ID: 1029507547

View in Genome Browser
Species Human (GRCh38)
Location 7:100971444-100971466
Sequence TTACCTCGAAGGTGTCCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 58}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029507547_1029507558 20 Left 1029507547 7:100971444-100971466 CCTGCAGGACACCTTCGAGGTAA 0: 1
1: 0
2: 0
3: 6
4: 58
Right 1029507558 7:100971487-100971509 ATCCTCCCAGCCAGGGACTCAGG No data
1029507547_1029507555 13 Left 1029507547 7:100971444-100971466 CCTGCAGGACACCTTCGAGGTAA 0: 1
1: 0
2: 0
3: 6
4: 58
Right 1029507555 7:100971480-100971502 TTCCACCATCCTCCCAGCCAGGG 0: 1
1: 0
2: 2
3: 46
4: 336
1029507547_1029507554 12 Left 1029507547 7:100971444-100971466 CCTGCAGGACACCTTCGAGGTAA 0: 1
1: 0
2: 0
3: 6
4: 58
Right 1029507554 7:100971479-100971501 GTTCCACCATCCTCCCAGCCAGG 0: 1
1: 0
2: 1
3: 32
4: 296
1029507547_1029507563 30 Left 1029507547 7:100971444-100971466 CCTGCAGGACACCTTCGAGGTAA 0: 1
1: 0
2: 0
3: 6
4: 58
Right 1029507563 7:100971497-100971519 CCAGGGACTCAGGCCCTCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029507547 Original CRISPR TTACCTCGAAGGTGTCCTGC AGG (reversed) Intronic
900458567 1:2789444-2789466 CTACCTCGAAGGAGACCCGCAGG + Intronic
905208192 1:36355014-36355036 TCACCAGGAAGGTGGCCTGCAGG + Intronic
906163852 1:43671194-43671216 TTTCCTCCAAAGTCTCCTGCAGG - Intronic
907397919 1:54205007-54205029 TTACCTCAAAGGTGTAAAGCAGG + Exonic
912764677 1:112397293-112397315 TAACCTTGAAGGTATACTGCAGG + Intronic
915355002 1:155250621-155250643 TTTCCTCGAAGGGGCCCCGCAGG + Exonic
918146293 1:181758826-181758848 TTCCCTGGAATGTGTCCTGAAGG + Exonic
923959371 1:239059327-239059349 CTTCCTCGAAGGTGTCCAGCAGG + Intergenic
924568214 1:245215297-245215319 TTACCTGGACCGTGTCATGCTGG - Intronic
1065571107 10:27071939-27071961 CTACCTCACAGGCGTCCTGCCGG + Intronic
1068042123 10:51838567-51838589 TTACTTGGAAAGTGTCCTGCAGG + Intronic
1076571523 10:131436261-131436283 CAGCCCCGAAGGTGTCCTGCTGG - Intergenic
1080136653 11:28862949-28862971 TTACCTCCATGCTGTCCTTCAGG + Intergenic
1081814732 11:45932215-45932237 TTCCCTCGGAGGTGTCCCCCAGG + Intronic
1085058249 11:73420886-73420908 TTACCTTCATGGTGTCCTGAGGG + Intronic
1085517302 11:77119023-77119045 TGACTTCGAAGATGTACTGCAGG - Exonic
1091344056 11:134840913-134840935 GTATCTCGAAGGTGGCTTGCTGG - Intergenic
1100282007 12:93127236-93127258 TTGCCTCCAAGCTGTCCTGCAGG + Intergenic
1112591610 13:100768393-100768415 TTCCTTTGAATGTGTCCTGCTGG + Intergenic
1118081439 14:62366173-62366195 TTACCTCGAGGCTGTCTTACTGG + Intergenic
1121542075 14:94735690-94735712 CTACCTTGAAGGCGTCATGCTGG + Intergenic
1122784468 14:104157481-104157503 CTGCCTCCAAGGAGTCCTGCTGG + Intronic
1123934944 15:25189582-25189604 GCACCCCGAAGGTGTCCTTCAGG - Intergenic
1141720960 16:85754978-85755000 TCACCTCCTAGGGGTCCTGCAGG + Intergenic
