ID: 1029503873

View in Genome Browser
Species Human (GRCh38)
Location 7:100950370-100950392
Sequence CAGAGAAAAGAGAAGTATAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 758
Summary {0: 1, 1: 0, 2: 6, 3: 49, 4: 702}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029503873_1029503874 12 Left 1029503873 7:100950370-100950392 CCTCTATACTTCTCTTTTCTCTG 0: 1
1: 0
2: 6
3: 49
4: 702
Right 1029503874 7:100950405-100950427 TGCTTCTGATCCCCGATCCCAGG 0: 1
1: 0
2: 0
3: 7
4: 118
1029503873_1029503878 28 Left 1029503873 7:100950370-100950392 CCTCTATACTTCTCTTTTCTCTG 0: 1
1: 0
2: 6
3: 49
4: 702
Right 1029503878 7:100950421-100950443 TCCCAGGCCACCCAGCCTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029503873 Original CRISPR CAGAGAAAAGAGAAGTATAG AGG (reversed) Intronic
901315698 1:8306408-8306430 CAGAAAAAAGAAAAGAAAAGAGG + Intergenic
901905945 1:12411313-12411335 CAGAGAAAAGAAAAATTTGGAGG + Intronic
902114891 1:14113277-14113299 CAGAGAACAGAGATGTTCAGTGG + Intergenic
902704207 1:18193199-18193221 CAGAGGGAAGAGCAGCATAGAGG + Intronic
904230984 1:29072009-29072031 CAGAGACAAGAGAACAATATTGG - Intronic
905800736 1:40840611-40840633 CAGAGAACTGAGAAGTCCAGGGG + Intergenic
907265010 1:53253455-53253477 CAGATAAAATATAAGTAAAGGGG + Intronic
907741009 1:57165789-57165811 GGGAGAAAAGAGAGGTAGAGTGG - Intronic
907774505 1:57500207-57500229 CAGAGAAATGAGAAAAAAAGAGG + Intronic
908495844 1:64693997-64694019 TAGATAAAAGATAATTATAGAGG - Intergenic
908595492 1:65684895-65684917 AAGTGAGAAGAGAAGTTTAGAGG - Intergenic
908726331 1:67181347-67181369 AAGTGAGAAGAGAAGTTTAGAGG - Intronic
908909808 1:69060117-69060139 CACAGAAAAGAGAAATGTAAGGG + Intergenic
909081829 1:71121836-71121858 AAGCGAGAAGAGAAGTTTAGAGG - Intergenic
909084833 1:71158202-71158224 AAGAGAAAAGAGGAGTTGAGAGG - Intergenic
909130834 1:71734862-71734884 CAGAGACAAGAGAACTGAAGAGG - Intronic
909885524 1:80937928-80937950 CAGAAAAAAGAGACATATAGAGG + Intergenic
910176440 1:84435941-84435963 CAGACAAAAGAGCAGTATCCTGG + Intergenic
910204748 1:84738096-84738118 AAGAGAAAAGGAAAGCATAGAGG - Intergenic
910407678 1:86907338-86907360 GGGATAAAAGATAAGTATAGGGG + Intronic
910462153 1:87459106-87459128 CAGAGGAAAGAGAAAAATTGAGG + Intergenic
910548962 1:88454464-88454486 CAGAGAAAAGAGAGTATTAGAGG - Intergenic
911895106 1:103423435-103423457 CAGAGAAAAGTGCAGTTTGGAGG + Intergenic
912245440 1:107957298-107957320 CAGAGAAAGGAGGTGAATAGAGG - Intronic
912902049 1:113661724-113661746 CAGAGAAAAGAGAAGGGTGGAGG + Intronic
913310994 1:117493115-117493137 AGGAGAAAACAGAAGGATAGAGG - Intronic
913582992 1:120245781-120245803 CAGAGAAATGAAAAGTCTGGAGG - Intergenic
913625180 1:120652579-120652601 CAGAGAAATGAAAAGTCTGGAGG + Intergenic
913981629 1:143524363-143524385 TAGAGAAAAGACAAATATATAGG - Intergenic
914000548 1:143691145-143691167 GAGAGAAAAGAAAAGAAAAGAGG + Intergenic
914076002 1:144351018-144351040 TAGAGAAAAGACAAATATATAGG - Intergenic
914103176 1:144615478-144615500 TAGAGAAAAGACAAATATATAGG + Intergenic
914392658 1:147236298-147236320 GAGAGAAGAGAGAAGGAGAGAGG - Intronic
914476642 1:148029063-148029085 AAAAGAAAAGAGAAGAAAAGAGG - Intergenic
914687933 1:149998532-149998554 TAGAGAAGAGAGAAATATAGCGG - Intronic
914730695 1:150367504-150367526 AAGAAAAAAGAGAAGCAAAGTGG - Intronic
914844476 1:151274306-151274328 CAGAGAAAAGGGCAGTGGAGAGG + Intergenic
915770059 1:158411709-158411731 CAGGGAAAATAGAAATAGAGTGG + Intergenic
915800333 1:158784576-158784598 CAGAGACTAGAGAAGAAAAGGGG - Intergenic
916149333 1:161771129-161771151 AAGAGAAGAGAGAAGGAGAGAGG - Intronic
916202466 1:162285037-162285059 GTTAGAAAAGAGAAGTATATGGG + Intronic
916551577 1:165854845-165854867 CAGGAAAAACAGAAGTATAAAGG - Intronic
916578031 1:166084544-166084566 TTCAGAAAAGAGAAATATAGTGG + Intronic
916623323 1:166525688-166525710 CAGTGAAAACACAAGTATTGTGG + Intergenic
916954099 1:169813674-169813696 CAGAAAAAGGAGAAGGTTAGCGG + Intronic
916981122 1:170138195-170138217 GACAGAAAAGAGAAGAAAAGAGG - Intergenic
917116510 1:171608928-171608950 CAGTGAAAGGTGAACTATAGTGG - Intergenic
917249787 1:173045922-173045944 AAGAGAAAATAGAAGTACGGAGG - Intronic
917505141 1:175620580-175620602 CAGAGAGAAAAGAAGCAGAGGGG + Intronic
917608686 1:176663837-176663859 CACACAAAAGAAAAGTGTAGTGG - Intronic
917756199 1:178101140-178101162 AAGGGAAAAGAGAAGTCTTGAGG + Intronic
918430489 1:184454935-184454957 AAGAGAAAAGAGAAAGAAAGAGG + Intronic
918555522 1:185794884-185794906 CAGAGAATATATAAATATAGTGG - Intronic
918698653 1:187579259-187579281 CTGAGAAAAGAAAACTATATAGG - Intergenic
918730272 1:187984488-187984510 TAGGGAAAAGTGATGTATAGGGG - Intergenic
918744761 1:188185165-188185187 GATAGAAAGGAGAAGTAGAGTGG + Intergenic
918760224 1:188394970-188394992 AAGAGGAAAGAAAAGAATAGTGG - Intergenic
919037433 1:192332268-192332290 CAAAGAAATGAGAATTATATGGG + Intronic
919122491 1:193358555-193358577 TAGAGACAAGAGAAATAAAGAGG + Intergenic
919289115 1:195605680-195605702 CACCAAAAAGAGAAGTATACTGG - Intergenic
919333388 1:196201156-196201178 CAGAGAATAGAAAAATATACTGG + Intergenic
919641681 1:200051351-200051373 GAGGGAAAAGAGAGGAATAGTGG - Intronic
920369292 1:205467752-205467774 CAGAGAACACTGAAGTACAGAGG + Intergenic
920461831 1:206146407-206146429 CAGGGAAAAGAGAACTAGACAGG - Intergenic
920644724 1:207792297-207792319 AAAAGAAAAGAAAAATATAGTGG + Intronic
920714689 1:208328516-208328538 GAGAGAGAAGAGAAATAAAGAGG - Intergenic
921649688 1:217662223-217662245 CTGAGAGCAGAGAAGTATAAAGG + Intronic
921671350 1:217927265-217927287 GAGAGCAAAGAGAAGGAGAGTGG + Intergenic
922149949 1:222992051-222992073 GAGAGAAAAGAGAAGTTGACTGG + Exonic
922217145 1:223529192-223529214 GAGAGAAAAAAGAGGTATAAAGG + Intergenic
922570304 1:226630823-226630845 AAGAGAAAAGAAAAGAAAAGAGG + Intergenic
923032161 1:230257773-230257795 CAGAGAGAAGGGAGGTAGAGCGG + Intronic
923138582 1:231140775-231140797 CAGGGAAAATAGCAGTAAAGAGG + Intergenic
923222819 1:231911887-231911909 AAGCGATAAGAGAAGTTTAGAGG - Intronic
923440997 1:234020286-234020308 CAAACAAATGAGAACTATAGAGG - Intronic
923847706 1:237754934-237754956 CAGAGAAAAGAAAAAAAAAGAGG - Intronic
924096471 1:240556578-240556600 AAAAGAAAAGAGAAATATTGAGG + Intronic
924185339 1:241483547-241483569 CAGTGAAAAGAGAGATAAAGAGG - Intergenic
1063159786 10:3410730-3410752 CAAAGAAAAGAAAAGAAAAGAGG + Intergenic
1063774626 10:9247576-9247598 CAAAAAAAAGAAAAGAATAGAGG + Intergenic
1063860483 10:10302053-10302075 CAGAGCAAAGAGAAGTATACAGG - Intergenic
1063886113 10:10580768-10580790 CAGAGAAAAGGGAATCAAAGTGG + Intergenic
1064071132 10:12229058-12229080 CACAGAAAGGAGAAGCGTAGAGG - Intronic
1064620933 10:17216737-17216759 CAGAGAAAAGAGGAGCAGATTGG + Intergenic
1065468212 10:26048240-26048262 CAGAGATTAGAGAAGTAAATGGG - Intronic
