900 2:172542813-172542835 CCACTAAGAGTGAAGGAGAAGGG - Intergenic
942246345 2:174012597-174012619 CCGCGAAGGGTGAAGGTCCCCGG - Intergenic
943061373 2:183044914-183044936 CCACTAAGGGCGAAGGATCATGG - Intergenic
943421797 2:187675244-187675266 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
943421824 2:187675369-187675391 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
943449955 2:188034346-188034368 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
943461380 2:188173831-188173853 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
943806338 2:192131009-192131031 CTGCTAAGGGTGAAGGACCAAGG - Intronic
943806428 2:192131378-192131400 CCGCTAAAGGTGAAGGAGAAGGG - Intronic
943806445 2:192131442-192131464 CCACTAAGGGTGAAGGAGAAGGG - Intronic
943834918 2:192506912-192506934 CTGCTAAGGGTGAAGGACTAAGG - Intergenic
943834946 2:192507033-192507055 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
943865174 2:192919151-192919173 CCACTAAGATTGAAGGATCAAGG - Intergenic
943951514 2:194135679-194135701 GCGCTAAGGGTGAAGGACCAAGG + Intergenic
944387205 2:199180247-199180269 CTGCTAAGGGTGAAGGACCAAGG - Intergenic
944387239 2:199180368-199180390 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
944393896 2:199247781-199247803 CTGCTAAGGGTGAAGGACCAAGG - Intergenic
944393925 2:199247905-199247927 CCACTAAGGGTGAAGGAGAAGGG - Intergenic
944876372 2:203966823-203966845 CCGCTAAGCATGAAGGACCAAGG + Intergenic
945153321 2:206811615-206811637 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
945153351 2:206811740-206811762 CCGCTAAGGGTAAAGGACCAAGG + Intergenic
945173207 2:207018049-207018071 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
945173238 2:207018174-207018196 CCACTAAGGGTGAAGGAGAAGGG - Intergenic
945301689 2:208220965-208220987 CTGCTAAGGGTGAAGGAGAAGGG + Intergenic
945301722 2:208221086-208221108 ACGCTAGGGGTGAAGGACCATGG + Intergenic
945361437 2:208900184-208900206 CCACTAAGGGTGAAGGACCAAGG - Intergenic
945375858 2:209078904-209078926 CTGCTAAGGGTGAAGGACCAAGG - Intergenic
945375889 2:209079025-209079047 CCACTAAGGGTGAAGGAGAAGGG - Intergenic
945394099 2:209300223-209300245 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
945394116 2:209300287-209300309 CCACTAAGGGTGAAGGAGAAGGG - Intergenic
945938060 2:215923183-215923205 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
945938091 2:215923308-215923330 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
946215214 2:218178628-218178650 CCACTAACGGTGAAGGAGAAGGG + Intergenic
946215244 2:218178753-218178775 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
946215275 2:218178878-218178900 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
946215309 2:218179003-218179025 CTGCTAAGGGTGAAGGACCAAGG + Intergenic
946781238 2:223194538-223194560 CCGCTAAGGGTGAAGGAGAAGGG + Intronic
946781271 2:223194663-223194685 CTGCTAAGGGTGAAGGACCAAGG + Intronic
946871999 2:224092655-224092677 CTGCTAAGGGTGAAGGACCAAGG + Intergenic
946886295 2:224226283-224226305 CCCCTAAGGGTGAAGGAGAAGGG - Intergenic
946893020 2:224297475-224297497 CCATTAAGGGTGAAGGACCAAGG - Intergenic
946893053 2:224297596-224297618 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
947461702 2:230309372-230309394 CCTCTGAGGGGGAAGGACCGTGG - Intronic
948390397 2:237607618-237607640 CCACTAAGGGTGAAGGACCAAGG - Intergenic
948390432 2:237607739-237607761 CCACTAAGGGGGAAGGAGAAGGG - Intergenic
1168739177 20:173652-173674 CTGCTAAGGGTGAAGGACCAAGG - Intergenic
1168771855 20:420793-420815 CCCCGAAGGGGGAAGGGCCAGGG - Intronic
1170069072 20:12344994-12345016 CCACTAAGGGTGAAGGAGAAGGG + Intergenic
1170069088 20:12345058-12345080 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
1170105983 20:12754698-12754720 CCGCTAAGGGCGAAGGACCAAGG - Intergenic
1170106022 20:12754863-12754885 CCACTAAGGGTGAAGGAGAAGGG - Intergenic
1170165648 20:13358818-13358840 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
1170165696 20:13359006-13359028 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
1170325694 20:15152573-15152595 CCACTAAGGGTGAAGGTGAAGGG + Intronic
1170368457 20:15622057-15622079 ACACTGAAGGGGAAGGACCAGGG + Intronic
1170820895 20:19755774-19755796 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1170820929 20:19755900-19755922 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
1172932760 20:38597932-38597954 CTGCTAAGAGTGAAGGACCAAGG + Intergenic
1173101636 20:40093963-40093985 CCGCTAAGGGTGAAGGACAAAGG - Intergenic
1173101666 20:40094088-40094110 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
1173118633 20:40269933-40269955 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
1173118666 20:40270058-40270080 CCATTAAGGGTGAAGGAGAAGGG - Intergenic
1173118685 20:40270122-40270144 CCACTAAGGGTGAAGGAGAAGGG - Intergenic
1173756788 20:45523412-45523434 CCCCTTAATGTGAAGGACCAAGG - Intergenic
1173781402 20:45760185-45760207 CCACTAAGGGTGAAGGACCAAGG - Intronic
1173781431 20:45760305-45760327 CCGCTAAGGGTGAAGGAGAAGGG - Intronic
1176102033 20:63368725-63368747 CCACTCAGGGTGCTGGTCCAGGG - Intronic
1176416008 21:6475152-6475174 CCACTCTGGGTGAGGGAACACGG + Intergenic
1177031366 21:15984450-15984472 CCGCAAAGGGTGAAGGACCAAGG + Intergenic
1177100388 21:16893045-16893067 CCACTAAGGGTGAAGGACCAAGG - Intergenic
1177100423 21:16893170-16893192 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
1177102477 21:16914962-16914984 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
1177119325 21:17122325-17122347 CCGCTAAGGGTAAAGGACCAAGG - Intergenic
1179015479 21:37591653-37591675 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
1179387284 21:40955640-40955662 CCGCTAAAGGTGAAGGACCAAGG - Intergenic
1179387313 21:40955764-40955786 CCACTAAGGGTGAAGGAGAAGGG - Intergenic
1179617656 21:42592577-42592599 CCACTAAGGCTGGAGGGACAAGG + Intergenic
1179650559 21:42805681-42805703 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
1179691508 21:43083486-43083508 CCACTCTGGGTGAGGGAACACGG + Intergenic
1180560669 22:16612207-16612229 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
1180560687 22:16612271-16612293 CCGCTGAGGGTGAAGGAGAAGGG - Intergenic
1180560705 22:16612335-16612357 CCACTAAGTGTGAAGGGGAAGGG - Intergenic
1181639591 22:24189646-24189668 CCACAAAGGTTGATGGACCCTGG - Intergenic
1182113707 22:27742865-27742887 CCACTAAGGGTGAAGGACCAAGG - Intergenic
1182113725 22:27742929-27742951 CCGCTGAGGGTGAAGGAGAAGGG - Intergenic
1182113745 22:27742995-27743017 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
1182123183 22:27799867-27799889 CCACGGAGGGTGACGAACCAAGG - Exonic
1182732036 22:32503605-32503627 CCGCCAAGGGTGAAGGACCAAGG - Intergenic
1185064095 22:48622085-48622107 CCACTCAGGGTGCAGGAGAAGGG - Intronic
949162308 3:895430-895452 CCGCTAAGAGTGAAGGAGAAGGG + Intergenic
949162339 3:895551-895573 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
949190568 3:1244346-1244368 CCGCTGAGGGTGAAGGAGAAGGG + Intronic
949190587 3:1244410-1244432 CCGCTGAGGGTGAAGGAGAAGGG + Intronic
949190606 3:1244474-1244496 CCGCTGAGGGTGAAGGAGAAGGG + Intronic
949827195 3:8177854-8177876 CCGCTAAGGGTGAAGGAGCAAGG - Intergenic
949827228 3:8177971-8177993 CCACTAAGGGTGAAGGAGAAGGG - Intergenic
950926246 3:16745113-16745135 CCACTAAGGGTGAAGGACCAAGG - Intergenic
950926277 3:16745234-16745256 CCACTAAGGGTGATGGAGAAGGG - Intergenic
951299018 3:20972247-20972269 CCACTAAGGGTGAAGGAGAAGGG + Intergenic
951299051 3:20972368-20972390 CCACTAAGGGTGAAGGACCAAGG + Intergenic
951762994 3:26165022-26165044 CTGCTAAGGGTGAAGGACCAAGG + Intergenic
952343751 3:32466061-32466083 CCTCAAAGGGTGAAGGACCAAGG + Intronic
952663662 3:35879087-35879109 CCAATAAGGGTGAAGGAGAAGGG + Intergenic
952663695 3:35879212-35879234 CTGCTAAGGGTGAAGGACCAAGG + Intergenic
952881821 3:37990446-37990468 CCACTCCGGGTGAGGGATCAGGG + Intronic
952895486 3:38075792-38075814 CCACTAAGGGTGAAGGAGAAGGG + Intronic
952895515 3:38075917-38075939 CCACTAAGGGTGAAAGACCAAGG + Intronic
952896731 3:38082622-38082644 CCGCTAAGGGTGAAGGAGAAGGG + Intronic
952896782 3:38082804-38082826 CCGCTAAGGGTGAAGGACCAAGG + Intronic
953058211 3:39405189-39405211 CCACCAAGGCTGAAGCACCTGGG - Intergenic
953077395 3:39582764-39582786 CCTCTAAGGGTGAAGGACCAAGG + Intergenic
953157128 3:40385921-40385943 CAACTCTGGGTGAATGACCATGG + Intergenic
