ID: 1029507074

View in Genome Browser
Species Human (GRCh38)
Location 7:100969009-100969031
Sequence CACTCACACCTGAGACTTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029507074_1029507089 21 Left 1029507074 7:100969009-100969031 CCATAAAGTCTCAGGTGTGAGTG No data
Right 1029507089 7:100969053-100969075 GCTGGAAACTGGGGACCCCAGGG No data
1029507074_1029507078 -2 Left 1029507074 7:100969009-100969031 CCATAAAGTCTCAGGTGTGAGTG No data
Right 1029507078 7:100969030-100969052 TGGGCCCTCTGCCCAGGAGAAGG No data
1029507074_1029507088 20 Left 1029507074 7:100969009-100969031 CCATAAAGTCTCAGGTGTGAGTG No data
Right 1029507088 7:100969052-100969074 GGCTGGAAACTGGGGACCCCAGG No data
1029507074_1029507087 12 Left 1029507074 7:100969009-100969031 CCATAAAGTCTCAGGTGTGAGTG No data
Right 1029507087 7:100969044-100969066 AGGAGAAGGGCTGGAAACTGGGG No data
1029507074_1029507085 10 Left 1029507074 7:100969009-100969031 CCATAAAGTCTCAGGTGTGAGTG No data
Right 1029507085 7:100969042-100969064 CCAGGAGAAGGGCTGGAAACTGG No data
1029507074_1029507079 -1 Left 1029507074 7:100969009-100969031 CCATAAAGTCTCAGGTGTGAGTG No data
Right 1029507079 7:100969031-100969053 GGGCCCTCTGCCCAGGAGAAGGG No data
1029507074_1029507086 11 Left 1029507074 7:100969009-100969031 CCATAAAGTCTCAGGTGTGAGTG No data
Right 1029507086 7:100969043-100969065 CAGGAGAAGGGCTGGAAACTGGG No data
1029507074_1029507077 -8 Left 1029507074 7:100969009-100969031 CCATAAAGTCTCAGGTGTGAGTG No data
Right 1029507077 7:100969024-100969046 TGTGAGTGGGCCCTCTGCCCAGG No data
1029507074_1029507082 3 Left 1029507074 7:100969009-100969031 CCATAAAGTCTCAGGTGTGAGTG No data
Right 1029507082 7:100969035-100969057 CCTCTGCCCAGGAGAAGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029507074 Original CRISPR CACTCACACCTGAGACTTTA TGG (reversed) Intergenic
No off target data available for this crispr