ID: 1029500006

View in Genome Browser
Species Human (GRCh38)
Location 7:100923119-100923141
Sequence GTGGAAAGTACCGCTTTTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029499997_1029500006 13 Left 1029499997 7:100923083-100923105 CCATGTGGGGATGCCTGCCTTGG No data
Right 1029500006 7:100923119-100923141 GTGGAAAGTACCGCTTTTCTGGG No data
1029499999_1029500006 0 Left 1029499999 7:100923096-100923118 CCTGCCTTGGTCCTTCACCCTTA 0: 465
1: 199
2: 49
3: 107
4: 236
Right 1029500006 7:100923119-100923141 GTGGAAAGTACCGCTTTTCTGGG No data
1029500000_1029500006 -4 Left 1029500000 7:100923100-100923122 CCTTGGTCCTTCACCCTTAGTGG 0: 93
1: 326
2: 368
3: 366
4: 369
Right 1029500006 7:100923119-100923141 GTGGAAAGTACCGCTTTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029500006 Original CRISPR GTGGAAAGTACCGCTTTTCT GGG Intergenic
No off target data available for this crispr