953176963 3:40561849-40561871 CTGCTAAGGGTGAAGGAGAAGGG - Intronic
953825917 3:46251028-46251050 CCACTAAGAGTGAAGGAGAAGGG + Intronic
953825947 3:46251153-46251175 CTGCTAAGGGTGAAGGACCAAGG + Intronic
954969465 3:54639185-54639207 CTGCTAAGGGTGAAGGAGAAGGG + Intronic
954969483 3:54639249-54639271 CCGCTAAGGGTGAAGGAGAAGGG + Intronic
954969501 3:54639313-54639335 CCGCTAAGGGTGAAGGACCAAGG + Intronic
955253163 3:57304697-57304719 CTGCTAAGGGTGAAGGACCAAGG - Intronic
956233681 3:67043298-67043320 CCACTAAGGGTGAAGGATCAAGG + Intergenic
956549159 3:70439485-70439507 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
956549170 3:70439549-70439571 CCGCTACGGGTGAAGGACCAAGG + Intergenic
956709006 3:72023966-72023988 CCGCTAAGGGTGAAGTACCAAGG - Intergenic
957060107 3:75474814-75474836 CTGCTAAGGGTGAAGGAGAAGGG + Intergenic
957060125 3:75474879-75474901 CCACTAAGGGTGAAGGACCAAGG + Intergenic
957294962 3:78324526-78324548 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
957317527 3:78587901-78587923 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
957317559 3:78588023-78588045 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
957905064 3:86543147-86543169 CCACTAAGGGTGAAGGATCAAGG + Intergenic
958182042 3:90072437-90072459 CCCCTAAGGGTGAAAGACCAAGG + Intergenic
958448754 3:94247156-94247178 GCACTTATGGTTAAGGACCAGGG - Intergenic
958750784 3:98191897-98191919 ACACTAAGGGTGAAGGATCAAGG - Intronic
959288573 3:104444776-104444798 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
959288601 3:104444899-104444921 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
959485969 3:106927403-106927425 CCACTAAGGGTGAAGGAGAAGGG + Intergenic
959485997 3:106927528-106927550 CCGCTAAGGATGAAGGACCAAGG + Intergenic
959972476 3:112422334-112422356 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
959972508 3:112422459-112422481 CCGTTAAGGGTGAAGGACCAAGG + Intergenic
960283070 3:115798137-115798159 CCACTAAGGGTGAAGGAGAAGGG + Intergenic
960283101 3:115798262-115798284 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
960310343 3:116110099-116110121 CTGCTAAGGGTGAAGGAGAAGGG + Intronic
960310402 3:116110346-116110368 CCGCTAAGGGTGAAGGACCAAGG + Intronic
961164986 3:124757303-124757325 CCACTAAGGGTGAAGGACCAAGG + Intergenic
961293260 3:125864527-125864549 CCACTAAGGGTGAAGGACAAAGG - Intergenic
961293278 3:125864592-125864614 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
961711805 3:128833807-128833829 CCACTAAGGGTGAAGGAGAAGGG + Intergenic
961711872 3:128834054-128834076 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
961730351 3:128960678-128960700 CCGCTAAGGGTGAAGGACCAAGG - Intronic
961730367 3:128960742-128960764 CCGCTGAGGGTGAAGGAGAAGGG - Intronic
961730386 3:128960806-128960828 CCGCTGAGGGTGAAGGAGAAGGG - Intronic
961730405 3:128960870-128960892 CCGCTAAGGGTGAAGGAGAAGGG - Intronic
961880777 3:130059979-130060001 CCACTAAGGGTGAAGGACCAAGG - Intergenic
961880809 3:130060104-130060126 CCACTAAGGGTGAAGGAGAAGGG - Intergenic
961880843 3:130060225-130060247 CCACTAAGGGTGAAGGAGAAGGG - Intergenic
961893922 3:130151885-130151907 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
962022352 3:131513708-131513730 CCACTAAGGGTGAAGGATCAAGG + Intergenic
962660432 3:137596483-137596505 CCGCTAAAGGTGAAGGACCAAGG - Intergenic
963058354 3:141205741-141205763 CTGCTAAGGGTGAAGGACCAAGG - Intergenic
963424991 3:145113907-145113929 CCACTAAGGGTGAAGGATCAAGG - Intergenic
963425025 3:145114032-145114054 TCGCTAAGGGTGAAGGAGAAGGG - Intergenic
963456885 3:145555936-145555958 CCACTAAGGGTGAAGGAGAAGGG + Intergenic
963456919 3:145556057-145556079 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
963468388 3:145711279-145711301 TTGCTAAGGATGAAGGACCAAGG - Intergenic
963468418 3:145711401-145711423 CCGCTGAGGGTGAAGGAGAAGGG - Intergenic
963663066 3:148152380-148152402 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
963663098 3:148152500-148152522 CCACTCAGGGTGAAGGAGAAAGG - Intergenic
963684068 3:148415116-148415138 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
963684098 3:148415241-148415263 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
964067576 3:152597854-152597876 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
964067603 3:152597971-152597993 CCACTAAGGGTGAAGGAGAAGGG - Intergenic
964125729 3:153231659-153231681 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
964300466 3:155279941-155279963 CCACTAAGGATGAAGGACCAAGG + Intergenic
964906737 3:161726674-161726696 CTGCTAAGGGTGAAGGAGAAGGG + Intergenic
964906771 3:161726795-161726817 CCACTAAGATTGAAGGAGAAGGG + Intergenic
964906807 3:161726915-161726937 CTGCTAAGGGTGAAAGACCAAGG + Intergenic
964983426 3:162713339-162713361 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
964983456 3:162713458-162713480 CAACTAAGGGTGAAGGAGAAGGG - Intergenic
965070090 3:163908369-163908391 CCACTAAGGGTGAAGGAGCAAGG - Intergenic
965105432 3:164346862-164346884 CCGCTAAGGATGAAGGAGAAGGG + Intergenic
965105460 3:164346987-164347009 CCACTAAGGGTGAAGGACCAAGG + Intergenic
965286921 3:166828718-166828740 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
965286952 3:166828843-166828865 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
965334871 3:167423278-167423300 CCACTAAGGGTAAAGGACCAAGG - Intergenic
965336112 3:167432119-167432141 CCACAAAGGGTGAAGGACAAAGG - Intergenic
965336125 3:167432183-167432205 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
965353455 3:167644805-167644827 TCACTGATGGTGAAGAACCAAGG - Intronic
965625097 3:170677286-170677308 CCACTAAGGGTGAAGGAGAAGGG + Intronic
965625132 3:170677407-170677429 CCGCTAAGGGTGAAGGACCAAGG + Intronic
965626526 3:170688111-170688133 CCACTAAGGGTGAAGGAGAAGGG + Intronic
965626559 3:170688230-170688252 CCACTAAGAGTGAAGGAGAAGGG + Intronic
965626589 3:170688351-170688373 CCGCTAAGAGTGAAAGACCAAGG + Intronic
965640267 3:170822791-170822813 CCACTAAGGGTGAAGGAGAAGGG + Intronic
965640300 3:170822912-170822934 CCGCTAAGGGTGAAGGACCAAGG + Intronic
965713142 3:171577208-171577230 CCGCTAAGGGTGAAGGAACAAGG - Intergenic
965713174 3:171577333-171577355 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
965713193 3:171577397-171577419 CCACTAAGGGTGAAAGAGAAGGG - Intergenic
965862189 3:173160672-173160694 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
966011949 3:175089240-175089262 CCATTAAGATTGAAGGACCCTGG + Intronic
966066556 3:175828367-175828389 CCACTAAGGGTGAAGGACCAAGG - Intergenic
966066590 3:175828488-175828510 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
966085202 3:176062181-176062203 CCATTAAGGGTGAAGGACCAAGG - Intergenic
966085230 3:176062306-176062328 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
966105274 3:176326270-176326292 CTGCTAAGGGTGAAGGAGAAGGG + Intergenic
966105292 3:176326334-176326356 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
966105322 3:176326458-176326480 CTGCTAAAGGTGAAGGACCAAGG + Intergenic
966233028 3:177670458-177670480 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
966278947 3:178208021-178208043 CCACTAAGGGTGAAGGACTAAGG - Intergenic
966278980 3:178208140-178208162 CCTCTAAGGGTGAAGGAGAAGGG - Intergenic
966279013 3:178208260-178208282 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
966279044 3:178208373-178208395 CCACTAAGGGTGAAGGGGAAGGG - Intergenic
966279080 3:178208492-178208514 CCTATAAGGGTGAAGGAGAAGGG - Intergenic
966397470 3:179517913-179517935 CCACTAAGGGTGAAGGACCAAGG - Intergenic
967151882 3:186658604-186658626 CCGCTAAGGGTGAAAGACCAAGG - Intergenic
967212409 3:187180369-187180391 CCGCTAAGGGCGAAGGACCAAGG + Intronic
967244376 3:187471028-187471050 CCACTAAAAGTGAAGGAGAAGGG + Intergenic
967244408 3:187471149-187471171 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
967495996 3:190145420-190145442 CCGCTAAGGGTGAAGGACTAAGG - Intergenic
967561163 3:190921042-190921064 ACGCTAAGGGTGAAGGACCAAGG - Intergenic
967561196 3:190921167-190921189 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
967624870 3:191671284-191671306 CCACTAAGAGTGAAGGAGAAGGG + Intergenic
967624889 3:191671348-191671370 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
967624920 3:191671473-191671495 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