1066071705 10:31822193-31822215 CAAAGAAAACAGAATTATTGTGG + Intronic
1066129221 10:32374439-32374461 TAGAGAAAAGAGATGAAGAGAGG - Intronic
1066603789 10:37138654-37138676 AAGTGAGAAGAGAAGTTTAGAGG + Intronic
1066778957 10:38921652-38921674 TAGAGAAAAGACAAATATATAGG - Intergenic
1066952276 10:42131972-42131994 TAGAGAAAAGACAAATATATAGG + Intergenic
1067034873 10:42906719-42906741 CAGACAAGAGAGAAGAATAAAGG + Intergenic
1068213849 10:53957043-53957065 TAGCTAAAAGAGAAGTCTAGAGG + Intronic
1068345011 10:55764980-55765002 CAGAGAAAGAACAATTATAGGGG - Intergenic
1068459185 10:57304447-57304469 CATAGAAAAGAGAAAGATAGGGG + Intergenic
1068796604 10:61089187-61089209 AAGATAAAATAGAAGTAAAGGGG - Intergenic
1068904957 10:62312356-62312378 CTGAGAAAAGATAGTTATAGAGG + Intergenic
1069163203 10:65115665-65115687 CAGAGAAACTAGAAAAATAGAGG - Intergenic
1069276463 10:66596594-66596616 AAGAGAAAAGAGAAATAGAGTGG + Intronic
1069293498 10:66813889-66813911 CAGAGAAATGTGAAATGTAGAGG + Intronic
1070268078 10:74924120-74924142 CAGAGGTAACAGAAGTAAAGGGG + Intronic
1070676158 10:78412918-78412940 CAGAGAAAATAAAAGCTTAGAGG + Intergenic
1070861556 10:79669971-79669993 CAGAGAAAGAACAATTATAGGGG + Intergenic
1070875691 10:79805616-79805638 CAGAGAAAGAACAATTATAGGGG - Intergenic
1071499624 10:86194076-86194098 CAGAGAAAGGAGAAGTGTTCTGG - Intronic
1071642620 10:87327770-87327792 CAGAGAAAGAACAATTATAGGGG - Intergenic
1071710858 10:88047833-88047855 CAGAGAAAGGAAAAGGAAAGGGG - Intergenic
1072574959 10:96690986-96691008 CATAGAAATGAGAAGTGAAGAGG + Intronic
1073112684 10:101072018-101072040 CAGATAAAAGAGATGGATGGAGG - Intergenic
1073452041 10:103615895-103615917 CAGAGAACATAAAAGTCTAGGGG + Intronic
1073466761 10:103698804-103698826 CAGAGAAAAGAGAGGTCCTGGGG + Intronic
1073626572 10:105103646-105103668 CAGAAGAAAGAAAAGTTTAGAGG + Intronic
1074839977 10:117341336-117341358 CAAAGAAAAGAAAAGCCTAGAGG + Intronic
1075034873 10:119056307-119056329 TAGAGAAAGGAGTAGTTTAGCGG + Intronic
1076304952 10:129459548-129459570 CAGAGAAATGAGAAGTCCAGGGG + Intergenic
1077745045 11:4893447-4893469 CTGAGAAGAAAGCAGTATAGTGG - Intronic
1078587152 11:12601675-12601697 AAGAGAAAAGAGATGGAAAGAGG - Intergenic
1078654832 11:13229029-13229051 CAGAGCAAAGAGAAGGAGACTGG + Intergenic
1078780122 11:14430349-14430371 AAGCGAGAAGAGAAGTTTAGAGG + Intergenic
1079530932 11:21452113-21452135 AAAAGAAAAGAGAAGGAGAGAGG + Intronic
1079605760 11:22364184-22364206 AAGAGATAAGATCAGTATAGTGG + Intronic
1080922288 11:36721131-36721153 AAGAAGAAAAAGAAGTATAGAGG - Intergenic
1080991910 11:37546572-37546594 CAGAAGAAAGAGAAGTTTAAAGG + Intergenic
1084075330 11:66770764-66770786 AAGAGAAGAGGGAAGTAAAGGGG - Intronic
1084682035 11:70672042-70672064 AAAAGAAAAGAAAAGTATGGTGG - Intronic
1085062756 11:73462923-73462945 AAGAGAAAAGAGAAGAGAAGAGG + Intronic
1085338608 11:75717002-75717024 GAGAGAAAAGAGAAGTCCCGAGG + Intergenic
1085360482 11:75880853-75880875 CAGTTAAAAGAGAACTGTAGAGG - Intronic
1086134976 11:83436043-83436065 CAGAGCAAAGAGCAGGACAGGGG + Intergenic
1086564340 11:88208402-88208424 TAGAGTAAAGAGTAGAATAGTGG - Intergenic
1087419644 11:97905551-97905573 CAGAGAAAAGAGAAATAATGAGG + Intergenic
1088339547 11:108747617-108747639 CAGAGAAATCAGCAGTATACAGG - Intronic
1088417101 11:109601180-109601202 CAGAGGTGAGAGAAATATAGAGG - Intergenic
1088743561 11:112786235-112786257 CAGAGAAAACAGATATTTAGGGG - Intergenic
1088988088 11:114927538-114927560 CAGAAAAGAGAGGAATATAGAGG + Intergenic
1090566306 11:127995632-127995654 CAGAGAACAGAGAAGATGAGTGG - Intergenic
1091153470 11:133351395-133351417 CTGAGAAGAGAGAAATACAGTGG - Intronic
1091210812 11:133857227-133857249 TAGTGTATAGAGAAGTATAGTGG + Intergenic
1092306046 12:7302187-7302209 GGGAGAAAAGAGAAGCAGAGTGG - Intergenic
1092367972 12:7892769-7892791 AAGAGAAAAGGGAAGGAGAGAGG + Intergenic
1092442525 12:8519466-8519488 CAGTGAACAGACAATTATAGTGG - Intronic
1092629343 12:10361671-10361693 AAGAGCAAAGAGAAGGTTAGAGG + Intergenic
1092650371 12:10628370-10628392 AAGAGAAGAGAGAAGTTTGGTGG + Intronic
1092874931 12:12839683-12839705 CAAAAAAAAGAGAAGAGTAGTGG + Intergenic
1093109845 12:15137172-15137194 CAGAGAAAGGAAAATTATAATGG - Intronic
1093250378 12:16795505-16795527 TAAAGCAAAGCGAAGTATAGAGG + Intergenic
1093576841 12:20741076-20741098 CACAGGAGAGAGAAGTACAGAGG + Intronic
1093841254 12:23904234-23904256 TAGAGAAAAGAGAAGAAAAATGG - Intronic
1093997517 12:25657797-25657819 CAGAGTAAAGAGAATTAACGGGG + Intergenic
1095089764 12:38092744-38092766 AAGTGAGAAGAGAAGTTTAGAGG + Intergenic
1095510685 12:42948765-42948787 CAGAGAAAAGACAAGCATCAAGG - Intergenic
1095677704 12:44938605-44938627 GAAAGAAAAGAAAAGTATACTGG - Intergenic
1095798565 12:46247462-46247484 AAGTGAGAAGAGAAGTTTAGAGG + Intronic
1095827370 12:46544655-46544677 AAGTGAGAAGAGAAGTTTAGAGG - Intergenic
1096436318 12:51592882-51592904 TGGAGAAAAGAGAAGTGCAGAGG - Intronic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096835803 12:54350450-54350472 CAGAGATAAGAGCAGCATTGAGG - Intronic
1097006826 12:55925827-55925849 AAGAGTAAAGAGAAGTATACTGG + Intronic
1097437453 12:59568898-59568920 CAGAGAAAATAGAAGAGTCGAGG - Intergenic
1097743869 12:63277577-63277599 AATAGAAAAGAGAATTACAGAGG + Intergenic
1097986794 12:65791668-65791690 CTGAGAAAAGAGAATTATAATGG - Intergenic
1098725862 12:73966064-73966086 CAGAGAAAAGAAAATCATACTGG - Intergenic
1099070621 12:78041989-78042011 CAGAGAAAAAGGAAGTAGATGGG - Intronic
1099281881 12:80660174-80660196 CAAAGGGAAGAGAACTATAGAGG + Intronic
1099316178 12:81084755-81084777 GAGAGAAAAGATAAAAATAGTGG + Intronic
1099738245 12:86598038-86598060 CATAGAAAAGTAAAGTATAAAGG - Intronic
1099895827 12:88645304-88645326 TAGAGTAATGATAAGTATAGAGG - Intergenic
1100035309 12:90243666-90243688 CAAAGAAAAGAGAAGAGAAGGGG - Intergenic
1100155334 12:91792702-91792724 GAAAGAAAGAAGAAGTATAGTGG + Intergenic
1100641464 12:96485627-96485649 AAGAGAACAGAGAATTCTAGAGG - Intergenic
1100907661 12:99320406-99320428 AAGCGAGAAGAGAAGTTTAGAGG - Intronic
1101286316 12:103316943-103316965 CTGAGGAAAGAGAAGTGAAGTGG - Intronic
1102216511 12:111165272-111165294 CTGAGAAAAGAGAAGTAGGAAGG + Intronic
1102856540 12:116299338-116299360 CATAGAAAGGAGAAGTGTGGGGG + Intergenic
1103247653 12:119471875-119471897 AAGAGAAAAGAGAGATAAAGAGG - Intronic
1103501249 12:121404351-121404373 CAGACACAAGAGAAGTATAGGGG - Intronic
1103677246 12:122665551-122665573 AAGAGAAAAGAGAAGAAAAGAGG - Intergenic
1104165943 12:126229956-126229978 CAGAGTAAACAGAAGTACAGGGG + Intergenic
1104451875 12:128875876-128875898 CAGAGAAAGGAGAAGATGAGGGG - Intronic
1104455948 12:128912384-128912406 GAGAGAAAAGAAAAGTACATTGG - Intronic
1105201500 13:18183605-18183627 AAGTGAGAAGAGAAGTTTAGAGG + Intergenic
1106206220 13:27597837-27597859 CAAAGAAAAGAGAATTATAAGGG + Intronic
