ID: 1029505411

View in Genome Browser
Species Human (GRCh38)
Location 7:100960883-100960905
Sequence CTGGAACCATAGAAGGTGCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 232}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029505411_1029505417 3 Left 1029505411 7:100960883-100960905 CCCAGCACCTTCTATGGTTCCAG 0: 1
1: 0
2: 0
3: 15
4: 232
Right 1029505417 7:100960909-100960931 TGAGTTTGCTGTGGAACAGGTGG 0: 1
1: 0
2: 4
3: 27
4: 323
1029505411_1029505418 10 Left 1029505411 7:100960883-100960905 CCCAGCACCTTCTATGGTTCCAG 0: 1
1: 0
2: 0
3: 15
4: 232
Right 1029505418 7:100960916-100960938 GCTGTGGAACAGGTGGATCTAGG 0: 1
1: 0
2: 0
3: 19
4: 196
1029505411_1029505416 0 Left 1029505411 7:100960883-100960905 CCCAGCACCTTCTATGGTTCCAG 0: 1
1: 0
2: 0
3: 15
4: 232
Right 1029505416 7:100960906-100960928 TTGTGAGTTTGCTGTGGAACAGG 0: 1
1: 0
2: 0
3: 17
4: 192
1029505411_1029505414 -6 Left 1029505411 7:100960883-100960905 CCCAGCACCTTCTATGGTTCCAG 0: 1
1: 0
2: 0
3: 15
4: 232
Right 1029505414 7:100960900-100960922 TTCCAGTTGTGAGTTTGCTGTGG 0: 1
1: 0
2: 0
3: 21
4: 371

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029505411 Original CRISPR CTGGAACCATAGAAGGTGCT GGG (reversed) Exonic
900029155 1:358409-358431 TCAGACCCATAGAAGGTGCTAGG + Intergenic
900035132 1:401493-401515 CAGGCACCATCGCAGGTGCTGGG + Intergenic
900056752 1:637246-637268 CAGGCACCATCGCAGGTGCTGGG + Intergenic
900498377 1:2987300-2987322 GTGGATCCAGAGAAGGTGCGGGG + Intergenic
901607012 1:10467114-10467136 ATGGAAGCTAAGAAGGTGCTGGG + Intronic
901983136 1:13052471-13052493 CTTGACCCATAGAAGGAGGTAGG + Intronic
901998953 1:13176447-13176469 CTTGACCCATAGAAGGAGGTAGG - Intergenic
902017439 1:13319578-13319600 CTTGACCCATAGAAGGAGGTAGG - Exonic
902227228 1:15004036-15004058 TTGGCACCGTGGAAGGTGCTGGG + Intronic
902977174 1:20097415-20097437 CTTGGACCATAGCAGATGCTTGG + Intergenic
906520853 1:46466247-46466269 CTGGACACACAGAAGGCGCTGGG + Intergenic
907497000 1:54851866-54851888 CTGGTCACATTGAAGGTGCTGGG - Exonic
907525008 1:55048947-55048969 CAGGCACCATATTAGGTGCTGGG + Intronic
914429643 1:147609256-147609278 TTGGAACTATAGAAGATGTTTGG + Intronic
916428910 1:164708942-164708964 CAGGTACCATGGTAGGTGCTGGG + Intronic
918012691 1:180602657-180602679 CTGGAACCAAGGCAGGTCCTGGG - Intergenic
919731270 1:200915052-200915074 CTGGAAGCAAAGAAGGCCCTAGG - Intronic
920199217 1:204249254-204249276 CTGGGTCCCTAGAAGCTGCTGGG - Exonic
922257664 1:223907049-223907071 CAGGCACCATCGTAGGTGCTGGG + Intergenic
922532646 1:226356214-226356236 CTGGAATCTTATAAAGTGCTAGG + Intergenic
924338858 1:243009828-243009850 CAGGCACCATCGTAGGTGCTGGG + Intergenic