967644036 3:191900126-191900148 CTGCTAAGGGTGAAGGAGAAGGG + Intergenic
967644070 3:191900247-191900269 CCGCTAAGGGTGAAAGACCAAGG + Intergenic
967658331 3:192075881-192075903 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
967658366 3:192076002-192076024 CCGCTAAGGGCAAAGGACCAAGG + Intergenic
967740242 3:192996489-192996511 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
967740275 3:192996614-192996636 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
968993160 4:3928269-3928291 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
969004029 4:4005040-4005062 CCACTAAGGGTGAAGGACCAAGG + Intergenic
969654347 4:8487681-8487703 CCACTAAGCGTGAAGGAGAAGGG + Intronic
969654377 4:8487806-8487828 CCACTAAGGGTGAAAGACCAAGG + Intronic
969748839 4:9095183-9095205 CTGCTAAGGGTGAAGGACCAAGG - Intergenic
969809907 4:9639826-9639848 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
970029426 4:11658421-11658443 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
970041876 4:11807177-11807199 CCACTAAGGGTGAATGACCAAGG - Intergenic
970041902 4:11807302-11807324 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
970087361 4:12364759-12364781 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
970256634 4:14175273-14175295 CCTCTAAGGGTGAAGAAGAAGGG + Intergenic
970532515 4:16998620-16998642 CCTCTAAGGGTGAAGGACCAAGG - Intergenic
970854287 4:20635113-20635135 CCGCTAAGGGTGAAAGACCAAGG + Intergenic
971123389 4:23726725-23726747 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
971123422 4:23726850-23726872 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
971123450 4:23726975-23726997 CCGCTAAGGGTAAAGGACCAAGG + Intergenic
971180326 4:24324148-24324170 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
971180358 4:24324274-24324296 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
971199885 4:24501858-24501880 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
971199965 4:24502167-24502189 CCATTAAGGGTGAAGGAGAAGGG - Intergenic
974003879 4:56536522-56536544 GCACTAAGGATGAAAGACAAAGG - Intronic
974428607 4:61769024-61769046 CCGCTAAGGGTGAAGGAGAAGGG + Intronic
974428625 4:61769088-61769110 CCGCTAAGGGTGAAGGACCAAGG + Intronic
974903601 4:68031739-68031761 CCACTAAGGGTGAAGGATCAAGG - Intergenic
975865355 4:78718828-78718850 CTGCTAAGGGTGAAGGACCAAGG + Intergenic
975934113 4:79558754-79558776 CTGCTAAGGGTGAAGGAGAAGGG + Intergenic
975934131 4:79558816-79558838 CCACTAAGGGTGAAGGACCAAGG + Intergenic
976558384 4:86475658-86475680 CCGTTAAGGGTGAAGGACCAAGG - Intronic
976696288 4:87922672-87922694 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
976696321 4:87922797-87922819 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
976884814 4:89969624-89969646 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
977009994 4:91624509-91624531 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
977010052 4:91624804-91624826 CCGCTAAGGACGAAGGACCAAGG - Intergenic
977010092 4:91624990-91625012 CCGCTAAGGGTGAAAGAGAAGGG - Intergenic
977013175 4:91659549-91659571 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
977013201 4:91659674-91659696 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
977041763 4:92026673-92026695 CCAATAAGGGTGAAGGACCAAGG - Intergenic
977041829 4:92026920-92026942 CCGCTAAGGATGAAGGAGAAGGG - Intergenic
977041847 4:92026984-92027006 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
977062804 4:92276629-92276651 CCGCTAAGGGTGCAGGAGAAGGG + Intergenic
977062834 4:92276754-92276776 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
977075402 4:92443636-92443658 CCGCTAAGAGTGAAGGAGAAGGG + Intronic
977075431 4:92443759-92443781 CCGCTAAGGGTGAAGGACCAAGG + Intronic
977198631 4:94089317-94089339 CCACTAAGGGTGAAGGAGAAGGG + Intergenic
977198647 4:94089381-94089403 CTGCTAAGGGTGAAGGACCAAGG + Intergenic
977217317 4:94297758-94297780 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
977217333 4:94297822-94297844 CCGCTAAGCGTGAAGGAGAAGGG + Intergenic
977217352 4:94297886-94297908 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
977217386 4:94298011-94298033 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
977225600 4:94388412-94388434 TAGCTAAGAGTGAAGGACCAAGG + Intergenic
977446613 4:97139198-97139220 CCACTAAGGGTGAAGGATCAAGG + Intergenic
977782689 4:100996622-100996644 CAGCTAAGGGTGAAGGATCAAGG + Intergenic
978001322 4:103558463-103558485 TCACTAAGGGTGAAGGAGAAGGG + Intergenic
978001354 4:103558588-103558610 CCACTAAGGGTGAAGGACCAAGG + Intergenic
978031275 4:103942154-103942176 CCACTAAGGGTGAAGGACCAAGG - Intergenic
978461078 4:108952988-108953010 CCATTAAGGGTGCATGCCCAAGG - Intronic
979054844 4:115980428-115980450 CTGCTAAGGGTGAAGGACCAAGG + Intergenic
979146383 4:117252940-117252962 CCACTAAGGGTGAAGGACCAAGG - Intergenic
979379640 4:119994544-119994566 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
979379681 4:119994729-119994751 CCACTAAGAGTGAAGGAGAAGGG - Intergenic
979850564 4:125566564-125566586 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
979895362 4:126149829-126149851 CCACTAAGGGTGAAGGAGAAGGG + Intergenic
979895380 4:126149893-126149915 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
980003553 4:127516181-127516203 CTCCTAAGGGTGAAGGAGAAGGG + Intergenic
980003583 4:127516299-127516321 CCGCTAAGGATGAAGCACCAAGG + Intergenic
980112152 4:128645626-128645648 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
980112181 4:128645744-128645766 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
980284729 4:130768244-130768266 CTGCTAAGGTTGAAGAACCAAGG - Intergenic
980284754 4:130768369-130768391 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
980388674 4:132119013-132119035 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
980388703 4:132119132-132119154 CCGCTCAGGGTGAAGGAGAAGGG - Intergenic
980491531 4:133533750-133533772 CCACTAAGGGTGAAGGATCAAGG + Intergenic
980527650 4:134013053-134013075 CTGCTAAGGGTGAAGGACCAAGG - Intergenic
980527677 4:134013178-134013200 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
980575837 4:134682582-134682604 TCACTAAGGGTGAAGGAGAAGGG + Intergenic
980575872 4:134682703-134682725 CCACTAAGGGTGAAGGACCAAGG + Intergenic
980611964 4:135171984-135172006 CAGCTAAGGGTGAAGGAGAAGGG + Intergenic
980611982 4:135172048-135172070 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
980612026 4:135172234-135172256 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
980903669 4:138928658-138928680 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
980903705 4:138928780-138928802 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
981040036 4:140214522-140214544 CCGCTAAGGGCGAAGGACCAAGG - Intergenic
981040068 4:140214647-140214669 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
981524894 4:145699704-145699726 CCACTAAGGGTGAAGGACCAAGG - Intronic
981524939 4:145699890-145699912 CCGCTAAGGGTGAAGGAGAAGGG - Intronic
981539452 4:145833442-145833464 CCACTAAGGGTGAAGGACTAAGG - Intronic
981539482 4:145833567-145833589 CCGCTAAGGGTGAAGGAGAAGGG - Intronic
982064324 4:151639822-151639844 CCACTAAGGAAGGAGGAGCAGGG - Intronic
982084152 4:151817255-151817277 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
982084185 4:151817376-151817398 CCACTAAGGGTGAAGGACCAAGG + Intergenic
982180668 4:152746001-152746023 CTGCTAAGGGTGAAGGAGAAGGG + Intronic
982180687 4:152746065-152746087 CCACTGAGGGTGAAGGAGAAGGG + Intronic
982180704 4:152746129-152746151 CCACTGAGGGTGAAGGAGAAGGG + Intronic
982180736 4:152746254-152746276 CCGCTAAGGGTGAAGGACCAAGG + Intronic
982396958 4:154923700-154923722 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
982414435 4:155113332-155113354 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
982497343 4:156108331-156108353 CCGCTAAGAGTGAAGGAGAAGGG + Intergenic
982497375 4:156108452-156108474 CCGCTAAGGGTGAAGGACAAAGG + Intergenic
982535179 4:156601064-156601086 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
982535212 4:156601189-156601211 CCGCTAAGGGTGAAAGAGAAGGG - Intergenic
982535229 4:156601253-156601275 CCGCTAAGGGTGAAAGAGAAGGG - Intergenic
983023634 4:162710017-162710039 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
983055258 4:163094035-163094057 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