1106339001 13:28810254-28810276 CAGAAGAAAGAGAGGTATGGGGG - Intergenic
1106646782 13:31643556-31643578 CAGAGAAAACAGAAGTATATAGG + Intergenic
1106999514 13:35527025-35527047 GAGAGAAGAGAGAAGGAGAGAGG - Intronic
1108766202 13:53632838-53632860 CAGAGAACCTAGGAGTATAGAGG - Intergenic
1109556870 13:63987536-63987558 AAGAGAAAGGAGAAGAAAAGTGG - Intergenic
1109660985 13:65459901-65459923 GAGAGAAAAGGGAATTATAAGGG + Intergenic
1109664892 13:65521257-65521279 CAGAGAAAAGTGAAAGACAGAGG - Intergenic
1109977643 13:69860370-69860392 CAGAAAAAAGAGAATGTTAGTGG + Intronic
1110109721 13:71731254-71731276 CAAGGAAAAGAGAAGTTAAGTGG - Intronic
1110219014 13:73053198-73053220 CAGAGTAAAAATAAGTGTAGAGG + Intergenic
1110297365 13:73884233-73884255 CTGAGAAAAGAGAAGAATATAGG - Intronic
1111196880 13:84887097-84887119 CATAGAAGAGTGAAATATAGTGG + Intergenic
1111592405 13:90367185-90367207 CAGAGAAAAGAAAAGAAGAGGGG + Intergenic
1111708009 13:91775517-91775539 TGGAAAAAAGAGAAATATAGAGG - Intronic
1111877994 13:93920524-93920546 CAGAAAGAAGAGCAGTATAGGGG - Intronic
1112235353 13:97630962-97630984 CAGAGGAATGAGAAGAAAAGTGG + Intergenic
1112471108 13:99690393-99690415 CACAGGGAAGAGAAGTAGAGAGG - Intronic
1112554248 13:100452154-100452176 AAGAAAAAAGAGAAGGAGAGAGG - Intronic
1112652221 13:101412324-101412346 CAAAGAAAAGAGATGAAAAGAGG - Intronic
1112843920 13:103614392-103614414 AAGAGAAAAAAGAAACATAGGGG + Intergenic
1113061476 13:106326699-106326721 CAGGGAAATCAGAAGTATAGAGG + Intergenic
1113098663 13:106693440-106693462 AAGAGAAAAGAAAAAAATAGAGG + Intergenic
1113400340 13:109986656-109986678 AAGAAAAAAGAAAAGTAAAGAGG + Intergenic
1113498165 13:110750198-110750220 AAAAGAAAAGAGAGGAATAGAGG - Intergenic
1114377811 14:22168068-22168090 AAGAGAAAAAAGAAGTATCAAGG - Intergenic
1114708940 14:24757479-24757501 CAGAGAAAAGAAAGGGATAGAGG + Intergenic
1114756650 14:25267538-25267560 CAGAGAAAAAAAAAGTATTAAGG - Intergenic
1114853900 14:26414418-26414440 AGGAGAAAATAGAAGCATAGAGG - Intergenic
1115103810 14:29735727-29735749 CAGAGAGAAATGAAATATAGAGG - Intronic
1115790968 14:36877732-36877754 CACAGAAAAAAGAAGAAAAGAGG + Intronic
1115929106 14:38470957-38470979 GAGAGAAAAGAGGACTGTAGTGG - Intergenic
1116797967 14:49412016-49412038 CAGAGAAAACAGACGTTTATTGG + Intergenic
1117202831 14:53410062-53410084 CAGAGAAAAAAGAAGTTATGTGG - Intergenic
1117803629 14:59468341-59468363 CACAGAAAAAAGAAGGAAAGTGG - Intronic
1117935321 14:60898384-60898406 CAGAGAAAAGAGGATTCTATTGG - Intronic
1119101706 14:71885931-71885953 GAGAAAAAAGAGAAGGAGAGTGG - Intergenic
1119108892 14:71952389-71952411 AAGAGAAAAAGGAAGTACAGAGG - Intronic
1119133468 14:72195513-72195535 CAGAGTAGAGAGAAGAAAAGAGG + Intronic
1119476773 14:74934977-74934999 CAGAGAAGAGAGAAGGAGAAGGG + Intergenic
1119607322 14:76031839-76031861 CAGAGAAGAGAGAAGGTTAGAGG - Intronic
1119618684 14:76115297-76115319 CAGAGAAAAAGGAAGCACAGAGG - Intergenic
1119641255 14:76316692-76316714 CAGAGAGGAGAGAAGGATAGGGG - Intronic
1120013962 14:79449225-79449247 AGCAGAAAAGACAAGTATAGTGG - Intronic
1120428882 14:84388439-84388461 CAAAGAAAAGAGTAGAATGGCGG + Intergenic
1120525375 14:85570933-85570955 CAAAGAAAAGGCAAGTATAATGG - Intronic
1121068320 14:90991394-90991416 GTGAGAAAATAGAAGTAAAGAGG + Intronic
1121947894 14:98140664-98140686 CAGAGGAAAGTGAAGCTTAGTGG + Intergenic
1122189862 14:100032746-100032768 CAGAAAAAAGAGAAATTTTGTGG - Intronic
1122277976 14:100605004-100605026 CAGGGAAAAGAGAAGTGTCTAGG - Intergenic
1123127668 14:105960837-105960859 AAGGGAGAAGAGAAGTTTAGAGG - Intergenic
1202938301 14_KI270725v1_random:114600-114622 TAGAGAAAAGACAAATATATAGG + Intergenic
1123394890 15:19923290-19923312 TAGAGAAAAGACAAATATATAGG - Intergenic
1123451288 15:20361837-20361859 TAGTGAAAAGACAAATATAGAGG - Intergenic
1123792558 15:23736823-23736845 GAGAGAAAAAAGCAGTCTAGAGG + Intergenic
1123960575 15:25395413-25395435 CAGAGTAAACAGAAGTATAATGG + Intronic
1124037234 15:26065839-26065861 CTGAGCAAAGAGAAGCAGAGAGG - Intergenic
1124428804 15:29588309-29588331 CAGGGAAAAGAAAGGGATAGAGG + Intergenic
1124786520 15:32686555-32686577 GAAAGAAAAGAGAGGAATAGAGG + Intronic
1124797048 15:32791989-32792011 CAGAGAATAGAGCAGAAAAGAGG + Intronic
1125518830 15:40337312-40337334 CAGAGAAAAGAGAGGACAAGGGG + Intronic
1126020643 15:44397566-44397588 AAGAGAAAAAAGAAGTAATGAGG - Intronic
1126328250 15:47505022-47505044 CACAGAAAACAGAATTACAGTGG + Intronic
1126696468 15:51330057-51330079 CAGAGAAATGAGCATGATAGTGG + Intronic
1127191089 15:56531340-56531362 CAGGGAAAAGAGAATTACTGTGG + Intergenic
1127719460 15:61685620-61685642 CATAAAAAAGGGAGGTATAGGGG + Intergenic
1127971064 15:63962056-63962078 AAGTGAGAAGAGAAGTTTAGAGG - Intronic
1128104305 15:65031762-65031784 AACAGAAAAGAGAAGCAAAGAGG + Intergenic
1128762579 15:70227430-70227452 CAGAGGAAATGGAAGTTTAGAGG + Intergenic
1128961872 15:72014810-72014832 AAAAGAAAAGAGAAGAAAAGAGG + Intronic
1129010533 15:72412299-72412321 AAGCGAGAAGAGAAGTTTAGAGG - Intergenic
1129111040 15:73337291-73337313 CACAGAAGTGAGAAGTAGAGAGG - Intronic
1129805174 15:78450436-78450458 CAGATAACAGAGAAGTATATTGG + Intronic
1130141969 15:81235166-81235188 CAGAGAAAAGATAAGGTTGGGGG + Intronic
1130289588 15:82585766-82585788 CAGAGAAGAGAGTAGGATTGAGG - Intronic
1130399557 15:83536860-83536882 CAGAGATAATCAAAGTATAGAGG - Intronic
1131730143 15:95270851-95270873 CAGAGAAAAGTCAAATAAAGTGG + Intergenic
1132425294 15:101710805-101710827 CAGAAACAAGAGAAGGAGAGGGG + Intronic
1133323944 16:4931955-4931977 TAGAGAGAAGAGAGGTAGAGGGG + Intronic
1133443023 16:5836508-5836530 CAGAGAATAAGGAAGTATGGAGG - Intergenic
1134231415 16:12433220-12433242 CAGAGAAAAGAAATGTCTTGAGG + Intronic
1134488940 16:14681175-14681197 AAGAGAAAAGAAAAGAAAAGGGG + Intronic
1134854821 16:17509671-17509693 AAGAACAAAGAGAAGTTTAGAGG - Intergenic
1135290222 16:21230008-21230030 AGAAGAAAAGAGAAGTTTAGAGG - Intergenic
1135706160 16:24676936-24676958 CAGAGAGAAAAGAAGGCTAGAGG - Intergenic
1135869104 16:26132669-26132691 CAGTGCAAAGAGAAGCATTGAGG + Intronic
1136074799 16:27809657-27809679 GAGAGAAAAGAGAGGGATGGAGG - Intronic
1136766672 16:32785749-32785771 TAGAGAAAAGACAAATATACAGG + Intergenic
1136770369 16:32833436-32833458 TAGAGAAAAGACAACTATATAGG + Intergenic
1136801425 16:33084629-33084651 TAGAGAAAAGACAAATATACAGG - Intergenic
1136936490 16:34471332-34471354 TAGAGAAAAGACAAATATATAGG + Intergenic
1136945235 16:34642610-34642632 TAGAGAAAAGACAAATATATAGG - Intergenic
1136948176 16:34681757-34681779 TAGAGAAAAGACAAATATATAGG - Intergenic
1136955568 16:34781634-34781656 TAGAGAAAAGACAAATATATAGG - Intergenic
1136963329 16:34877238-34877260 TAGAGAAAAGACAAATATATAGG - Intergenic
1137220727 16:46447848-46447870 TAGAGAAAAGACAAATATATAGG + Intergenic