924666529 1:246078879-246078901 CTGGAACCATGGTAGATACTTGG - Intronic
1063663122 10:8047283-8047305 CTGGAACCATAGGAGGTGGCAGG + Intergenic
1063856256 10:10257470-10257492 CTGGAAACATAGAAGTTGGAAGG - Intergenic
1064422195 10:15199893-15199915 CTGGAACCCTAGAAGATTGTGGG - Intergenic
1065150833 10:22821559-22821581 CTGGACACACAGAAAGTGCTTGG + Intergenic
1066094432 10:32058715-32058737 CAGGAACCAATGAAGGTGTTAGG - Intergenic
1067737114 10:48865566-48865588 CTGGTCCCATAGAATGTGTTGGG + Intronic
1068106084 10:52618750-52618772 CTGGAACTATGTTAGGTGCTAGG - Intergenic
1069458563 10:68573262-68573284 CTTGAACCTTAGAAACTGCTTGG + Exonic
1070574522 10:77667467-77667489 CTAGAACCACTGCAGGTGCTGGG - Intergenic
1073323742 10:102630803-102630825 CTGCCACCAGAGAAGGTGCTTGG + Exonic
1074489023 10:113922211-113922233 AGGGAACCACAGAAGGTTCTTGG - Intergenic
1075164387 10:120053924-120053946 CAGGCACTATAGCAGGTGCTAGG + Intergenic
1076002013 10:126919830-126919852 CAGGGACCACAGCAGGTGCTGGG - Intronic
1076320954 10:129580975-129580997 CAGGAATCAAAGCAGGTGCTTGG + Intronic
1076551879 10:131285024-131285046 CTGGATTCATAGAAGAAGCTGGG - Intronic
1077281199 11:1747040-1747062 CTGGTAGCAGAGCAGGTGCTGGG - Intronic
1078040015 11:7851633-7851655 CAGGAACTGCAGAAGGTGCTGGG - Intergenic
1079122849 11:17697381-17697403 CAGGACCCATAGCAGGTGCCTGG + Intergenic
1081456143 11:43224936-43224958 CTGGACCCATAGAGAATGCTAGG + Intergenic
1083553411 11:63607689-63607711 CTGCAATCATAGAAGCTGGTGGG + Intronic
1083740658 11:64709724-64709746 CTGGTACCAGATTAGGTGCTGGG + Intronic
1083777926 11:64903240-64903262 CTGGAGCCACAGCAGGTGCAGGG - Intronic
1084001512 11:66297626-66297648 CTGGAACCATGGAAGGGGGTTGG + Intergenic
1086013641 11:82137502-82137524 CTGGAGCCAAAGAAAGGGCTGGG + Intergenic
1086953004 11:92909822-92909844 CTGTCACCAGAGAAGGTGATGGG + Intergenic
1087927877 11:103941270-103941292 GGAGAACCATAGGAGGTGCTGGG + Intronic
1089091856 11:115885031-115885053 CTGGAGCCATAGCAGCTTCTAGG + Intergenic
1093205819 12:16247886-16247908 CTGGAACCCTAGTAGCTGCATGG + Intronic
1093914084 12:24781212-24781234 CATGAACAATAGATGGTGCTAGG - Intergenic
1094080384 12:26528219-26528241 CTGGAACCATTGAAAGTCATAGG - Intronic
1096575547 12:52550503-52550525 GTGCAACCATGGAGGGTGCTGGG - Intronic
1096763145 12:53860467-53860489 CTGGACCCAAAGAAGGTGGCTGG - Intergenic
1101112034 12:101495702-101495724 AGGGAACATTAGAAGGTGCTAGG - Intergenic
1102033837 12:109759834-109759856 CTGCCACCACCGAAGGTGCTTGG - Intronic
1102614491 12:114141516-114141538 CTGGAACACTGGAAGGGGCTGGG - Intergenic
1103517704 12:121518282-121518304 CTGGAACCAGATAAGATGCCAGG - Intronic