983055294 4:163094179-163094201 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
983055312 4:163094243-163094265 CCACTAAGGGTGAAGGAGAAGGG - Intergenic
983345362 4:166521531-166521553 CTGCTAAGGGTGAAGGACCAAGG - Intergenic
983360142 4:166717003-166717025 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
983360172 4:166717128-166717150 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
983414914 4:167440512-167440534 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
983414945 4:167440639-167440661 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
983447831 4:167877143-167877165 ATGCTAAGGGTGAAGGACCACGG - Intergenic
983447846 4:167877205-167877227 CCACTAAGGGTGAAGGAGAAGGG - Intergenic
983452092 4:167923737-167923759 CCACTAAGGGTGAAGGACCAAGG - Intergenic
983659345 4:170117271-170117293 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
983707476 4:170678478-170678500 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
983707493 4:170678542-170678564 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
983884072 4:172961445-172961467 CTGCTAAGGGTGAAGGACCAAGG + Intronic
983915569 4:173287725-173287747 CCAGCAAGGGTGAAGGGCCAAGG - Intronic
984099237 4:175466085-175466107 CTGCTAAGGGTGAAGGAGAAGGG + Intergenic
984099272 4:175466227-175466249 CTGCTAAGGGTGAAGGACCAAGG + Intergenic
984165558 4:176299545-176299567 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
984321939 4:178207965-178207987 CTGCTAAGGGTGAAGGACCAAGG - Intergenic
984393803 4:179169540-179169562 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
984393835 4:179169665-179169687 CCACTAAGGGTGAAGGACCAAGG + Intergenic
984418304 4:179488087-179488109 ACACGAAGGGTGTAGGATCATGG - Intergenic
984437036 4:179721367-179721389 CTGCTAAGGGTGAAGGACGAAGG - Intergenic
984700451 4:182815482-182815504 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
985079195 4:186246762-186246784 CCACTAAGGGTGAAGGATCAAGG + Intronic
985390105 4:189484326-189484348 CCACTAAGGGTGAAGGAGAAGGG + Intergenic
985390149 4:189484512-189484534 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
985435498 4:189926726-189926748 CCACTAAGGGTGAAAGACCAAGG - Intergenic
985435532 4:189926851-189926873 CCATTAAGGGTGAAGGAGAAGGG - Intergenic
985582029 5:703332-703354 CTGCTAAGGGTGAAGGACCAAGG - Intergenic
985582070 5:703518-703540 CCGCTGAGGGTGAAGGAGAAGGG - Intergenic
985582133 5:703765-703787 CCGCTGAGGGTGAAGGAGAAGGG - Intergenic
985582152 5:703829-703851 CCGCTAAGCGTGAAGGAGAAGGG - Intergenic
985666739 5:1184887-1184909 CCACTCAGGGTGGAGGCCAAGGG - Intergenic
985779839 5:1864730-1864752 CTCCTAAGGGTGATGGACCAGGG - Intergenic
985780955 5:1871575-1871597 ACACCACGGGTGAAGGCCCAGGG - Intergenic
986064627 5:4223461-4223483 CAACAAAGGGTGAAGCACTAAGG - Intergenic
986193295 5:5516405-5516427 CTGCTAAGGGTGAAGGACCAAGG - Intergenic
986193325 5:5516530-5516552 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
986193342 5:5516594-5516616 CCACTAAGCGTGAAGGAGAAGGG - Intergenic
986388643 5:7264450-7264472 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
986388673 5:7264575-7264597 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
986555780 5:9008693-9008715 CTGCTAAGGGTGAAGGAGGAGGG + Intergenic
986555814 5:9008818-9008840 CCACTAAGGGTGAAAGACCAAGG + Intergenic
986555905 5:9009390-9009412 CCACTAAGGATGAAGGAGAAGGG + Intergenic
986555939 5:9009515-9009537 CCACTAAGGGTGAAGGAGAAGGG + Intergenic
986905546 5:12490747-12490769 CCGCTGAGGGTGAAGGACCAAGG - Intergenic
986905563 5:12490811-12490833 CCGCTGAGGGTGAAGGAGAAGGG - Intergenic
986919806 5:12667319-12667341 CCGCTAAGAGTGAAGGAGAAGGG + Intergenic
986919840 5:12667444-12667466 CCACTAAGGGCGAAGGACCAAGG + Intergenic
987281790 5:16420807-16420829 CTGCTAAGGGTGAAGGACCAAGG - Intergenic
987281822 5:16420932-16420954 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
987498370 5:18673698-18673720 CTGCTAAGGGTGAAGGACCAAGG + Intergenic
987755549 5:22095491-22095513 CCGCTAAGGGTGAAGGACCAAGG - Intronic
987755573 5:22095610-22095632 CCACTAAGGGTGAAGGAGAAGGG - Intronic
989619665 5:43371950-43371972 CCACTAATGGTGGAGGGCAAAGG + Intergenic
990621728 5:57567258-57567280 TCACTGAGGGTGAAAGAGCATGG + Intergenic
992394407 5:76358123-76358145 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
992394434 5:76358248-76358270 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
992452459 5:76886138-76886160 CCGCTAAGGGTGAAGGACCAAGG + Intronic
992960582 5:81954064-81954086 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
992960615 5:81954185-81954207 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
993152920 5:84183721-84183743 CCTGTAAGTGTGAAGGAGCATGG - Intronic
993192420 5:84699090-84699112 CCACTAAGGGTGAAGGACCAAGG - Intergenic
993192482 5:84699358-84699380 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
993192500 5:84699422-84699444 CCACTAAGGGTGAAGGAGAAGGG - Intergenic
993192517 5:84699486-84699508 CCACTAAGGGTGAAAGAGAAGGG - Intergenic
993589620 5:89778238-89778260 CCACTAGGGGCTCAGGACCAAGG - Intergenic
993836414 5:92824606-92824628 CTGCTAAGGGTGAAGGACCAAGG - Intergenic
993836447 5:92824731-92824753 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
993836475 5:92824856-92824878 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
993985231 5:94589284-94589306 CCACTAATGGTGTGGGTCCATGG + Intronic
994009384 5:94882766-94882788 GCACTAGAGGTGAAGGACTATGG - Intronic
994294964 5:98080141-98080163 CCGCTAAAGGTGAAGGAGAAGGG - Intergenic
994376015 5:99016080-99016102 CTGCTAAAGGTGAAAGACCAAGG + Intergenic
994514287 5:100751246-100751268 CCACTGAGGATCAAGGATCAGGG - Intergenic
994532744 5:100988968-100988990 CCGCAAAGGGTGAAGGAGAAGGG + Intergenic
994532808 5:100989215-100989237 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
994532843 5:100989340-100989362 CCACTAAGGGTGAAGGACCAAGG + Intergenic
994556717 5:101315860-101315882 CCGCTAAGGGCAAAGGACTAAGG - Intergenic
994775460 5:104032540-104032562 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
994775493 5:104032661-104032683 CCGCTAAAGGTGAAGGAGAAGGG - Intergenic
994779248 5:104069398-104069420 CCACTAAGGGTGAAGGAGAAGGG + Intergenic
994779264 5:104069462-104069484 CCACTAACGGTGAAGGAGAAGGG + Intergenic
994779294 5:104069587-104069609 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
995284201 5:110368423-110368445 CCACGAGGGGTGAAGAACAATGG - Intronic
995899615 5:117051260-117051282 CCACTAAGAGTGAAGGAGAAGGG + Intergenic
996203482 5:120702392-120702414 CCGCTAAGAGTGAAGGAGAAGGG + Intergenic
996203513 5:120702517-120702539 CTGTTAAGGGTGAAGGACCAAGG + Intergenic
996345018 5:122478279-122478301 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
996358801 5:122623467-122623489 CCACTAAGGGTGAAGGACCAAGG + Intergenic
996509668 5:124304604-124304626 CCTCTAAGGGTGAAGGACCAAGG - Intergenic
996527818 5:124497877-124497899 CCACTAAGGGTGAAGGACCAAGG - Intergenic
996527848 5:124498002-124498024 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
996575201 5:124971258-124971280 CTGCTAAGGGTGAAGGACCAAGG + Intergenic
996745741 5:126844680-126844702 CCACTAAGGGTGAAGGAGAAGGG + Intergenic
996745771 5:126844805-126844827 CCGCTAAGGGTGAAGGACAAAGG + Intergenic
997049949 5:130368135-130368157 CCAATTAGGGTGAAGCACAAAGG + Intergenic
997679090 5:135736637-135736659 CTGCTATGGGTGAAGGACCAAGG + Intergenic
997746180 5:136302261-136302283 CCGCTAAGGGTGAAGGACCAAGG - Intronic
997769886 5:136544383-136544405 CCACTAAGGGTGAAGGAGAAGGG + Intergenic
997769904 5:136544447-136544469 CTGCTAAGGGTGAAGGAGAAGGG + Intergenic
997769920 5:136544511-136544533 CTGCTAAGGGTGAAGGACCAAGG + Intergenic
997772885 5:136570228-136570250 CCACTAAGGGTGAAGGAGAAGGG + Intergenic
997772914 5:136570353-136570375 CCACTAAGGGTGAAGGACCAAGG + Intergenic
997788736 5:136737863-136737885 CCACTAAGAGTGAAGGACCATGG - Intergenic
998996589 5:147873559-147873581 CCGCTAAGGGTGAAGGAGAAGGG + Intronic
998996607 5:147873623-147873645 CCGCTAAGGGTGAAGGACCAAGG + Intronic
999619069 5:153454402-153454424 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
999619100 5:153454523-153454545 CCGCTAAGTGTGAAGGACTAAGG + Intergenic
1000438344 5:161240809-161240831 CTCCTAAGGGTGAAGGACCAAGG - Intergenic