1137264833 16:46860118-46860140 CAGAGAACAGAGAACTTCAGAGG - Intergenic
1137681002 16:50344694-50344716 AAGCAAAAAGAGAAGTTTAGAGG + Intronic
1138181568 16:54943998-54944020 CACATAAAAGAGAAGATTAGTGG + Intergenic
1138292661 16:55861295-55861317 CATAGAAAAGAGGAGGATTGAGG - Intronic
1138754880 16:59471750-59471772 GTGGGAGAAGAGAAGTATAGTGG - Intergenic
1138757484 16:59505967-59505989 GAGAGTAGAGAGAAGTAGAGGGG + Intergenic
1138858377 16:60723655-60723677 AAGAGAAAGAAGAAGTATAAGGG + Intergenic
1139041198 16:63001150-63001172 GAGAGAAAAGAGCACAATAGGGG - Intergenic
1140741071 16:77942125-77942147 CAAAGAAAAAAGAAGTTTAATGG + Intronic
1140787310 16:78355132-78355154 AAAAGAAAAGAAAAGTAGAGAGG + Intronic
1140903571 16:79392109-79392131 GAGAGGAAAGAGAAGAAGAGAGG + Intergenic
1141002611 16:80322547-80322569 CAGAAAGTATAGAAGTATAGTGG + Intergenic
1141014122 16:80431855-80431877 AAGAGAAAAGAGAGGTAAGGTGG - Intergenic
1141289762 16:82706815-82706837 AAAATAAAAAAGAAGTATAGAGG + Intronic
1141708127 16:85680838-85680860 CAGAGAAAAGAGCTGTAGAGAGG + Intronic
1141710718 16:85697444-85697466 CAGACAAAAAATAAGAATAGGGG + Intronic
1203072790 16_KI270728v1_random:1095543-1095565 TAGAGAAAAGACAACTATATAGG + Intergenic
1142862596 17:2771985-2772007 CAAAAAAAAGAGAACTATTGTGG - Intergenic
1143228913 17:5334228-5334250 CAAAAAAAAGAGAAGGAAAGGGG - Intronic
1143425087 17:6829434-6829456 AAGAGAAAAGGAAAGTATATGGG - Intronic
1143995034 17:10998866-10998888 CAGAGAAACCAGAAATCTAGAGG + Intergenic
1144293546 17:13851299-13851321 CAGATAAAAGAGATCTTTAGAGG - Intergenic
1145691502 17:26745689-26745711 TAGAGAAAAGACAAATATATAGG - Intergenic
1145860161 17:28203061-28203083 CAGAGAAAAGAAAGCTATGGGGG + Intergenic
1146636120 17:34506468-34506490 CAGAGAAAAGGAAAGGAAAGAGG + Intergenic
1147929390 17:43968247-43968269 CAGAGAGAAGAAAGCTATAGGGG - Intronic
1147966202 17:44195524-44195546 CAGAGAAAAGAGAAGGACAGGGG + Intronic
1148384425 17:47223795-47223817 CAGAGAAATGAGTAGTATCTGGG + Intergenic
1148763543 17:50022151-50022173 CAGAGAAGAGAAAAGCACAGAGG - Intergenic
1148904936 17:50905855-50905877 ATGAGAAAACAGAAGTGTAGCGG - Intergenic
1148907648 17:50921361-50921383 CAGAGAAAGCAGAAGTGTGGAGG - Intergenic
1148971326 17:51485110-51485132 GAGAGAAAAAAGTAATATAGGGG - Intergenic
1149750631 17:59142172-59142194 CAAAGAAAATAGAAGAATTGTGG - Intronic
1150502032 17:65660286-65660308 GAGAGAAAAGAGAAGGAGGGAGG - Intronic
1150539153 17:66078204-66078226 CACAGAATAGAGCAGAATAGAGG - Intronic
1150562853 17:66309809-66309831 CAGAGAAAGGAGAAGAAGACAGG + Intronic
1150563213 17:66313070-66313092 CAGAGGAAACAGAAGTAGAGAGG - Intronic
1150657197 17:67046993-67047015 CAGAGAAAAGAGAGGGAAAAAGG - Intronic
1150911134 17:69388695-69388717 CATAGAAATCAGAAGTATAATGG - Intergenic
1151489711 17:74425518-74425540 AAGAGATAAGAGAAGTGTACTGG + Intronic
1203183026 17_KI270729v1_random:83241-83263 TAGAGAAAAGACAAATATATAGG - Intergenic
1203214678 17_KI270730v1_random:111534-111556 CAGAGAAAAGACAAATATATAGG - Intergenic
1152984561 18:310026-310048 CAGATAAAAGACAAGTGCAGTGG + Intergenic
1153198322 18:2624859-2624881 AAGAGAAAATAGAAGTATGTAGG + Intergenic
1153402495 18:4696093-4696115 AAGTGAGAAGAGAAGTTTAGAGG + Intergenic
1153752664 18:8249203-8249225 TAGAGAAAAGAGAAGCAGAGGGG - Intronic
1154478461 18:14791601-14791623 CAGAAAAAAGAGAAGTGAAACGG + Intronic
1155074451 18:22342382-22342404 CAGAGAGAGGAGAAGCAGAGAGG + Intergenic
1155398923 18:25416904-25416926 CACATAAAAGAGAAAAATAGAGG - Intergenic
1156109031 18:33700954-33700976 CAGAGAGAAGAGCACGATAGGGG + Intronic
1156286267 18:35699156-35699178 CAGAGTAGAGAGAATTAGAGGGG - Intronic
1156930886 18:42641875-42641897 TAGATAAAAGAGAAGGACAGGGG + Intergenic
1156972032 18:43168226-43168248 TTGAGAAAAGAGAAGTAAACAGG + Intergenic
1159972846 18:74675166-74675188 CAGAGAAAGCATAAGTATAAAGG - Intronic
1161139298 19:2638363-2638385 AAGAGAAAAGAAAAGAAAAGGGG + Intronic
1161267394 19:3370621-3370643 GAGAGAAGAGAGAAGGAGAGAGG - Intronic
1161817260 19:6507070-6507092 AAAAGAAAAAAGAAGCATAGGGG - Intergenic
1163478059 19:17538626-17538648 GAGAGAAAAGAAAAGAAAAGAGG + Intronic
1164367480 19:27601678-27601700 AAGCGAGAAGAGAAGTTTAGAGG - Intergenic
1166240407 19:41487785-41487807 AAGTGAGAAGAGAAGTTTAGAGG + Intergenic
1202681497 1_KI270712v1_random:8543-8565 TAGAGAAAAGACAAATATATAGG - Intergenic
925251239 2:2440660-2440682 CAAAGAACAGACAAGTTTAGAGG + Intergenic
925273317 2:2630833-2630855 CAGAGAAAAGGGAGGTACAGGGG - Intergenic
925372465 2:3356758-3356780 CACAGAAAAGAGAATCAGAGAGG + Intronic
925827614 2:7864873-7864895 AGGAGAAAAGAGAAATAAAGCGG + Intergenic
925970393 2:9102755-9102777 CAAAGAACAGAGAAGTTTGGAGG + Intergenic
926485685 2:13454474-13454496 TAGTGAAAAGACAAATATAGAGG + Intergenic
926758183 2:16252596-16252618 CAGAGAAATGAGAACTATTTGGG - Intergenic
927236835 2:20882437-20882459 AAGAGAAAAGGGAAGGATAAGGG - Intergenic
927291885 2:21412762-21412784 CAGAGTAAAGAAAAGTATCATGG + Intergenic
928963823 2:36957200-36957222 AAGACAAAACAGAAGTATATTGG + Intronic
929551062 2:42892462-42892484 TAGAGAAAAGAGTATTATAAAGG + Intergenic
929759291 2:44793047-44793069 GAAAGAAAAAAGAAGTAAAGGGG + Intergenic
930422485 2:51170549-51170571 CAGATAAAAGAGACTGATAGAGG + Intergenic
930590572 2:53321973-53321995 CAGAGTAAAGAGAAGAAGTGTGG - Intergenic
930740612 2:54828997-54829019 GAGAGAAAAGACAACTATGGAGG - Intronic
930882803 2:56291453-56291475 CAGAGAAAATAGCAGTGTGGGGG + Intronic
930975547 2:57455173-57455195 CAGAGAAAATGGAAGGAGAGAGG - Intergenic
931409472 2:62015208-62015230 CAGAGAAAAAAGTAGAAAAGAGG - Intronic
931653846 2:64492086-64492108 CAGAGAGAAGAAAAATATATTGG + Intergenic
931862965 2:66376342-66376364 CAGAAAAAATAGCAGTATGGAGG - Intergenic
931908439 2:66868512-66868534 GAGAGAAAAGAGATGGAGAGTGG + Intergenic
932053314 2:68419939-68419961 CAGAGAAAAGAGAGCTCCAGAGG - Intergenic
932289779 2:70567048-70567070 CAGAGAAACAAGAACAATAGGGG - Intergenic
932375998 2:71236284-71236306 CTAAGAAAAGAGAAGAATGGCGG + Intergenic
932900230 2:75689810-75689832 CAGAGAAAAGAGTCTTACAGAGG + Intronic
933624371 2:84582252-84582274 CAGAGATGAGAGAAGGAGAGAGG - Intronic
934302592 2:91788837-91788859 TAGAGAAAAGACAAATATATAGG - Intergenic
934330667 2:92063932-92063954 TAGAGAAAAGACAAATATATAGG + Intergenic
934879227 2:97959008-97959030 CAGAGAAAAGAAGAGGACAGAGG + Intronic
935598779 2:104900981-104901003 CACAGAAAACAGAGGTAAAGTGG - Intergenic
936175454 2:110216163-110216185 CAGAACAAAGAGAAGCTTAGAGG - Intergenic
936375038 2:111933465-111933487 CAGAGAACATAGATGTATATTGG + Intronic
936392209 2:112085649-112085671 TGGAGAAAAGAGAACTCTAGAGG + Intronic
937677759 2:124610366-124610388 CAGTGAAATGAGAATAATAGTGG + Intronic
937705682 2:124918181-124918203 CTGAGAAAAGGGAAGGAGAGGGG - Intergenic