1110495990 13:76168474-76168496 ATGGAAATATAGAAGGTGCTAGG - Intergenic
1111204712 13:84990612-84990634 GTGCAACCATAGAAGGTGTCAGG + Intergenic
1111597223 13:90427639-90427661 CTGAAATCAGAGCAGGTGCTGGG - Intergenic
1114151738 14:20048319-20048341 CTGGAATCATAGATAGTCCTGGG - Intergenic
1114457474 14:22865560-22865582 CTAGAACCATGGAAGATGCACGG + Intergenic
1114960371 14:27880140-27880162 CTGGACTCATAGAATGTGTTTGG + Intergenic
1118489036 14:66241485-66241507 TTCAAACCATAGAAGGTGGTAGG - Intergenic
1118842454 14:69523473-69523495 CTGGAAGCTGAGTAGGTGCTTGG - Intronic
1119331337 14:73796268-73796290 CTGGAACCATACCAGGACCTGGG - Intergenic
1120738519 14:88082125-88082147 CGCGAACCATAGAAGCTGGTTGG + Intergenic
1123634319 15:22288450-22288472 TTAGAACCATAGATGATGCTGGG + Intergenic
1124662043 15:31557809-31557831 CTGGAACTCTAGAAAGTGCTTGG + Intronic
1126332666 15:47550244-47550266 ATGGACCCAGAGAAGATGCTTGG - Intronic
1126579231 15:50227784-50227806 CAGGCACCATGGTAGGTGCTGGG - Intronic
1128940581 15:71784727-71784749 CTGGAACCATATAACATGCCAGG - Intergenic
1130145859 15:81273265-81273287 CTGGGGCCATAGAAGATGTTGGG + Intronic
1131187463 15:90287215-90287237 CTGGGCCCATTGGAGGTGCTAGG + Intronic
1131423607 15:92327519-92327541 CTGGAGCCAGAGAAGTTCCTAGG - Intergenic
1135294599 16:21268380-21268402 CTGGAATCCTGAAAGGTGCTGGG + Intronic
1138371573 16:56531047-56531069 CAGGAACTGTTGAAGGTGCTTGG - Intergenic
1139563122 16:67756329-67756351 CTGGAACCCTGCAAGGGGCTAGG + Intronic
1139950557 16:70666274-70666296 CTGCTACCATAGAAGGGGGTGGG + Intronic
1140038998 16:71393028-71393050 GTGGAACCCTAGAAGGAGATAGG - Intergenic
1140055178 16:71519623-71519645 CTTGGCCCATAGAAGGCGCTTGG - Intronic
1140671955 16:77287963-77287985 CTGGAGGTATATAAGGTGCTTGG + Intronic
1141401506 16:83751152-83751174 CAGGCACCATGGTAGGTGCTGGG - Intronic
1141684239 16:85561418-85561440 CAGGAACCAGATAAGGGGCTCGG - Intergenic
1144251107 17:13417637-13417659 CTGGAGCCCCAGAAGTTGCTAGG + Intergenic
1144364195 17:14526245-14526267 GTGGAACCATAGGAGGAGTTTGG - Intergenic
1146558006 17:33843229-33843251 CAGGCACCATAGTAGGTTCTTGG - Intronic
1146909323 17:36638382-36638404 CTGGAAACATAGTAAGTGCTTGG + Intergenic
1147438319 17:40431497-40431519 CAGGAGCCACAGAGGGTGCTGGG + Intergenic
1148244278 17:46020396-46020418 CTGAAACCCCAGAGGGTGCTTGG - Intronic
1148551494 17:48553020-48553042 CTGGAAGCATAGAAGCCTCTGGG - Exonic
1149209540 17:54287797-54287819 CAGGGACCATAGCAGGTTCTTGG + Intergenic
1149695070 17:58610282-58610304 CTGGAAGGAGAGAAGGTGATGGG - Intronic
1152950603 17:83228147-83228169 TCAGACCCATAGAAGGTGCTAGG - Intergenic
1156118233 18:33812919-33812941 CTGGACTCATAGAATGTGTTAGG - Intergenic