1000477437 5:161728559-161728581 TCACTAAGGGAGAATGAGCAAGG + Intergenic
1000519664 5:162280295-162280317 CCACTAAGGGTGAAGGACCAAGG + Intergenic
1000552101 5:162679730-162679752 TCACCAGGGGTGAAGGACAAAGG - Intergenic
1000885534 5:166743800-166743822 CTGCTAAGGGGGAAGGACCAAGG + Intergenic
1000935870 5:167302694-167302716 CCACTAAGGGTGAAGGAGAAGGG + Intronic
1000935901 5:167302815-167302837 CCGCTAAGGGTGAAGGACCAAGG + Intronic
1001331697 5:170766893-170766915 CCACTAAGAGTGAAGGAGAAGGG + Intronic
1001331732 5:170767011-170767033 CCGCTAAGGGTGAAGGACCAAGG + Intronic
1002611171 5:180419435-180419457 CCGCTAAGGGCGAAGGAGAAGGG + Intergenic
1002611221 5:180419621-180419643 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
1003430366 6:6032490-6032512 CCACTAAGGGTGAAGGAGAAGGG + Intergenic
1003430384 6:6032554-6032576 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1003430403 6:6032618-6032640 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1003477372 6:6496244-6496266 CCACTAAGGGAAAACCACCATGG + Intergenic
1004105961 6:12668013-12668035 CCGCTAAGGATGAAGGACCAAGG - Intergenic
1004283771 6:14301815-14301837 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1004283802 6:14301940-14301962 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
1004508240 6:16263916-16263938 CCGCTAAGTGTGAAGGAGAAGGG + Intronic
1004508271 6:16264037-16264059 CCGCTAAGGGTGAAGGACCAAGG + Intronic
1004574986 6:16886811-16886833 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
1004575017 6:16886932-16886954 CCGCTCAGGGTGAAGGAGAAGGG - Intergenic
1004612590 6:17258277-17258299 CCATTAAGTGTGAAAGACAAAGG + Intergenic
1004768810 6:18758914-18758936 CCACTAAGAGTGAAGGAGAAGGG + Intergenic
1004768844 6:18759035-18759057 CTGCTAAGGGTGAAGGACCAAGG + Intergenic
1004836793 6:19539869-19539891 CCGCTAAGGGTAAAGGACCAAGG - Intergenic
1005014881 6:21366248-21366270 CCTCTAAGGGTGAAGGAGAAGGG + Intergenic
1005014913 6:21366373-21366395 CCGCTAAGGGTGAAGTACCAAGG + Intergenic
1006579815 6:35070415-35070437 CCTCTAAGGGTGAATCACCTAGG + Intronic
1007117953 6:39356992-39357014 CCACTCAGGAGGCAGGACCAGGG + Intronic
1008476302 6:51939109-51939131 CTGCTAAGGGTGAAGGACCAAGG - Intronic
1008476337 6:51939230-51939252 CCACTAAGGGTGAAGGAGAAGGG - Intronic
1008588496 6:52970327-52970349 CCACTGAGAGTGAAGGCCCAAGG - Intergenic
1008773626 6:55009035-55009057 CCGCTAGGGGTTCAGGACCAGGG + Intergenic
1008850402 6:56015454-56015476 CCACTAGGGGTGAAGGAGAAGGG + Intergenic
1008850434 6:56015573-56015595 CCACTAAGGGTGAAGGAGAAGGG + Intergenic
1008850465 6:56015694-56015716 CCACTAAGGGTGAAGGAGAAGGG + Intergenic
1008850496 6:56015813-56015835 CTGCTAAGGGTGAAGGAGAAGGG + Intergenic
1009343375 6:62586813-62586835 CCGCTAAGGGTGAAGAACCAAGG - Intergenic
1009359143 6:62792455-62792477 TTGCTAAGGGTGAAGGACCAAGG - Intergenic
1009359174 6:62792574-62792596 CCACTAAGGGTGAAGGAGAAGGG - Intergenic
1009464171 6:63951022-63951044 ACACTAAGGGTGAAGGATCAAGG - Intronic
1009750489 6:67873554-67873576 CCACTAAGGGTGAAGGATCAAGG + Intergenic
1010071915 6:71753209-71753231 CCACTAAGGGTGAAGGACCAAGG + Intergenic
1010586917 6:77665307-77665329 CCACTAAGGGTGAAAGATAAGGG + Intergenic
1010586936 6:77665371-77665393 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1010586955 6:77665435-77665457 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1010586986 6:77665560-77665582 CTGCTAAGGGTGAAGGACCAAGG + Intergenic
1010827120 6:80487128-80487150 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1010827152 6:80487254-80487276 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
1010841507 6:80652472-80652494 CCACTAAGGGTCAAGGACCAAGG + Intergenic
1010894812 6:81350160-81350182 CCGCTAAGGGTGAAGGAGAGGGG + Intergenic
1010894840 6:81350285-81350307 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
1011351273 6:86426439-86426461 CCCCTAAGGGGGAAGGGACATGG - Intergenic
1011368090 6:86602981-86603003 CCACTAAGGGTGAAGTAGAAGGG + Intergenic
1011368105 6:86603040-86603062 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
1011771144 6:90674884-90674906 TCACTAAGGGTGAAGGAGAAGGG + Intergenic
1012014611 6:93834857-93834879 CCACTAAGGGTGAAGGACCAAGG + Intergenic
1012066759 6:94558681-94558703 CGGCTAAGGGTGAAGGACCAAGG + Intergenic
1012315563 6:97780380-97780402 CCACTAAGGGTGAAGGACCAAGG - Intergenic
1012315594 6:97780505-97780527 CCGCTAAGAGTGAAGGAGAAGGG - Intergenic
1012318857 6:97816948-97816970 CCACGAAGGGGCAAGGACCGAGG - Intergenic
1012674900 6:102102954-102102976 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
1012689295 6:102293593-102293615 CTGCTAAGGGTAAAGGACAAAGG - Intergenic
1012689310 6:102293657-102293679 ACACTAAGGGTGAAGGAGAAGGG - Intergenic
1012689328 6:102293721-102293743 CCACTAAGGGTGAAGGAGAAGGG - Intergenic
1012689345 6:102293785-102293807 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
1013408111 6:109860592-109860614 CCGCTAAGAGTGAAGGAGAAGGG + Intergenic
1013408147 6:109860713-109860735 CCGCGAAGGGTGAAGGACCAAGG + Intergenic
1013843956 6:114427356-114427378 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1013891435 6:115032663-115032685 CTGCTGAGGGTGAAGGACCAAGG - Intergenic
1013891485 6:115032853-115032875 CCACTAAGGGTGAAAGAGAAGGG - Intergenic
1014360395 6:120467114-120467136 CTGCTAAGGGTGAAGGAGAAGGG + Intergenic
1014360424 6:120467239-120467261 CTACTAAGGGTGAAGGACCAAGG + Intergenic
1014395757 6:120925668-120925690 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
1014455081 6:121625156-121625178 CCGCTAAGGGTGAAAGAGAAGGG + Intergenic
1014455100 6:121625220-121625242 CCACTAAGGGTGAAGGAGAAGGG + Intergenic
1014455116 6:121625284-121625306 CCACTAAGGGTGAAGGAGAAGGG + Intergenic
1014455146 6:121625409-121625431 CTGCTAAGCGTGAAGGACCAAGG + Intergenic
1014555589 6:122840627-122840649 CTGCTAAGGGTGAAGGACCAAGG - Intergenic
1014555633 6:122840813-122840835 CCGCTAAGAGTGAAGGAGAAGGG - Intergenic
1014614912 6:123587162-123587184 CCACTAAGGATGAAGGACCAAGG + Intronic
1014718367 6:124891271-124891293 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
1014718399 6:124891396-124891418 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
1014718418 6:124891460-124891482 CCACTAAGTGTGAAGGAGAAGGG - Intergenic
1014794209 6:125706621-125706643 CCACTAAGAGTGAAGGAGAAGGG + Intergenic
1014794271 6:125706870-125706892 CCGATAAGGGTGAAGGACCAAGG + Intergenic
1014891325 6:126849707-126849729 CCACTAAGGGTGAAGGACCAAGG - Intergenic
1014891344 6:126849770-126849792 CCACTAAGGGTGAAGGAGAAGGG - Intergenic
1015164965 6:130193143-130193165 CTGCTAAAGGTGAAGGACCAAGG - Intronic
1015266477 6:131296228-131296250 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
1015266536 6:131296474-131296496 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
1015269406 6:131324179-131324201 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
1015269436 6:131324304-131324326 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
1015271112 6:131339683-131339705 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
1015271163 6:131339871-131339893 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
1015271181 6:131339935-131339957 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
1015277931 6:131403790-131403812 CCACTAAGGGTGAAGGACCAAGG - Intergenic
1015277966 6:131403914-131403936 CCACTAGGGGTGAAGGAGAAGGG - Intergenic
1015323563 6:131902425-131902447 CCGCTACGGGTGAAGGACCAAGG - Intergenic
1015323615 6:131902612-131902634 CCACTAAGGGTGAAGGAGAAGGG - Intergenic
1015801635 6:137066254-137066276 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
1016114374 6:140262215-140262237 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
1016204302 6:141453654-141453676 CTGCTAAGGGTGAAGGACAAAGG - Intergenic
1016204330 6:141453780-141453802 CCACTAAGGGTGAAGGAGAAGGG - Intergenic
1016248585 6:142016539-142016561 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
1016248615 6:142016664-142016686 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
1016518565 6:144924039-144924061 CCGCCAAGGGTGAAGGACCAAGG - Intergenic
1016518598 6:144924164-144924186 CCACTAAGGCTGAAGGAGAAGGG - Intergenic
1016518631 6:144924289-144924311 CCACTAACGGTGAAGGAGAAGGG - Intergenic
1016535957 6:145107894-145107916 CCACTAAGGGTGAAGGAGAAGGG + Intergenic