937866875 2:126759121-126759143 ATGGGAACAGAGAAGTATAGGGG + Intergenic
938980709 2:136523746-136523768 CAGAGGAAAGGGAAGCATATTGG + Intergenic
939011590 2:136853326-136853348 GAGAGATAAGAGAAATATGGAGG - Intronic
939069800 2:137525486-137525508 AAGAGAAGAGAGAATTATAGTGG - Intronic
939413857 2:141866817-141866839 GAGAGAAAATAGAAGGAGAGAGG + Intronic
939756536 2:146119273-146119295 CAGAAGAAAGAGAAGTTTAGTGG + Intergenic
940277760 2:151957229-151957251 CAAAGAAAAAAAAAGTAGAGTGG + Intronic
940495662 2:154424782-154424804 CTCAGAAAAGACAAGTATGGTGG - Intronic
940945597 2:159615123-159615145 CAGACAAAAGATAAATACAGAGG + Intronic
941133944 2:161689936-161689958 CAGAGAACAGAAAAGTTTTGAGG - Intronic
941469068 2:165862067-165862089 CAGAAAAAAAAGAAGTTTAGTGG - Intronic
941920829 2:170849254-170849276 CAGAGAAAGGAGAGGAAGAGGGG - Intronic
941997129 2:171611393-171611415 AAGAGAAGAGAGAAGTGAAGTGG - Intergenic
942238547 2:173936871-173936893 TAGAGAAGAGAGAAGTTTAATGG - Intronic
942286978 2:174429176-174429198 AGGAGAGAAGAGGAGTATAGGGG - Exonic
942773951 2:179558381-179558403 GAGGGAAAAGAAAAGAATAGTGG + Intronic
942919248 2:181351259-181351281 GGGAGAAAAGAGAAGTGTGGAGG - Intergenic
943227965 2:185205658-185205680 CAGACAAAAGAGATGTGCAGGGG - Intergenic
943746878 2:191471421-191471443 AAGAGAAAAGAAAAATATTGAGG - Intergenic
943976915 2:194493655-194493677 CAGAGAAAAGAGAAGGAAGCTGG + Intergenic
944085129 2:195836973-195836995 GAGAGAAAAGAGATGGAGAGAGG - Intronic
944171268 2:196781161-196781183 CAGAAAAACCTGAAGTATAGAGG + Intronic
944181856 2:196904432-196904454 CATAGACAAGAAAAGTCTAGAGG + Intronic
945004639 2:205391220-205391242 TAGAGAAAAGGGAAGGAAAGAGG + Intronic
945455657 2:210049301-210049323 GAGAGGAAAGAGAAGTGTGGTGG - Intronic
945492158 2:210468879-210468901 AAAAGAAAACAGAAGTATAGTGG - Intronic
945809264 2:214528483-214528505 CAGAGAAAAGAAAAGTTAAGAGG - Intronic
945868193 2:215200114-215200136 CAGAAAAAACAGAAGTTTTGAGG + Intergenic
945986587 2:216359353-216359375 CAGAGAAAAGAGAAAAGAAGAGG - Intronic
946538230 2:220655418-220655440 CAGAGAAAAGAGAATAATTCTGG + Intergenic
947056375 2:226108664-226108686 AAGTGAGAAGAGAAGTTTAGAGG + Intergenic
947074677 2:226329571-226329593 CAGAGAGAAGAGCATTACAGAGG - Intergenic
947212308 2:227719179-227719201 AAGAGAAAAGAAAAGAAAAGAGG - Intergenic
947809812 2:232997282-232997304 CAGAGAAAAGAGAATTCTCACGG - Intronic
948569757 2:238910357-238910379 CGGAGAAAGGAAAAGAATAGCGG - Exonic
948995444 2:241576038-241576060 CAAAGAAAAGAGAACTGCAGTGG - Intergenic
1168936867 20:1673281-1673303 AAGATTAAAGAGAGGTATAGAGG - Intergenic
1169036392 20:2455910-2455932 CAGAGGAAAGAAAAGGAAAGGGG + Intergenic
1169306969 20:4500526-4500548 AAGCAAGAAGAGAAGTATAGAGG - Intergenic
1170738645 20:19033177-19033199 TAGATAAAAGAGCAGTACAGAGG - Intergenic
1171293465 20:23995751-23995773 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1171352428 20:24513552-24513574 AAGCGAGAAGAGAAGTTTAGAGG + Intronic
1172452586 20:35038028-35038050 CAGAGAAAAAAGCAGAATGGTGG + Intronic
1172832647 20:37849077-37849099 CAGAGATATGAGAGGTAAAGCGG - Intronic
1173118576 20:40269552-40269574 CAGAGCAAAGAGCAGGACAGGGG - Intergenic
1173409449 20:42796844-42796866 CAGAGAGAAGAGATGTATCTTGG - Intronic
1174881331 20:54282450-54282472 CAGAGTAAACAGAGGTAAAGAGG - Intergenic
1175516091 20:59571281-59571303 CAGAGAAGTGAGAAGCATCGGGG + Intergenic
1175742258 20:61427984-61428006 CAGAGAAAAGAGAACTACTGAGG + Intronic
1176245717 20:64095522-64095544 CAGAGAAGAGAGAACTGAAGGGG + Intronic
1177253158 21:18623237-18623259 CAGAGAGAAGATAACTAAAGAGG - Intergenic
1177503684 21:21993483-21993505 CAGAGAAAACAGAATTATACAGG - Intergenic
1177654982 21:24005054-24005076 TAAAGAAAAGAGAGGTTTAGTGG + Intergenic
1178007971 21:28244554-28244576 CAGAGAAAAGAGAATCAGATTGG + Intergenic
1178982554 21:37277152-37277174 CACAGAAAAGAGAAATACAATGG + Intergenic
1179222296 21:39419158-39419180 CAGAGACAGGAGAAGAATAGTGG - Intronic
1180236407 21:46462074-46462096 CAGAGAACAGAGTAGTAGAGTGG + Intronic
1180254231 21:46612344-46612366 CAGAGCAAAGAAAATTATAATGG - Intergenic
1180524611 22:16244825-16244847 TAGAGAAAAGACAAATATATAGG - Intergenic
1180623849 22:17180809-17180831 GAGAGAGAAGAGAAATAAAGAGG + Exonic
1180824521 22:18853467-18853489 CAAAGAAAACAGAAGCATGGAGG - Intronic
1181014880 22:20063170-20063192 AAGAGAAAAGAGAAGAGAAGAGG + Intronic
1181124943 22:20696622-20696644 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181188214 22:21121081-21121103 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1181210982 22:21289412-21289434 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181398518 22:22637476-22637498 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1181650897 22:24258584-24258606 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181706484 22:24652155-24652177 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1182180098 22:28338553-28338575 AAGCGAGAAGAGAAGTTTAGAGG - Intronic
1182309737 22:29396074-29396096 AAGAGAAAAGAGAAGAGAAGAGG + Intronic
1184641119 22:45870798-45870820 CAGAGAAAAGAGAGTTATGCAGG + Intergenic
1203215964 22_KI270731v1_random:6018-6040 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1203236848 22_KI270732v1_random:11725-11747 TAGAGAAAAGACAAATATATAGG - Intergenic
1203239170 22_KI270732v1_random:38858-38880 AAGAGAAAAGAGATGAATGGTGG + Intergenic
1203274659 22_KI270734v1_random:79372-79394 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1203290907 22_KI270735v1_random:38187-38209 TAGAGAAAAGACAAATATATAGG + Intergenic
1203323753 22_KI270737v1_random:96015-96037 TAGAGAAAAGACAAATATATAGG + Intergenic
949140335 3:625591-625613 CAAAGAAAAGAAATGTTTAGAGG - Intergenic
949166059 3:942477-942499 CACAAAAAAGAGAAATATACAGG + Intergenic
949843512 3:8347112-8347134 TAGAGAAAAGAAAAGTATTGTGG + Intergenic
950324047 3:12088397-12088419 AAGACAAAAGATAAGTATTGGGG + Intronic
950922011 3:16704295-16704317 CAGAGAAATGAAAAATATATAGG + Intergenic
951291741 3:20879087-20879109 CAGATAAAAGTGAATAATAGTGG - Intergenic
951355176 3:21657912-21657934 CAGAGAAGAGAGCACTATACAGG + Intronic
951698123 3:25467140-25467162 CAGAGAAATTAGAAGTATCCAGG + Intronic
952013476 3:28929862-28929884 CAGAGAAAAGAGAAATTGAGTGG - Intergenic
952234553 3:31465258-31465280 CAGAGAAAAGAAAAGAACAAAGG + Intergenic
953138595 3:40205880-40205902 CAGAGAAAGGAGCAGTAAGGAGG - Intronic
953536868 3:43783279-43783301 GAGAGAAAAGAGAGGTATGGGGG - Intergenic
953685470 3:45074804-45074826 GAGAGAAAAGAGAAGAATCTGGG + Intergenic
953964151 3:47289787-47289809 AAGAAAAAAGAGAATTGTAGAGG + Intronic
954989953 3:54831988-54832010 CAGAGAAGAGAGAGATAAAGAGG - Intronic
955015842 3:55067992-55068014 GAGAGAGAAGAGGAGAATAGAGG - Intronic
955148014 3:56339338-56339360 CAGGGGAAAGAGAAGTGTAAGGG + Intronic