1159409988 18:68060116-68060138 GTGGTACAATTGAAGGTGCTGGG - Intergenic
1159775558 18:72600017-72600039 CTGTAACCACAGGCGGTGCTTGG - Intronic
1160929488 19:1563493-1563515 CAGGAACCAGGGCAGGTGCTTGG - Intronic
1164845933 19:31432574-31432596 CTGGCACCATGGGAGATGCTAGG - Intergenic
1165389684 19:35531272-35531294 CTGGTCCCATGGCAGGTGCTTGG + Intergenic
1166739020 19:45103102-45103124 CAGGCACCATGGAGGGTGCTGGG - Intronic
1167263291 19:48470655-48470677 ATGGACCCCAAGAAGGTGCTTGG + Exonic
1167358809 19:49019224-49019246 CTTGAACAGCAGAAGGTGCTTGG - Intergenic
1168331851 19:55574956-55574978 AGAGAACCATCGAAGGTGCTGGG + Intergenic
925489949 2:4380242-4380264 CTGGCACCAAAGCAGTTGCTGGG + Intergenic
925613953 2:5727454-5727476 CTGGAACCAGAATATGTGCTAGG + Intergenic
925982512 2:9188835-9188857 CTGGAAACAGTGAAGATGCTCGG - Intergenic
926796176 2:16620945-16620967 GTGGAACCATGGAAGCTTCTTGG - Intronic
927055170 2:19360146-19360168 CTGGAATCTTAGCAGTTGCTAGG + Intergenic
927311095 2:21632179-21632201 CCTGAAACATAGAAGGTGCATGG + Intergenic
927862982 2:26571541-26571563 CTGGCACCATACTAAGTGCTGGG - Intronic
928087641 2:28355881-28355903 CTGGAACCCTAGAAGATGCGAGG - Intergenic
928738121 2:34316538-34316560 CTGAAGCCAGAGAATGTGCTTGG + Intergenic
929258073 2:39835153-39835175 CTGGAATCATAGAATGAGTTAGG + Intergenic
930839538 2:55830184-55830206 CTGGACTCATAGAATGAGCTGGG - Intergenic
931447930 2:62342610-62342632 CTTGACACATAGTAGGTGCTCGG - Intergenic
932096803 2:68857519-68857541 CTGGGAGCCTAGAAGGTGTTGGG - Intergenic
932463120 2:71896094-71896116 CTGGTACCTTAGAAGGAGCTGGG - Intergenic
932822801 2:74915705-74915727 CTGGGAGCAGAGCAGGTGCTGGG + Intergenic
936920620 2:117684981-117685003 CTGGTATCATAAAAGGTGTTTGG + Intergenic
942526659 2:176860495-176860517 CTGGAAGCATAAAGAGTGCTGGG - Intergenic
945711497 2:213302508-213302530 CAGGTACCATGAAAGGTGCTGGG - Intronic
945808499 2:214519297-214519319 CTAGGACCATGAAAGGTGCTTGG - Intronic
946916397 2:224527207-224527229 CTGAAAGCAGAGAAGGTGCCAGG + Intronic
947240990 2:227994435-227994457 CTGGAAACAGAGAAGGTGTGAGG - Intronic
947736145 2:232456514-232456536 CTGGAACCACTGAAGGTCCCGGG - Intronic
948072784 2:235140947-235140969 CTGGAACCATGGGAGCTACTTGG - Intergenic
1169027235 20:2381299-2381321 CTGGATCCATGGAATGTGCATGG - Intronic
1169157453 20:3344088-3344110 CTTGGACCATAGATGGTGATTGG - Intronic
1169191687 20:3662163-3662185 CTGGAGACAGAGAAGGTGCCTGG + Intronic
1170300427 20:14877978-14878000 CTGGCTCCATAGAAGGAGTTAGG + Intronic
1172186723 20:33035589-33035611 CTGGAAGCAGAGAAGGCACTGGG - Intronic
1178675206 21:34625733-34625755 CTGGAAGCAGAGAAGGTGTGTGG + Intergenic