1016535988 6:145108015-145108037 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
1016650497 6:146455150-146455172 CTGCTAAGGGTGAAGGAGAAGGG + Intergenic
1016650578 6:146455458-146455480 TCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1016650607 6:146455583-146455605 CCGCTAAGGGTGAAGGTCCAAGG + Intergenic
1016751017 6:147630994-147631016 CCACTAAGGGTGAAGGATCAAGG - Intronic
1016853020 6:148640601-148640623 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
1017779534 6:157705390-157705412 CTGCTAAGGGTGAAGGAGAAGGG + Intronic
1017779565 6:157705511-157705533 CCACTAAGAGTGAAGGAGAAGGG + Intronic
1017779597 6:157705632-157705654 CCACTAAGGGTGAAGGACCAAGG + Intronic
1018084719 6:160291336-160291358 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1018084753 6:160291457-160291479 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
1018495679 6:164343796-164343818 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1018495709 6:164343916-164343938 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
1018521699 6:164656957-164656979 CCACTAAGGATGAAGGAGAAGGG + Intergenic
1018521732 6:164657078-164657100 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1018521765 6:164657199-164657221 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
1020315796 7:6904616-6904638 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
1020315827 7:6904741-6904763 CCACTAAGGGTGAAGGAGAAGGG - Intergenic
1020324154 7:6961457-6961479 CTGCTAAGGGTGAAGGACCAAGG + Intergenic
1020532947 7:9358249-9358271 CCGCTAAGAGTGAAGGAGAAGGG + Intergenic
1020532961 7:9358313-9358335 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
1020541350 7:9463310-9463332 CTGCTAAGGGTGAAGGACCAAGG + Intergenic
1021172488 7:17414917-17414939 CCACTAAAGGTGAAGGATCAAGG - Intergenic
1021393412 7:20121598-20121620 CTGCTAAGGGTGAAGGACCAAGG - Intergenic
1021637088 7:22704216-22704238 CTGCTAAGGGTGAAGGACCAAGG - Intergenic
1021637104 7:22704276-22704298 CCACTCAGGGTGAAGGAGAAGGG - Intergenic
1021652266 7:22843836-22843858 CCAAGAAGGGTGAAGGGCAAAGG - Intergenic
1021810420 7:24397129-24397151 CCGCTAATGGTGAAGGACCAAGG - Intergenic
1021810451 7:24397254-24397276 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
1021978056 7:26028729-26028751 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1021978075 7:26028793-26028815 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1021978107 7:26028918-26028940 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
1022068241 7:26883368-26883390 CCACTAAGTGTTAAGGTCAAGGG + Intronic
1022372655 7:29785822-29785844 CTGCTAAGGGTGAAGGACCAAGG - Intergenic
1022372686 7:29785947-29785969 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
1022710219 7:32842460-32842482 CCACTAAGGGTGAAGGAGAAGGG + Intergenic
1022710268 7:32842646-32842668 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
1022854914 7:34304547-34304569 CCACTAAGGGTGAAGGAGAAGGG + Intergenic
1022854947 7:34304679-34304701 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
1023699101 7:42875341-42875363 CCGCTAAGGCTGAAGGAGAAGGG + Intergenic
1023699117 7:42875405-42875427 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1023699135 7:42875469-42875491 CCACTAAGGGTGAAGGACCAAGG + Intergenic
1024697349 7:51870763-51870785 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
1024697367 7:51870827-51870849 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
1024697386 7:51870891-51870913 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
1024697405 7:51870955-51870977 CCACTAAGGGTGAAGGAGAAGGG - Intergenic
1024697423 7:51871019-51871041 CCACTAAGGGTGAAGGAGAAGGG - Intergenic
1025639144 7:63350841-63350863 GAACTGAGGGTGAAGGAACAAGG - Intergenic
1025643555 7:63397251-63397273 GAACTGAGGGTGAAGGAACAAGG + Intergenic
1027851707 7:83460535-83460557 CCGCTAAAGGTGAAGGACCAAGG - Intronic
1028689945 7:93640776-93640798 CTGCTAAGGGTGAAGGACCGAGG - Intronic
1028689977 7:93640897-93640919 CTGCTAAGGGTGAAGGAGAAGGG - Intronic
1029500000 7:100923100-100923122 CCACTAAGGGTGAAGGACCAAGG - Intergenic
1030441889 7:109596733-109596755 CCGCTAAGGGTGAAGGACCCAGG + Intergenic
1030445959 7:109646709-109646731 CCACTAAGGGTGAAGGATCAAGG + Intergenic
1030751676 7:113238135-113238157 CCACTAAGGGTGAAGGAGAAGGG + Intergenic
1030751695 7:113238199-113238221 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1030751745 7:113238385-113238407 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
1031004454 7:116456495-116456517 CCGCTAAGGGTGGAGGACCAAGG - Intronic
1031004473 7:116456559-116456581 CCGCTAAGGGTGAAGGAGAAGGG - Intronic
1031355421 7:120781914-120781936 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1031355450 7:120782033-120782055 CCACTAAGGGTGAAGGACCAAGG + Intergenic
1031364953 7:120890407-120890429 CCACTAAGGGTGAAAGAGAAGGG + Intergenic
1031364986 7:120890528-120890550 CTGCTAAGGGTGAAAGACCAAGG + Intergenic
1031399693 7:121316250-121316272 CCGCTAAGGGTGAAGGACTGAGG - Intergenic
1031399817 7:121316724-121316746 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
1031422683 7:121568815-121568837 CTGCTAAGGGTGAAGGACCAAGG + Intergenic
1031525310 7:122817601-122817623 CCACTAAGGGTGAAGGACCAAGG - Intronic
1031525339 7:122817726-122817748 CCGCTAAGAGTGAAGGAGAAGGG - Intronic
1031728136 7:125263611-125263633 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1031728165 7:125263736-125263758 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
1031776088 7:125910833-125910855 CCACTAAGGGTGAAGGACCAAGG - Intergenic
1031776106 7:125910895-125910917 CCACTAAGAGTGAAGGAGAAGGG - Intergenic
1031777089 7:125918403-125918425 CCACTAAGGGTGAAGGAGCAAGG - Intergenic
1031777118 7:125918528-125918550 CTGCTAAGGGTGAAGGGGCAGGG - Intergenic
1033211311 7:139462272-139462294 CTGCTAAGGGTGAAGGACCAAGG - Intronic
1033465269 7:141583588-141583610 CCACTAAGGGTGAAGGATCTAGG + Intronic
1033676167 7:143541939-143541961 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1033676201 7:143542064-143542086 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
1033695632 7:143787375-143787397 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
1033695666 7:143787500-143787522 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
1033909698 7:146248247-146248269 CCGCTCAGGGTGAAGGAGAAGGG + Intronic
1033909729 7:146248360-146248382 CCGCTAAGGGTGAAGGACCAAGG + Intronic
1034085037 7:148314751-148314773 CCACTAAGGGTGAAGGACCAAGG + Intronic
1036071122 8:5441324-5441346 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1036071155 8:5441443-5441465 CCACTAAGGGTGAAGGACCAAGG + Intergenic
1036280395 8:7395446-7395468 CCACCAAGGCTTAGGGACCATGG + Intergenic
1036281225 8:7403161-7403183 CCGCTAAGGGTGAATGACCAAGG - Intergenic
1036281251 8:7403286-7403308 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
1036340215 8:7908286-7908308 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1036340241 8:7908411-7908433 CCGCTAAGGGTGAATGACCAAGG + Intergenic
1036371910 8:8169508-8169530 CTGCTAAGGGTGAAGGAACAAGG - Intergenic
1036371925 8:8169572-8169594 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
1036472561 8:9064215-9064237 CCGCTAAGGGTGAAGGAGAAGGG + Intronic
1036472596 8:9064338-9064360 CCGCTAAGGGTGAGGGACAAAGG + Intronic
1036639214 8:10571945-10571967 CTGCTAAGGGTGAAGGACCAAGG - Intergenic
1036878979 8:12496071-12496093 CTGCTAAGGGTGAAGGAGAAGGG + Intergenic
1036878994 8:12496135-12496157 CTGCTAAGGGTGAAGGAACAAGG + Intergenic
1040476061 8:47778697-47778719 CCACTAAGGGTGAGGGCAGAAGG + Intronic
1040647839 8:49420588-49420610 CCACTAAGCATGAAGGATCAAGG - Intergenic
1041652029 8:60311116-60311138 CTACTAAGGGTGAAGGATCAAGG + Intergenic
1042453279 8:68973851-68973873 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
1042453308 8:68973976-68973998 CCACTAAGGGTGAAGGAGAAGGG - Intergenic
1042705896 8:71665469-71665491 GCCCCAAGGGTGAAGGATCAAGG - Intergenic
1042707143 8:71675809-71675831 CCACTAAGGGTGAAGGACCAAGG - Intergenic
1043353878 8:79390800-79390822 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
1043718123 8:83509956-83509978 CTGCTAAGGGTGAAGGAGAAGGG + Intergenic
1043718158 8:83510077-83510099 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
1043837461 8:85063672-85063694 CTGCTAAGGGCAAAGGACCAAGG - Intergenic