955429396 3:58826982-58827004 CAGAGTACAGAGAATTTTAGGGG + Intronic
955457625 3:59141338-59141360 CAGGGAAAAGACCAATATAGAGG + Intergenic
956141026 3:66147148-66147170 AAGAGAAAAGAAAAGAAAAGAGG - Intronic
956504054 3:69918796-69918818 CAGAGAAAAGAAAATAAGAGAGG - Intronic
956505431 3:69933275-69933297 TAGAGAGAATAGAAGAATAGTGG + Intronic
957150272 3:76477552-76477574 CAGAGAAACTAGAGGTATAATGG - Intronic
957158257 3:76574268-76574290 TAGAAAATAGAAAAGTATAGAGG + Intronic
957618083 3:82558327-82558349 CAGAGATAAGAGAACTACATAGG + Intergenic
957906435 3:86562120-86562142 TAGAGAAACTAGAAGTTTAGAGG + Intergenic
957952545 3:87144824-87144846 CACAGCACAGAGAAGCATAGCGG + Intergenic
957962050 3:87268850-87268872 CAGAGGAGAGAGAAGAACAGAGG + Intronic
958523547 3:95223169-95223191 CAGAGAAGAGAGAAAAATAAAGG - Intergenic
958779630 3:98524645-98524667 CAGGCAAAAGAGAAGTTTAAAGG + Intronic
959364665 3:105442204-105442226 GGGAGAAAAAAGAAGTATAAAGG - Intronic
960303328 3:116031165-116031187 AATAGAAAATAGAAGTATAAAGG + Intronic
962436278 3:135370114-135370136 CAGGGAAGGGAGAAGTATAGAGG - Intergenic
962473905 3:135739240-135739262 CAGAGAACAGAAAGGTGTAGTGG + Intergenic
962623306 3:137199881-137199903 GAGAGAAAAGAGAAAAATTGAGG - Intergenic
962907495 3:139817944-139817966 AAGAGAGAAGAGAAGTTTAGAGG - Intergenic
962932443 3:140050750-140050772 CACAGAAGAGAGAAGGGTAGTGG + Intronic
965576794 3:170225554-170225576 AAAAGAAAAGAAAAGTGTAGAGG - Intronic
965878052 3:173352501-173352523 CAGAGAAAAGAGAGGAAAAAAGG - Intergenic
966016546 3:175146284-175146306 CAGAAAAAAGAGAAGGACTGTGG + Intronic
966026881 3:175294979-175295001 ATGAGAAAACAGAAGCATAGAGG - Intronic
966052029 3:175630232-175630254 CAGAGAAATGAAATATATAGAGG + Intronic
966222483 3:177564669-177564691 CACAGAAAAGAGCAGTTTTGTGG + Intergenic
967355410 3:188564439-188564461 TAAATAAAAGAGAAGGATAGGGG - Intronic
967632757 3:191765529-191765551 CAGACAAAAGAAATGTATAAAGG - Intergenic
971070517 4:23086079-23086101 CAGAGGCACGAGAAGTAGAGGGG + Intergenic
971120892 4:23703815-23703837 AAGAGAAATGAGAAGTACATGGG + Intergenic
971770626 4:30891610-30891632 CAGCTAAAAGAGAAAAATAGTGG - Intronic
971828199 4:31655494-31655516 CAGAGGAAAGACAAGTATTCAGG - Intergenic
972065005 4:34931123-34931145 TAGAGAAAAGAGTAGAATGGTGG + Intergenic
972069592 4:34999979-35000001 CAGAGAAGATAGAAATAGAGGGG - Intergenic
972400325 4:38695928-38695950 AAGAGAAAAGGGAAGGAAAGTGG + Intronic
972400857 4:38702309-38702331 CAAACAAAAAAGAAATATAGTGG - Intergenic
972416828 4:38848706-38848728 AAGTGAGAAGAGAAGTTTAGAGG + Intronic
973281753 4:48365476-48365498 TAGAAAACAGAAAAGTATAGGGG - Intronic
974388463 4:61233375-61233397 GAGAAAAAAGAGTAGTATAATGG - Intronic
974414000 4:61580937-61580959 AAGAGAAAAGGGAAGAATACTGG + Intronic
974643445 4:64664024-64664046 AAGTGAGAAGAGAAGTTTAGAGG + Intergenic
974903445 4:68030296-68030318 AAGAGAAAGGAAAAGTAGAGTGG - Intergenic
974920458 4:68232906-68232928 CAGAGTAAAGAGAATTATCATGG - Intronic
975193133 4:71489936-71489958 CAGGGAAAAGAGCAGGAGAGAGG + Intronic
975457157 4:74606050-74606072 CAGATAAACGACAAGAATAGAGG - Intergenic
975547238 4:75572148-75572170 CAGAAAAAAAAGAACTATTGAGG + Intergenic
976401775 4:84615237-84615259 AAGACAGGAGAGAAGTATAGGGG - Intronic
976876529 4:89860132-89860154 GAGAGAAAAGAGGACTATATTGG + Intergenic
976964579 4:91020806-91020828 CAGAGAAAACAGAAGTACCTTGG - Intronic
977096713 4:92754804-92754826 AAGAGAAAAGAGAATTTTATTGG + Intronic
977125125 4:93155756-93155778 CAGGCAATAGAGAAGTGTAGGGG + Intronic
977475332 4:97500128-97500150 CAGAGAAAAGATGATGATAGTGG + Intronic
977700377 4:100015310-100015332 CAAATGAAAGAGAAGGATAGAGG - Intergenic
978030924 4:103939176-103939198 GAGAGAAAAGTAAAGTAAAGGGG + Intergenic
978223152 4:106302247-106302269 CAGAGTAAACAGCAATATAGTGG + Intronic
979605098 4:122630004-122630026 AAGAAAAAAGTGAAGTAAAGAGG - Intergenic
979607913 4:122658349-122658371 AAGAAAAAAGAAAAATATAGAGG + Intergenic
979750559 4:124274079-124274101 AAGCGAGAAGAGAAGTTTAGAGG - Intergenic
979935001 4:126682262-126682284 CAGAGAAAACTGATGTATTGAGG + Intergenic
980161347 4:129167377-129167399 CAGAGAAAAGACATATTTAGAGG - Intergenic
980410498 4:132412228-132412250 AAGAGAAAAGATCAGTATAATGG + Intergenic
981741703 4:148009115-148009137 GAGAAAAAAGAGAAGTATTGAGG - Intronic
982995544 4:162339284-162339306 TAGTGAAATGAGAAGTATAGTGG - Intergenic
984218081 4:176939622-176939644 CAGAGAGAAGAGCAGTATGCTGG - Intergenic
984353456 4:178625808-178625830 CAAAGAAGAGAGAAGTATCAGGG - Intergenic
987249954 5:16089871-16089893 GTGAGAAAACAGAAGTATGGAGG + Intronic
987568163 5:19620526-19620548 GAGAGAAAAGAGAAATAAAGAGG + Intronic
988185595 5:27857548-27857570 CTGAGAATAGAGAAGAATATGGG + Intergenic
989235786 5:39147258-39147280 AAAAGAAAAGAAAAGTATAGAGG - Intronic
989410484 5:41114153-41114175 CAGAGAAAACAGAAGTATACAGG - Intergenic
990219770 5:53575080-53575102 GAGAGAAAAGAGAAGAAAATGGG + Intronic
990830504 5:59951928-59951950 CAGAGAAAGGAGAAGTGAGGAGG - Intronic
990878842 5:60517911-60517933 GAGAGAAGAGAGAAGAAGAGAGG + Intronic
991501903 5:67285447-67285469 CAGATAAAAGACCAGTATATGGG + Intergenic
992298256 5:75349322-75349344 AATAGAAAACAGAATTATAGAGG - Intronic
993148167 5:84123450-84123472 GATAGAAAAGAGAAATATACAGG - Intronic
993456555 5:88133657-88133679 GAGAGAAAAGAGAAGAGGAGAGG + Intergenic
993884099 5:93396453-93396475 AAGGGGAAAGAGAAGTAAAGAGG - Intergenic
994662164 5:102667159-102667181 CAGAGGAAAGATTTGTATAGGGG - Intergenic
996052206 5:118947547-118947569 CAGAGAGAAGAGAAGGGGAGAGG - Intronic
996475674 5:123917666-123917688 GAGAGGAAAGAGAAATAAAGAGG + Intergenic
996501505 5:124222173-124222195 AAAAAAAAAGAGAAGAATAGAGG - Intergenic
996644970 5:125802989-125803011 CAGAAAAAACAAAAGCATAGTGG - Intergenic
996937044 5:128961422-128961444 AAGTGACAAGAGAAGTTTAGAGG - Intronic
997235016 5:132267685-132267707 CAGAGAAAAGAAAGGTCCAGGGG + Intronic
997391388 5:133520092-133520114 CTGAGAAAGGAGAAGAAAAGAGG - Intronic
997605308 5:135171127-135171149 CAGAGAAGAGAGTAGAACAGTGG - Intronic
998382197 5:141733752-141733774 GAGAGAAATGAAAAGTTTAGTGG + Intergenic
999609983 5:153358725-153358747 CAAAGAAAAGAGAGGAATTGCGG - Intergenic
1000332556 5:160217387-160217409 CAGAGAAAAGACAAGAAGAAGGG + Intronic
1000408355 5:160912652-160912674 GAGAAAAAAGAGAAGAAAAGAGG + Intergenic
1000435233 5:161199803-161199825 AAGAGAAAAGAAAAGCACAGTGG + Intergenic
1001178278 5:169493617-169493639 CACAGAAAAAAGAACTTTAGAGG - Intergenic
1001590926 5:172864593-172864615 CAGACAGAAGAGGAATATAGGGG + Intronic
1001591085 5:172865923-172865945 CAGACAGAAGAGGAATATAGGGG - Intronic
1002078329 5:176723080-176723102 CAGTGAAAAGAGCAGCAAAGAGG + Intergenic
1002490417 5:179572284-179572306 CACAGAAAAGTGAAGTCCAGAGG - Intronic