1145917506 17:28584146-28584168 TTACCTCCAAGGTCTCTTTCAGG + Exonic
1146524137 17:33551736-33551758 TTACATCGAAGGGATCCTGATGG - Intronic
1148612454 17:48973436-48973458 TCACTTCCAAGGAGTCCTGCTGG + Intergenic
1152883328 17:82832979-82833001 TTTCCTCGAAAGCGCCCTGCCGG + Intronic
1158131155 18:54153793-54153815 TTTCCTTGAAGCAGTCCTGCTGG - Exonic
1160775208 19:852358-852380 TTTCCTCGCCTGTGTCCTGCCGG + Exonic
1168710746 19:58498676-58498698 TGACCTCCATGGCGTCCTGCAGG + Exonic
944398887 2:199302735-199302757 TTCCCTGGAAGATGTCCTTCAGG + Intronic
1179882218 21:44297649-44297671 TGCCATCGAAGGTGTGCTGCGGG - Exonic
1179980288 21:44891981-44892003 TCACCTGGAAGGTGATCTGCAGG + Exonic
1181685371 22:24524306-24524328 TTAACTCGAAGGTCCCATGCTGG + Intronic
1184456999 22:44616515-44616537 TGATCTCTAAGGTGTCCTGGTGG - Intergenic
949522562 3:4870015-4870037 TTACTTTGAAGCTGTCCTGATGG + Intronic
961013663 3:123450929-123450951 TTGCCCCCAAGCTGTCCTGCTGG + Intergenic
961819723 3:129569807-129569829 TGCCCTCCAAGGTGTCCTGAGGG + Intronic
964153143 3:153552797-153552819 TTACCTCAGAGGTATCTTGCTGG - Intergenic
964623004 3:158734019-158734041 TTGCCTAGAAGGTGTGCTCCAGG - Intronic
965633885 3:170761229-170761251 TTCCTTCTAAGGTATCCTGCAGG + Intronic
966465312 3:180225231-180225253 TTTCCTGTAATGTGTCCTGCAGG + Intergenic
967849805 3:194073172-194073194 TTACCTTGAATGTGGCCAGCTGG - Intergenic
968668545 4:1834910-1834932 TCTCCTCGATGGTGTCCTGGAGG + Exonic
971359118 4:25920710-25920732 TTACCTTGAATGAATCCTGCAGG - Intronic
977206762 4:94171825-94171847 TTACCACTAGGGTGCCCTGCTGG - Intergenic
990754439 5:59052746-59052768 TTCCCTAGAAGGTGGCCTCCAGG + Intronic
991203842 5:64026213-64026235 TTACTTTGAAGGTATCCTACTGG - Intergenic
999007306 5:147996880-147996902 TAAACTCCAAGGTGTTCTGCTGG + Intergenic
1000283472 5:159803757-159803779 TTGCCTCCAAGGTGTCTTCCAGG + Intergenic
1002462316 5:179380546-179380568 GTTCCTCGAAGGTTTCCTGCTGG - Intergenic
1005475874 6:26207305-26207327 TTACCTCCATGCTTTCCTGCTGG - Intergenic
1029507547 7:100971444-100971466 TTACCTCGAAGGTGTCCTGCAGG - Intronic
1042673144 8:71286285-71286307 TTACCACGAGGGTGTGCTCCTGG - Intronic
1045173548 8:99696647-99696669 TCTCCTCGATGGTGTCCTGGAGG - Intronic
1047855783 8:128910117-128910139 TCTCCTTGAAGGTGTCCTACAGG - Intergenic
1048881921 8:138878197-138878219 CCACCTCGAAGGTGTCCACCAGG + Exonic
1051478825 9:17537931-17537953 TTACCTGGGAGGTCTCCTGCAGG + Intergenic
1057510779 9:95678196-95678218 GTATCTCTAAGGTGTTCTGCAGG - Intergenic
1059141572 9:111857871-111857893 TTACCTTGAAGGTCTACTGACGG - Intergenic
1060936991 9:127521716-127521738 GTGCCAGGAAGGTGTCCTGCCGG - Intronic
1203785799 EBV:126798-126820 TTCCCTCGGTGGTGTCCTGCCGG + Intergenic
1188435403 X:30152840-30152862 TTCCCTTGAAGAGGTCCTGCAGG - Intergenic
1189170229 X:38901837-38901859 TTACATAGAAGGTGCCATGCTGG + Intergenic