1043837507 8:85063861-85063883 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
1044148728 8:88746969-88746991 CCACTAAGGGTGAAGGACCAAGG + Intergenic
1044258838 8:90094982-90095004 CTGCTAAGGGTGAAGGACCAAGG + Intronic
1044416832 8:91948852-91948874 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
1044416850 8:91948916-91948938 CCGCTAAGGGTAAAGGAGAAGGG - Intergenic
1044416887 8:91949041-91949063 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
1044921714 8:97175884-97175906 CCGCTAAGGGTGGAGGACCAAGG - Intergenic
1044921749 8:97176009-97176031 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
1044921783 8:97176133-97176155 CCACTAAAGGTGAAGGAGAAGGG - Intergenic
1044924883 8:97201642-97201664 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
1044924930 8:97201830-97201852 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
1044924947 8:97201894-97201916 CCACTAAGGGTGAAAGAGAAGGG - Intergenic
1045197231 8:99944545-99944567 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
1045644536 8:104286772-104286794 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
1045644584 8:104286959-104286981 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
1046293882 8:112196709-112196731 CTGCTAAGGGTGAAGGACCAAGG - Intergenic
1046293914 8:112196834-112196856 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
1046313757 8:112473760-112473782 ACTCCAAGGGTGAAGGAGCAGGG - Intronic
1046386579 8:113514359-113514381 CTGCTAAGGGTGAAGGAGAAGGG + Intergenic
1046386611 8:113514484-113514506 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
1046439819 8:114242476-114242498 CCGCTAAGGGTGAAGGACCATGG - Intergenic
1046442949 8:114282568-114282590 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
1046442982 8:114282693-114282715 CCGCTAAGGGTGAAGGCGAAGGG - Intergenic
1046442999 8:114282757-114282779 CCACTAAGGGTGAAGGAGAAGGG - Intergenic
1046511854 8:115213124-115213146 CCGCTAAGGGTGAAGGACAAAGG - Intergenic
1046511882 8:115213249-115213271 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
1046559036 8:115815485-115815507 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
1046559070 8:115815611-115815633 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
1047699106 8:127432577-127432599 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
1047699135 8:127432681-127432703 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
1047829734 8:128616599-128616621 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1047829765 8:128616724-128616746 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
1047856146 8:128915300-128915322 CTGCTAAGGGTGAAGGACCAAGG - Intergenic
1048097361 8:131310997-131311019 CCACTAAGGGTGAAAGACCAAGG - Intergenic
1048097391 8:131311118-131311140 CCGCTAAGAGTGAAGGAGAAGGG - Intergenic
1048168633 8:132084909-132084931 CCGCTAAGGGTGAAGGAGAAGGG + Intronic
1048168652 8:132084973-132084995 CCGCTAAGGGTGAAGGAGAAGGG + Intronic
1048168684 8:132085098-132085120 CCGCTAAGGGTGAAGGACCAAGG + Intronic
1048417304 8:134241871-134241893 ACACAATGGGTAAAGGACCAAGG - Intergenic
1048585629 8:135771881-135771903 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1048585691 8:135772127-135772149 CCACTAAGGGTGAAGGACCAAGG + Intergenic
1048728621 8:137413025-137413047 CCACTAAGGGTAAAGGACCAAGG + Intergenic
1048764444 8:137829586-137829608 CCACTAAGGGTGAAGGAGACAGG + Intergenic
1048764479 8:137829711-137829733 CCACTAAGGGTGAAGGACCAAGG + Intergenic
1048914924 8:139173393-139173415 CCAGTATGTGTGAAGTACCAAGG + Intergenic
1049869061 8:144959134-144959156 CCACTAAGGGTGAAGGACCAAGG + Intergenic
1049961793 9:744321-744343 CCTCTAAGGGTGAAGGCCTGAGG - Intronic
1050117378 9:2276534-2276556 GCACTAAGGGTGAAGGGACAAGG - Intergenic
1050473927 9:6020898-6020920 CCGCTAAAGGTGAAGGACCAAGG - Intergenic
1050895885 9:10885813-10885835 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
1051052399 9:12949258-12949280 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
1051052417 9:12949322-12949344 CCTCTAAGGGTGAAGAAGAAGGG - Intergenic
1051849496 9:21490415-21490437 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1051849540 9:21490603-21490625 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
1051953595 9:22663204-22663226 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
1052191583 9:25669756-25669778 CCACTAAGGGTGAAGGACCAAGG - Intergenic
1052191612 9:25669874-25669896 CCACTAAGGGTGAAGGAGAAGGG - Intergenic
1052653071 9:31327184-31327206 CTGCTAAGGGTGAAGGACCAAGG - Intergenic
1052653099 9:31327304-31327326 GCTCTAAGGGTGAAGGAGAAGGG - Intergenic
1053057734 9:35004137-35004159 CTGCTAAGGGTGAAGGACCAAGG - Intergenic
1053057761 9:35004254-35004276 CAGCTAAGGGTGAAGGAGAAGGG - Intergenic
1053504337 9:38628407-38628429 CCACCCAAGGTCAAGGACCAGGG - Intergenic
1054807689 9:69409452-69409474 CCGCTAAGGGTGAAGGACGAAGG + Intergenic
1055232795 9:74086451-74086473 CCACTAAGGGTGAAGGACCAAGG - Intergenic
1055232827 9:74086578-74086600 CCACTAAGGGTGAAGGAGAAGGG - Intergenic
1055232846 9:74086642-74086664 CCGCTAAGGGTGAAAGAGAAGGG - Intergenic
1055347921 9:75356482-75356504 CCGCTAAGAGTGAAGGAGAAGGG + Intergenic
1055347967 9:75356660-75356682 TCACTAAGAGTGAAGGACCAAGG + Intergenic
1055626482 9:78181653-78181675 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
1055809794 9:80138162-80138184 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
1055881530 9:81009912-81009934 CTGCTAAGGGTGAAGGACCAAGG - Intergenic
1055881544 9:81009975-81009997 CCGCTAAGGCTGAAGGAGAAGGG - Intergenic
1056044915 9:82705266-82705288 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1056044937 9:82705330-82705352 CCGCTAAGGGTGAAGGGGAAGGG + Intergenic
1056044955 9:82705394-82705416 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
1056060919 9:82884616-82884638 CCACTAAGGGTGAAGGACCAAGG - Intergenic
1056060967 9:82884802-82884824 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
1056323573 9:85459206-85459228 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
1056323620 9:85459392-85459414 CCACTAAGGGTGAAGGAGAAGGG - Intergenic
1056437435 9:86587981-86588003 CCGCTGAGGGTGAAGGAGAAGGG + Intergenic
1056437452 9:86588045-86588067 CCGCTAAGGGTGAACGAGAAGGG + Intergenic
1056437489 9:86588173-86588195 CCGCTGAGGGTGAAGGAGAAGGG + Intergenic
1056437508 9:86588237-86588259 CCGCTGAGGGTGAAGGAGAAGGG + Intergenic
1056437527 9:86588301-86588323 CCACTGAGGGTGAAGGAGAAGGG + Intergenic
1056437545 9:86588365-86588387 CCGCTGAGGGTGAAGGAGAAGGG + Intergenic
1056522154 9:87411579-87411601 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
1056831826 9:89923454-89923476 CCACAAAGGGGGAAGGAATACGG - Intergenic
1056882773 9:90413577-90413599 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
1057152097 9:92805520-92805542 CCACCCAAGGTCAAGGACCAGGG + Intergenic
1057234602 9:93348471-93348493 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
1057234619 9:93348535-93348557 CCGCTAAGAGTGAAGGAGAAGGG - Intergenic
1057377750 9:94540704-94540726 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
1057377775 9:94540803-94540825 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
1057683697 9:97215398-97215420 CCACTAAGGGTGAAGGACCAAGG - Intergenic
1057683772 9:97215631-97215653 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
1057981760 9:99670653-99670675 CTGCTAAGGGTGAAGGACCAAGG - Intergenic
1057981776 9:99670717-99670739 CCACTAAGCTTGAAGGAGAAGGG - Intergenic
1057981792 9:99670781-99670803 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
1057981810 9:99670844-99670866 CCACTAAGGGTGAAGGAGAAGGG - Intergenic
1058026446 9:100145542-100145564 CCACTAAGGGTGAAGGAGAAGGG + Intronic
1058026473 9:100145662-100145684 CTGCTAAGGGTGAAGGACCAAGG + Intronic
1058612183 9:106789114-106789136 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
1059133185 9:111776796-111776818 ACCCTAAGGTTGAAGGAACAAGG - Intronic
1059546362 9:115179350-115179372 CCGCTAAGGGTGAAAGAGAAGGG + Intronic
1059546389 9:115179475-115179497 CTGCTAAGGGTGAAGGACCAAGG + Intronic
1059574339 9:115474065-115474087 CTGCTAAGGGTGAAGGACCAAGG - Intergenic
1059574386 9:115474251-115474273 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
1059574404 9:115474315-115474337 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