1178733583 21:35128998-35129020 ATGGAACCACAGAATGTTCTAGG - Intronic
1179396288 21:41043403-41043425 CAGGAAGCATAGAAGCTTCTGGG + Intergenic
1180539536 22:16430637-16430659 CTGGAAAAATAGAAGCTACTAGG - Intergenic
1183518954 22:38285221-38285243 CTGGGACAAAAGAAGGGGCTGGG - Intergenic
1184062062 22:42089234-42089256 CTGCAACCAGAGAGGGTTCTGGG + Intronic
949936827 3:9122122-9122144 CTGGCACCAAAGTAAGTGCTCGG + Intronic
951367445 3:21801327-21801349 CTGGACCCATAGAATGAGTTAGG + Intronic
951656448 3:25014265-25014287 TTGGATCAATAGAATGTGCTGGG + Intergenic
952092242 3:29901797-29901819 CTGGAAAAATAGAAGTGGCTGGG + Intronic
952600292 3:35071863-35071885 CTGGTACCATCTAAAGTGCTGGG - Intergenic
953022116 3:39121237-39121259 CTGGACCCATGGAAGCTGCCCGG - Intronic
954206830 3:49065641-49065663 GAGGAACCCTAAAAGGTGCTTGG + Intronic
956481255 3:69675920-69675942 CAGGAAGCATAGAGGGAGCTTGG - Intergenic
958255691 3:91322126-91322148 CTGGCACTATTGTAGGTGCTGGG - Intergenic
959951343 3:112184032-112184054 CTGGAAGCAAAGAAGGCCCTAGG + Intronic
962346662 3:134623870-134623892 CTGGAGCCATCAAAGGGGCTGGG - Intronic
963777551 3:149454317-149454339 CTGGAAACATAGAAGGAAATAGG - Intergenic
964268192 3:154924191-154924213 CTGGCACCATACAATGTGTTGGG - Intergenic
969274466 4:6125404-6125426 CTGTAGCCATAGATGGAGCTGGG - Intronic
969289315 4:6228501-6228523 CTGGCACCATGCTAGGTGCTGGG + Intergenic
973263129 4:48185096-48185118 CTGTAACCCTAGAAGATGTTGGG - Intronic
975855604 4:78621441-78621463 TAGGAAACATAGAAGGTTCTTGG + Intergenic
976163641 4:82230243-82230265 CTGTATCCATAGCAGATGCTTGG - Intergenic
976206539 4:82627965-82627987 CTGGAAGGATAGAATGTTCTTGG - Intergenic
977802511 4:101253465-101253487 ATGTAACCCTTGAAGGTGCTTGG - Intronic
979375990 4:119947470-119947492 CTTGAACCCAAGAAGATGCTGGG + Intergenic
980155490 4:129099306-129099328 CAGGTACCATACCAGGTGCTGGG - Intronic
982120187 4:152135908-152135930 TTGGAATCCTAGAAAGTGCTTGG - Intergenic
983882498 4:172949221-172949243 CTGGAACCACACAAGATGCTAGG + Intronic
985285521 4:188332947-188332969 CTGGAACAGGAGAAGGAGCTTGG + Intergenic
986251613 5:6063628-6063650 CTGGCTCCATAGAATGAGCTAGG - Intergenic
989496112 5:42112972-42112994 CTGGAACCATTGCAGGTTCTTGG + Intergenic
989574159 5:42973606-42973628 CTGGAGCCATTGAAGGTGGATGG - Intergenic
990840404 5:60073522-60073544 CTGGCCTCATAGAATGTGCTGGG + Intronic
991662633 5:68966227-68966249 CTGGAGCCAGAGAAGGTGTGAGG - Intergenic
995607306 5:113870741-113870763 TTGAAACCATAGAAGGGACTGGG + Intergenic
997418179 5:133745228-133745250 CTGGGTCCATAGAAGGCCCTTGG - Intergenic
997744549 5:136287648-136287670 CTGACACTATAGCAGGTGCTGGG - Intronic