1002885716 6:1292164-1292186 CAGAGTTAAGAGCAGAATAGGGG - Intergenic
1002940926 6:1715133-1715155 TAGTGAAAAGACATGTATAGAGG + Intronic
1003250290 6:4422309-4422331 TAGAGAAAAGGAAAGTATATAGG + Intergenic
1003295280 6:4820802-4820824 CTGTGAAAATAGAAATATAGTGG + Intronic
1003467353 6:6393390-6393412 CTGAGAAAATAGAATTATTGTGG - Intergenic
1003600646 6:7513971-7513993 CAGAAAATAGAAAAGTATAAAGG + Intergenic
1003949552 6:11105103-11105125 CAGAGAATGGACAAGCATAGAGG - Exonic
1004094533 6:12539437-12539459 CAAAGAAATGATAAGAATAGGGG - Intergenic
1004554196 6:16679467-16679489 CAAAGAGAAGGGAAATATAGTGG + Intronic
1004691622 6:17997131-17997153 AAGCGAAAAGAGAAGTACATTGG + Intergenic
1004797141 6:19099369-19099391 CAGAGTAAAGAGAACTCCAGGGG - Intergenic
1004801440 6:19152935-19152957 AGGAGAAAAGAGAATTATTGAGG - Intergenic
1004893164 6:20121443-20121465 CAAAGAAAAGGGAAGCATGGGGG + Intronic
1005023115 6:21436546-21436568 CAGGGAGAAGAGAAGAATTGTGG - Intergenic
1005091241 6:22059109-22059131 CAGAGAAAAGGGAAGAAAACAGG - Intergenic
1005436845 6:25821228-25821250 GAGAGAAAAAAGAAGAATGGAGG - Intronic
1006191783 6:32213890-32213912 AAGAGGAAAGAGAAGGAGAGCGG - Intronic
1007906412 6:45465941-45465963 CATAGAAAAAAGAAGTAGGGCGG - Intronic
1008208484 6:48691546-48691568 CAGAGAAAAGAAACTAATAGAGG + Intergenic
1008265886 6:49425790-49425812 CAGAGAAAAAAGTAGAATGGTGG - Intergenic
1009282565 6:61770613-61770635 AAGTGAGAAGAGAAGTTTAGGGG + Intronic
1010151065 6:72732757-72732779 CAAAGAAAAGAGTACTAAAGAGG + Intronic
1010928393 6:81770981-81771003 CAGGGAAATGAGAAGGAAAGGGG + Intergenic
1011577977 6:88825851-88825873 CAGAGTGAGGAGAAGGATAGTGG - Intronic
1011955118 6:93016613-93016635 CAGAGAGTAGAGAAGTCCAGTGG - Intergenic
1012931957 6:105326785-105326807 CAGAGAAAAGAGAAAAATGGAGG + Intronic
1013033367 6:106357902-106357924 AAGGGAAAAGAGAAGAAAAGGGG - Intergenic
1013066331 6:106687593-106687615 TAGAGAAAACAGAAATATTGGGG - Intergenic
1013169190 6:107620769-107620791 CACAGAAAAAAGAAATATGGTGG - Intronic
1013452469 6:110297997-110298019 CAGAGAAAAGGGAGGAAGAGGGG + Intronic
1013604551 6:111735636-111735658 GGGAGAAAAGAGAAGCATGGGGG + Intronic
1014429742 6:121353948-121353970 CAGAGAGAAGAGAAGCTTTGGGG + Intergenic
1014450794 6:121579164-121579186 CAAAGAAATGTGAAGAATAGAGG - Intergenic
1014476655 6:121881668-121881690 TAGAGAGAAGCAAAGTATAGAGG - Intergenic
1014963257 6:127713798-127713820 GTGAGAAAGGAGAAGTAGAGAGG + Intronic
1015134168 6:129848926-129848948 CAGAGATAAGAAAAGTTTAATGG - Intronic
1015548525 6:134387425-134387447 AAGAGAAAAGAGAACAATATGGG - Intergenic
1016513096 6:144864911-144864933 CAGAGAAGAGAGAAAGAGAGAGG - Intergenic
1016578911 6:145605462-145605484 CAGACAAGAGAGAAGGATAATGG - Intronic
1017115351 6:150971061-150971083 CAAAGTAAAGAGTAGAATAGTGG + Intronic
1017421509 6:154277726-154277748 CAGGGAAAGGTGAAGTAAAGTGG - Intronic
1017607117 6:156146367-156146389 CAGAGAAAAGAGGAAAAAAGAGG - Intergenic
1018449450 6:163893484-163893506 CAGAGAGAAGAAAAAAATAGAGG + Intergenic
1018582732 6:165321468-165321490 CAGAGAAAAGAGAAGGCAACTGG + Intergenic
1019024641 6:168948808-168948830 CATTCAAAAGAGAAGTATGGAGG - Intergenic
1020603021 7:10300342-10300364 CAGAGAAAAGAGAGTGAGAGAGG - Intergenic
1021381502 7:19972745-19972767 AAGGGGAAAGAGAAGTATAATGG + Intergenic
1021784881 7:24141898-24141920 CAGATAAATGAGAAGAACAGAGG + Intergenic
1023445232 7:40224737-40224759 CACAGGAAACAGTAGTATAGCGG - Intronic
1023473452 7:40550959-40550981 AAGAGAAAAGAGAAGAAAACAGG - Intronic
1023510953 7:40953166-40953188 AAGCGAGAAGAGAAGTTTAGAGG - Intergenic
1023556597 7:41429923-41429945 CCGAGAAAAGAGAAGCGTTGGGG + Intergenic
1023776800 7:43615775-43615797 CAGAGGGAAGAGAAGTATAGAGG - Intronic
1024369966 7:48570857-48570879 CAGAGGAATGAAAAATATAGAGG - Intronic
1025479956 7:60970458-60970480 TAGAGAAAAGACAAATATATAGG - Intergenic
1025488963 7:61087377-61087399 TAGAGAAAAGACAAATATATAGG + Intergenic
1025552004 7:62261895-62261917 TAGAGAAAAGACAAATATATAGG + Intergenic
1025557810 7:62330998-62331020 TAGAGAAAAGACAAATATATAGG + Intergenic
1026131836 7:67627380-67627402 TTGAGAAAACAGAAGTATGGAGG + Intergenic
1026298395 7:69076366-69076388 CAGAGAAAAGAAAAACACAGGGG + Intergenic
1027233460 7:76284767-76284789 AAGAGAAAAGAGAGGTTAAGGGG - Intronic
1028791069 7:94853586-94853608 CAGGGAGAAGAGAAGGATGGGGG - Intergenic
1028814311 7:95126988-95127010 AAGAGGAAAGAGAGGTAAAGAGG - Intronic
1029503873 7:100950370-100950392 CAGAGAAAAGAGAAGTATAGAGG - Intronic
1030196580 7:106859036-106859058 CAGAGAAGAAAGCAGTACAGAGG + Intergenic
1030377024 7:108764766-108764788 CAGGTAACACAGAAGTATAGTGG + Intergenic
1031060059 7:117040981-117041003 CAGAGAAAAGGAAAGCAAAGGGG - Intronic
1031250944 7:119379698-119379720 AAGAGAAAAGAGAAAGATTGTGG - Intergenic
1031303869 7:120099202-120099224 CAGAAAAAAGAAAAATATTGTGG - Intergenic
1033653278 7:143357842-143357864 CAGAGAAGGGAGAATTGTAGGGG + Intronic
1033716251 7:144005657-144005679 AAAAGAAAAGAGAAGTAATGAGG - Intergenic
1033954860 7:146834224-146834246 CAGACAAAAGAGGAATTTAGTGG - Intronic
1034210335 7:149357670-149357692 AAGAGAAGAGAGAAGGAGAGAGG - Intergenic
1034310522 7:150083786-150083808 GAGAGAAAACAGCAGTATGGAGG - Intergenic
1034700205 7:153088767-153088789 CAAAGAAAAGAGAAGATAAGGGG + Intergenic
1036134395 8:6146529-6146551 CACAAAAAAGAGAAGTAAAAGGG + Intergenic
1036786024 8:11687722-11687744 CAGAGAAAAGCCAAGAATACAGG + Intronic
1037188334 8:16091947-16091969 CAGGTAATAGAAAAGTATAGAGG - Intergenic
1037370778 8:18175399-18175421 CATAGAAACAAAAAGTATAGAGG - Intronic
1037640768 8:20740895-20740917 CAGAGTAGAGAGGAGAATAGTGG - Intergenic
1038615709 8:29092332-29092354 CAGAGAAAACAGAGGTTGAGAGG + Intronic
1039600690 8:38834537-38834559 GAGAGAAAAGAGAGGTTTTGTGG + Intronic
1040739447 8:50555185-50555207 CAGTTAAAACAGTAGTATAGGGG - Intronic
1040866450 8:52053158-52053180 CAGAGAAAATAGAATACTAGAGG - Intergenic
1042140717 8:65675692-65675714 GTGAGAAAACAGAAGCATAGAGG + Intronic
1042237899 8:66633300-66633322 CAGTGAACAGAGAAGAATATGGG + Exonic
1042338968 8:67658890-67658912 CAGACAAAAGAGAATGAGAGAGG - Intronic
1042449351 8:68926311-68926333 ATGAGAAAAATGAAGTATAGAGG + Intergenic
1043277196 8:78413550-78413572 AAGAGAACAGAGAAGAATGGGGG - Intergenic
1043411794 8:80004913-80004935 AAGTGAGAAGAGAAGTTTAGAGG + Intronic
1043911793 8:85872989-85873011 AAGTGAGAAGAGAAGTTTAGAGG - Intergenic
1044104128 8:88180511-88180533 CATAGAAAAGAAAATTATTGGGG + Intronic
1044376291 8:91475720-91475742 AAGAAAAAAGAAAAATATAGAGG + Intergenic
1044867377 8:96585520-96585542 AAGAGAAATGAGAAGGATGGGGG + Intronic
1045749812 8:105470133-105470155 CAGAGAAAGGAAGAGTAGAGAGG - Intronic
1046098952 8:109592653-109592675 CAGAGAAATGATAAGCAAAGAGG + Intronic
1048041150 8:130729851-130729873 CAGGGAAATGAGAAGCATAGAGG + Intergenic