1059574421 9:115474379-115474401 CCACTAAGGGTGAAGGAGAAGGG - Intergenic
1059606912 9:115843910-115843932 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1059606945 9:115844035-115844057 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
1059863693 9:118490379-118490401 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1059863719 9:118490504-118490526 CTGCTAAGAGTGAAGGACAAAGG + Intergenic
1060225917 9:121790881-121790903 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
1060318675 9:122535294-122535316 CCACTAAGGGTAAAGGACCAAGG + Intergenic
1060421553 9:123472899-123472921 CCTCCAAGGGTGAAGGGCAAGGG - Intronic
1060738141 9:126079562-126079584 CCACTAAGGGTGAAGGACCAAGG + Intergenic
1061009812 9:127948298-127948320 GCACTAGGGGTGGAGGAACAGGG - Intronic
1185858797 X:3559150-3559172 CCACTAAGGGTGAAGGAGAAGGG + Intergenic
1185858826 X:3559275-3559297 TCGCTAAGGGTGAAGGACCAAGG + Intergenic
1185960862 X:4545041-4545063 CTGCTAAGGGTGAAGGAGAAGGG + Intergenic
1185960880 X:4545105-4545127 CCACTAAGGGTGAAGGAGAAGGG + Intergenic
1185960901 X:4545171-4545193 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1185960962 X:4545418-4545440 CTGCTAAGGGTGAAGGACCAAGG + Intergenic
1185990829 X:4892482-4892504 CCACTAAGGGTGAAGGACCAAGG - Intergenic
1185990857 X:4892607-4892629 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
1186113099 X:6276953-6276975 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1186113132 X:6277074-6277096 CCGCTAAGGGTGAAGGAGCAAGG + Intergenic
1186783833 X:12940709-12940731 CCGCTAAGCATGAATGACCAAGG - Intergenic
1186783864 X:12940834-12940856 CCACTAAGGGTGAAGGAGAAGGG - Intergenic
1187086741 X:16049450-16049472 CCACTCAGGGTGAAGGAGAAGGG + Intergenic
1187086773 X:16049571-16049593 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
1187100079 X:16183334-16183356 CCGCTAAGGGTAAAGGAGAAGGG + Intergenic
1187100107 X:16183451-16183473 CCGCTAAGAGTGAAGGAGAAGGG + Intergenic
1187100138 X:16183573-16183595 CCGCTAAGGGTGAAAGACCAAGG + Intergenic
1188301236 X:28507001-28507023 CCACTAAGGATGAAGGATCAAGG + Intergenic
1188333217 X:28897255-28897277 CCGCTAAGGGTGAAGGACCAAGG + Intronic
1188463591 X:30453834-30453856 CCACTAAGGGTGAAGGAGAAGGG + Intergenic
1188463618 X:30453958-30453980 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
1188552460 X:31378597-31378619 CCGCTAAAGGTGAAGGACCAAGG - Intronic
1189031997 X:37460405-37460427 CCACTAAATGTGAAGGATCAAGG + Intronic
1189497348 X:41521051-41521073 CCAGTGAGTGTGGAGGACCAAGG - Intronic
1190474574 X:50813939-50813961 CCCTTAAGGGTGAAGCCCCAGGG + Exonic
1192705894 X:73528554-73528576 CTGCTAAGGGTGAAGGACCAAGG - Intergenic
1193885738 X:86982839-86982861 CCACTAAGGGTGAAGGCAAAGGG - Intergenic
1193941216 X:87682561-87682583 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
1193941275 X:87682808-87682830 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
1194186440 X:90778011-90778033 CTGCTAAGGGTGAAGGAGAAGGG + Intergenic
1194186499 X:90778252-90778274 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
1194293819 X:92104922-92104944 CCACTAAGGGTGAAGGAGAAGGG + Intronic
1194308779 X:92277911-92277933 CCGCTAAGGGTGAAGGACCAAGG + Intronic
1194351037 X:92825313-92825335 CTGCTAAGGGTGAAGGAGCAAGG - Intergenic
1194351068 X:92825440-92825462 CCGCTAAGGGTGAAGGAGAGGGG - Intergenic
1194351088 X:92825504-92825526 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
1194366863 X:93023802-93023824 TCGCTAAGGGTGAAGGATCAAGG - Intergenic
1194366896 X:93023923-93023945 CCACTAAGGGTGAAGGAGAAGGG - Intergenic
1194503199 X:94703600-94703622 CCACTCAGGGTGAAGGAGAAAGG + Intergenic
1194503232 X:94703721-94703743 CCACTAAGGGTGAAGGACCAAGG + Intergenic
1194660437 X:96624838-96624860 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
1194822971 X:98528990-98529012 CCACTAAGGGTGAAGGAGAAGGG + Intergenic
1194822990 X:98529054-98529076 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1194823022 X:98529179-98529201 ACGCTAAGGGTGAAGGACCAAGG + Intergenic
1194874052 X:99164332-99164354 CAGCTAAGGTTGAAGGAGCAAGG + Intergenic
1195327070 X:103766475-103766497 CCACTAAGGGTGAAGGATCAAGG + Intergenic
1195841226 X:109179211-109179233 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
1195841259 X:109179332-109179354 CCCCTAAGGGTGAAGGAGAAGGG - Intergenic
1195908879 X:109869907-109869929 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1195908897 X:109869969-109869991 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
1196072819 X:111544680-111544702 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
1196165263 X:112531275-112531297 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
1196165291 X:112531400-112531422 CCGCTAAGAGTGAAGGAGAAGGG - Intergenic
1196221215 X:113113532-113113554 CTGCTAAGGGTGAAGGACCAAGG + Intergenic
1196299797 X:114040922-114040944 CCGCTAAGGGTGAAGTACCAAGG - Intergenic
1196299809 X:114040986-114041008 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
1196330568 X:114467543-114467565 CCGCTAAGGGTGAAGGACCAAGG - Intergenic
1196330585 X:114467607-114467629 CCGCTAAGAGTGAAGGAGAAGGG - Intergenic
1196341956 X:114606163-114606185 CCACTAAGGGTGAAGGAGAAGGG + Intronic
1196341972 X:114606225-114606247 CCGCTAAGGGTGAAGGAGAAGGG + Intronic
1196341999 X:114606350-114606372 CCGCTTAAGGTGAAGGATCAAGG + Intronic
1196525688 X:116725665-116725687 CCACTAAGGGTGAAGGAGAAGGG + Intergenic
1196525735 X:116725843-116725865 CTGTTAAGGGTGAAGGACCAAGG + Intergenic
1196533741 X:116817193-116817215 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1196533760 X:116817257-116817279 CCACTAAGGGTGAAGGAGAAGGG + Intergenic
1196533776 X:116817321-116817343 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
1196572254 X:117280011-117280033 CTGCAAAGGGTGAAGGACCAAGG - Intergenic
1196572317 X:117280257-117280279 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
1196774061 X:119322462-119322484 CTGCTAAGGGTGAAGGAGAAGGG + Intergenic
1196774093 X:119322587-119322609 CCACTAAGGGTGAAGGACCAAGG + Intergenic
1197064671 X:122222887-122222909 CGGCTAAGGGTGAAGGACCAAGG - Intergenic
1197064700 X:122223013-122223035 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
1197352260 X:125393545-125393567 CTGCTAAGGGTGAAGGAGAAGGG + Intergenic
1197352290 X:125393670-125393692 CCGCTAAGGGTGAAGGACCAAGG + Intergenic
1197470721 X:126863943-126863965 CAGCTAAGGGTGAAGGACCAAGG - Intergenic
1197712485 X:129681533-129681555 TCACTAACGGTAAATGACCAGGG - Intergenic
1197932836 X:131712880-131712902 CCGCTAAGGGTGAAAGACCAAGG - Intergenic
1198598184 X:138259492-138259514 CTGCTAAGGGTGAAGGACCATGG - Intergenic
1198598217 X:138259617-138259639 CCACTAAGGGTGAAGGAGAAGGG - Intergenic
1198599606 X:138269056-138269078 CTGCTAAGGGTGAAGGAGAAGGG + Intergenic
1198599638 X:138269177-138269199 CCGCTAAGGGTAAAGGACCAAGG + Intergenic
1199188080 X:144939792-144939814 CCTCTAAGCCTGAAGGAGCAAGG + Intergenic
1199576215 X:149316465-149316487 CTGCTAAGGGTGAAGGACCAAGG - Intergenic
1199576248 X:149316590-149316612 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
1199576280 X:149316715-149316737 CCACTAAGGGTGAAGGAGAAGGG - Intergenic
1200136784 X:153879128-153879150 CCACTAAGGGCAAAGGAGCGGGG + Intronic
1200533040 Y:4360087-4360109 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1200533099 Y:4360328-4360350 CTGCTAAGGGTGAAGGACCAAGG + Intergenic
1200611336 Y:5329463-5329485 CCACTAAGGGTGAAGGAGAAGGG + Intronic
1200659363 Y:5941993-5942015 CCGCTAAGGGTGAAGGACTAAGG - Intergenic
1200659397 Y:5942120-5942142 CCGCTAAGGGTGAAGGAGAGGGG - Intergenic
1200659417 Y:5942184-5942206 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
1200675086 Y:6140058-6140080 TCGCTAAGGTTGAAGGATCAAGG - Intergenic
1200675118 Y:6140179-6140201 CCACTAAGGGTGAAGGAGAAGGG - Intergenic
1200870129 Y:8088773-8088795 CCTCTATATGTGAAGGACCAAGG + Intergenic
1201307674 Y:12564514-12564536 CCCCTAAGGGTGAAGGATAAAGG + Intergenic
1201581178 Y:15513273-15513295 CCACTAAGGGTAAAGGAGAAGGG - Intergenic
1201936842 Y:19419335-19419357 CCACTAAGGGTGAAGGACCAAGG - Intergenic
1201936864 Y:19419439-19419461 CCGCTAAGGGTGAAGAAGAAGGG - Intergenic
1202076786 Y:21044292-21044314 CTGCCAAGGGTGAAGGACCAAGG + Intergenic
1202092551 Y:21209027-21209049 CCCCTATGGGTGCAGGCCCAGGG - Intergenic