998314634 5:141171586-141171608 CTGGCATCATAGAATGTGTTAGG - Intergenic
1001260860 5:170227389-170227411 ATGGAAACACAGAAGGGGCTGGG + Intergenic
1002738687 5:181417378-181417400 CAGGCACCATCGCAGGTGCTGGG - Intergenic
1002744835 5:181461962-181461984 TCAGACCCATAGAAGGTGCTAGG - Intergenic
1003617430 6:7668357-7668379 CTGAAATCACAGAAGGTGTTTGG + Intergenic
1003656426 6:8014743-8014765 CTGGAACCATATAAAGTTCCTGG - Exonic
1003979161 6:11373592-11373614 CAGGCACCATATTAGGTGCTGGG - Intronic
1004959373 6:20769097-20769119 CTGGAACCGTACATGGTCCTGGG - Intronic
1005043525 6:21620621-21620643 CTGAAATCATAGCAGGTGCTGGG + Intergenic
1006632143 6:35437167-35437189 CTGGAACCATGCTAAGTGCTGGG - Intergenic
1007440037 6:41851128-41851150 CTGGCATCATAGAATGAGCTTGG - Intronic
1008999654 6:57699039-57699061 CTGGCACTATTGTAGGTGCTGGG + Intergenic
1009568347 6:65345139-65345161 CTGGAAAAAAAGAAGGAGCTAGG + Intronic
1011740062 6:90350563-90350585 CAGACACTATAGAAGGTGCTAGG - Intergenic
1012152596 6:95773439-95773461 CTGGAAAGATTGAATGTGCTTGG - Intergenic
1012796555 6:103769643-103769665 CTAGAACAATAGAAGGTAATGGG - Intergenic
1014489320 6:122042779-122042801 CTGGAACTTGAGATGGTGCTTGG - Intergenic
1014505404 6:122248340-122248362 CTCGCACCAGAGCAGGTGCTGGG + Intergenic
1014599377 6:123390540-123390562 CTGGATCCCTTGAAGGTGCATGG + Intronic
1016230117 6:141793150-141793172 CTGGCCCCATAGAAGGAGTTTGG - Intergenic
1016565239 6:145444587-145444609 CTGGACCCATAGAATGAGTTGGG + Intergenic
1017130047 6:151100447-151100469 CTGGAGCCAGATAAGGTGCTTGG - Intronic
1017698313 6:157041738-157041760 CAGAAAACAGAGAAGGTGCTGGG - Intronic
1019243791 6:170692930-170692952 CAGGCACCATCGCAGGTGCTGGG - Intergenic
1019541153 7:1551445-1551467 ATGCAAACATAGAAGGTGCCTGG - Intronic
1019803436 7:3105254-3105276 CTGGGGCCAGAGAAGGGGCTTGG - Intergenic
1021594849 7:22304004-22304026 GTGCAACCATAGAAAGTACTGGG + Intronic
1022563700 7:31375420-31375442 CTGGAACCATTGAAGGATTTGGG - Intergenic
1023760290 7:43459271-43459293 CTGGTACCACACTAGGTGCTGGG - Intronic
1023853953 7:44169375-44169397 GTGGGGCCTTAGAAGGTGCTAGG + Intronic
1025192034 7:56903087-56903109 CTGGGGCCATGGATGGTGCTAGG - Intergenic
1025679918 7:63673844-63673866 CTGGGGCCATGGATGGTGCTAGG + Intergenic
1027995719 7:85423608-85423630 CTGAAATCAGAGCAGGTGCTGGG - Intergenic
1029241469 7:99166290-99166312 CTAGAAACATAGTAGGTGCTAGG - Intergenic
1029505411 7:100960883-100960905 CTGGAACCATAGAAGGTGCTGGG - Exonic
1029943500 7:104506530-104506552 CAGGCACCACAGTAGGTGCTGGG - Intronic
1031275595 7:119718086-119718108 CTGCAATCATACAAGGTACTTGG + Intergenic
1031723956 7:125212791-125212813 CTGCATCAATAGAAGGAGCTTGG + Intergenic