1048158801 8:131992013-131992035 AAAAGAAAAGACAAGTATGGGGG - Intronic
1048321873 8:133406393-133406415 CAGAGAAAAGAGATGTTTTCTGG + Intergenic
1048409709 8:134159831-134159853 CACAGAAAACAGAAATATATAGG - Intergenic
1048802075 8:138203432-138203454 CAGAGATAAGAGAATTTGAGAGG - Intronic
1049397704 8:142409276-142409298 GAGTGAAAAGAGAAGGAGAGAGG + Intergenic
1050275682 9:3996316-3996338 CAGAGAAAACAGAAAAATATGGG + Intronic
1051023023 9:12568759-12568781 GAGAGAAATAAGAAGTAAAGAGG - Intergenic
1051040779 9:12808199-12808221 CAGAGAGAAGAAAAATATATCGG - Intronic
1051062807 9:13064676-13064698 CAGAGAAAATTTAAGTACAGAGG - Intergenic
1051613040 9:18980311-18980333 CATACAAATCAGAAGTATAGTGG + Intronic
1051933494 9:22414881-22414903 AAGAGAAAACAAAAGAATAGAGG - Intergenic
1052032064 9:23640032-23640054 CAGAGAAGGGAGAAGCATATAGG - Intergenic
1052963893 9:34324300-34324322 CAAAGAAGAGAGAAGTGGAGGGG - Intronic
1053165028 9:35838309-35838331 AAAAGAAAAGAGTAATATAGGGG - Intronic
1053375386 9:37601634-37601656 GTGGGAAAAGAGAAGAATAGAGG + Intronic
1053945289 9:43302089-43302111 TAGAGAAAAGACAAATATATAGG + Intergenic
1054827661 9:69589392-69589414 CAGAGAAAGAAGAATTAGAGTGG - Intronic
1054922472 9:70555806-70555828 CAGAGGAAAGGGCAGAATAGAGG - Intronic
1054993655 9:71359615-71359637 CAGGGAAAAGATAAATATATGGG - Intronic
1055197686 9:73616460-73616482 CCCAGAAAAGAAAAGGATAGGGG + Intergenic
1055257806 9:74393033-74393055 CATAGAAAAGGGAGGTGTAGAGG + Intergenic
1055517390 9:77047126-77047148 CAGGGAAAGGAAAAGTATGGAGG - Intergenic
1055786215 9:79871740-79871762 GAGAGAAAATGGTAGTATAGTGG + Intergenic
1055901024 9:81238019-81238041 TAGAGATAAGAGAAATACAGAGG + Intergenic
1056085534 9:83145703-83145725 GAGAGAAAATAGAAATAAAGAGG + Intergenic
1056850511 9:90080012-90080034 CAGAGGAAGGAGGAGAATAGGGG - Intergenic
1057558323 9:96107349-96107371 CAGAGGAGGGAGAAGAATAGGGG + Exonic
1057803869 9:98206988-98207010 CAAACAAATGAGAAGTACAGGGG + Intronic
1058018630 9:100066756-100066778 CGCAGATAAGAGAAGTATAAAGG + Intronic
1058475402 9:105327825-105327847 CAGGGAAAACAGGATTATAGAGG - Intronic
1058503675 9:105647768-105647790 CAGAGAATAAAGAAGGAAAGGGG + Intergenic
1058557561 9:106186338-106186360 AAGCGAGAAGAGAAGTTTAGAGG - Intergenic
1059348408 9:113647819-113647841 CAGAGAAAGGAGAAAAATTGGGG + Intergenic
1059489337 9:114654377-114654399 CTCAGAAAAGAGAAGAATAAAGG - Intergenic
1059549743 9:115217015-115217037 CACAGAAAGGAGAAGTTGAGAGG + Intronic
1059865162 9:118505959-118505981 AAGTGAGAAGAGAAGTTTAGAGG + Intergenic
1060326783 9:122624159-122624181 CAGAGAAGAGAAGAGAATAGAGG + Intergenic
1061074708 9:128334013-128334035 CTGAGAAGAGAGAAGTGGAGGGG + Exonic
1062304159 9:135893186-135893208 AAGAGAGAAGAGAAGGAGAGAGG + Intronic
1203580876 Un_KI270746v1:3058-3080 TAGAGAAAAGACAAATATATAGG - Intergenic
1203588424 Un_KI270747v1:30667-30689 TAGAGAAAAGACAAATATATAGG + Intergenic
1186752381 X:12634787-12634809 TAGAGAAAAGAAAACTATAGGGG - Intronic
1186789728 X:12985238-12985260 CAGAGAAAAGAAAGGAATTGAGG - Intergenic
1186826803 X:13348482-13348504 GAGAGAGAAAAGAAGTATAAGGG + Intergenic
1187206595 X:17187398-17187420 CTGAGAAAAGAGATCTAGAGCGG + Intergenic
1187463002 X:19504150-19504172 AAGAGAAAAGAGATGTATTTAGG + Intronic
1188128605 X:26401739-26401761 TAGAAAAAAGAGAGGTTTAGGGG - Intergenic
1188318276 X:28703664-28703686 CAGAAAAAAGAGTGGTACAGAGG - Intronic
1188918742 X:35945503-35945525 CAAAGAAAAAAGAAGTATTGGGG - Intronic
1189028560 X:37426430-37426452 TAGAGTAAAGAGAAGTAAAGAGG - Intronic
1189454375 X:41171853-41171875 CAAAGAAAAGAGATGTATCTGGG - Exonic
1189584354 X:42442822-42442844 CAGATAAAAGGGCAGTATGGTGG + Intergenic
1189700610 X:43714365-43714387 CAGAGGGGAGAAAAGTATAGTGG + Intronic
1190267625 X:48836843-48836865 CAGACAACAGAAAAGTATAAAGG - Intergenic
1190868470 X:54404930-54404952 CAAAGGAAAGAGAAGTATTAAGG - Intergenic
1191663726 X:63676689-63676711 CAGAGAAAGGAAAGGTACAGGGG - Intronic
1191687109 X:63903388-63903410 AAGAGACAAGGGAAGTTTAGAGG - Intergenic
1191885782 X:65886540-65886562 CAAAGAAAAGTGATGTAAAGGGG + Intergenic
1191935434 X:66422716-66422738 AAGTGACAAGAGAAGTTTAGAGG - Intergenic
1192004093 X:67191157-67191179 AAGTGAGAAGAGAAGTTTAGAGG - Intergenic
1192050042 X:67716469-67716491 CAGAGATAACAGAGATATAGAGG + Intronic
1192233234 X:69279953-69279975 CAGAGAAGAGGGAGGTATCGAGG - Intergenic
1192284965 X:69725876-69725898 GAGAGAAAGGAGATGTATTGAGG + Intronic
1192531936 X:71895587-71895609 AAGAGAAAAGAAAAGGAAAGAGG + Intergenic
1192617524 X:72643148-72643170 CAGAGAAAAGGGAAGGAGACTGG + Intronic
1193085271 X:77443314-77443336 CAAAGAAAACAGAAGGAGAGAGG + Intergenic
1193431888 X:81417635-81417657 CAAAGCAAGGAGAAGGATAGGGG - Intergenic
1193770764 X:85584575-85584597 AAGTGAGAAGAGAAGTTTAGAGG + Intergenic
1194297993 X:92150946-92150968 CAAACAAAACAGAAGTATAACGG - Intronic
1194663753 X:96655369-96655391 CAGAGAAAAGACACCTAGAGTGG + Intergenic
1195144375 X:101999020-101999042 CAGACAAAAAAGACATATAGAGG + Intergenic
1195234081 X:102879720-102879742 CAGAGAAGGGAGAAGAAGAGAGG - Intergenic
1195295925 X:103477110-103477132 AAAAGAAAAAAGTAGTATAGGGG - Intergenic
1195530563 X:105950481-105950503 TATAGAAAAGAGAAGTTTAATGG + Intronic
1196026725 X:111049098-111049120 AAGAGAAAAGAGCAGTGCAGAGG - Intronic
1196265798 X:113645008-113645030 CAGAGAAAAGAATAAGATAGTGG - Intergenic
1196310097 X:114153803-114153825 CAGAGAAAAGAGAGGGAGAATGG + Intergenic
1196402752 X:115333186-115333208 CAGAGAAATGAAAAGTAGAATGG - Intergenic
1196469697 X:116011516-116011538 TAGAGAAAAGAGGAGTAAAAAGG - Intergenic
1196666431 X:118321901-118321923 AAGAGAAAAGAAAAGAAAAGAGG + Intergenic
1197068348 X:122262388-122262410 CAGATAAGAGAGAAATATAAAGG - Intergenic
1197103938 X:122690614-122690636 CTCAGAAAATAGAAATATAGAGG + Intergenic
1197362148 X:125517960-125517982 CAGAAAACAGGGAAGAATAGTGG + Intergenic
1197649142 X:129045633-129045655 AAGAGAGAAGGGAAGTTTAGAGG + Intergenic
1198319240 X:135503438-135503460 CAGAAAAAAAAGATGTAAAGAGG - Intergenic
1198574523 X:137995617-137995639 CAGAAAAAAGAGCAGTTTTGAGG + Intergenic
1198670221 X:139072033-139072055 GAGAGAAAAGAGAAAAATAAAGG - Intronic
1199504929 X:148551187-148551209 AAGAGAAGAGAGTAGTGTAGGGG - Intronic
1199633956 X:149797449-149797471 CAGAGAAAATAGAAGAGAAGGGG - Intergenic
1200615602 Y:5375917-5375939 CAAACAAAACAGAAGTATAACGG - Intronic
1200917866 Y:8587152-8587174 AAAAGAAAAGACAAGTGTAGAGG - Intergenic
1201784716 Y:17762433-17762455 CTGAAAAAAGAGAAATACAGGGG - Intergenic
1201816836 Y:18143554-18143576 CTGAAAAAAGAGAAATACAGGGG + Intergenic
1202088931 Y:21168303-21168325 GAGAGAAAAAAGCAGTATATTGG + Intergenic
1202333501 Y:23780267-23780289 AAGTGAGAAGAGAAGTTTAGAGG - Intergenic
1202537268 Y:25889796-25889818 AAGTGAGAAGAGAAGTTTAGAGG + Intergenic