1035498350 8:72153-72175 TCAGACCCATAGAAGGTGCTAGG + Intergenic
1035504332 8:115230-115252 CAGGCACCATCGCAGGTGCTGGG + Intergenic
1036183537 8:6605101-6605123 CTGGTCCCACAGCAGGTGCTTGG + Intronic
1039418713 8:37418038-37418060 AAGGAACCATCGAAGGTACTGGG + Intergenic
1040995001 8:53392276-53392298 CTGGACCCAAGAAAGGTGCTGGG - Intergenic
1045436228 8:102167686-102167708 CTTCAACCATAGGAGCTGCTAGG - Intergenic
1046009761 8:108532099-108532121 CTAGATACATAGTAGGTGCTTGG + Intergenic
1047241882 8:123098279-123098301 CTGGAAGAATAGAAGGTGCAAGG - Intronic
1047532897 8:125693446-125693468 CTGGTACAATGGAAAGTGCTCGG - Intergenic
1049587259 8:143437817-143437839 CTGGCACCCTGGAAGGTGGTGGG + Exonic
1050288523 9:4129635-4129657 CAGGAAGCATAGAAGCTTCTGGG - Intronic
1052379870 9:27758448-27758470 CAGGAACCAGAGTAGGTCCTAGG + Intergenic
1054931422 9:70639454-70639476 CTGGATCCCAAGAAGGTGCAAGG + Intronic
1055197607 9:73615392-73615414 CTTGAACCAAAGAAAATGCTTGG - Intergenic
1055861132 9:80750619-80750641 CTGAAGCAATAAAAGGTGCTGGG - Intergenic
1057218263 9:93241655-93241677 GTGATACCATGGAAGGTGCTTGG + Intronic
1057779093 9:98035325-98035347 CTGGTACCACAGCAGGTGCTGGG - Intergenic
1061486509 9:130923170-130923192 GCGGGACCACAGAAGGTGCTGGG - Intronic
1062101350 9:134730273-134730295 CTGAAACCAGTGAAGGGGCTGGG + Exonic
1203603980 Un_KI270748v1:42153-42175 CAGGCACCATCGCAGGTGCTGGG - Intergenic
1203610646 Un_KI270748v1:92441-92463 TCAGACCCATAGAAGGTGCTAGG - Intergenic
1186510877 X:10128885-10128907 ATGCCTCCATAGAAGGTGCTGGG + Intronic
1187080945 X:15987251-15987273 CTTAAACCATAAAAGTTGCTAGG + Intergenic
1187200384 X:17128584-17128606 CAGGGACCATGGTAGGTGCTTGG - Intronic
1187429274 X:19206769-19206791 CAGGCACCATACCAGGTGCTGGG - Intergenic
1190405902 X:50087275-50087297 ATTGAACCAAAGAAGTTGCTGGG + Intronic
1190998754 X:55637388-55637410 CTGAAATCATAGTGGGTGCTGGG - Intergenic
1191972810 X:66836355-66836377 CTGGCACCATAGAATGAGTTTGG - Intergenic
1192140842 X:68646464-68646486 CTGGGACCCTGGAAGGTCCTAGG - Intergenic
1195756501 X:108204210-108204232 CTGGAAGAATAGAGGGTTCTGGG - Intronic
1198031255 X:132755573-132755595 CTGGAACCAAGGATGGTGTTAGG + Intronic
1200254248 X:154571113-154571135 CTGTCACCATAAATGGTGCTTGG + Intergenic
1200263521 X:154633295-154633317 CTGTCACCATAAATGGTGCTTGG - Intergenic
1200959187 Y:8981644-8981666 CAGGAACCATTGCAGGTTCTTGG + Intergenic
1202305704 Y:23468114-23468136 TTAGAACCATAGATGATGCTGGG + Intergenic
1202386037 Y:24327202-24327224 CAGGCACCATCGTAGGTGCTGGG - Intergenic
1202484749 Y:25342926-25342948 CAGGCACCATCGTAGGTGCTGGG + Intergenic
1202565105 Y:26202475-26202497 TTAGAACCATAGATGATGCTGGG - Intergenic